ID: 1162496861

View in Genome Browser
Species Human (GRCh38)
Location 19:11028183-11028205
Sequence TGCTGGGCGCACTGGGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 323}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162496850_1162496861 19 Left 1162496850 19:11028141-11028163 CCGGGTGTCCTGACTCCTAGGCT 0: 2
1: 1
2: 8
3: 77
4: 433
Right 1162496861 19:11028183-11028205 TGCTGGGCGCACTGGGGAAGGGG 0: 1
1: 0
2: 1
3: 28
4: 323
1162496852_1162496861 4 Left 1162496852 19:11028156-11028178 CCTAGGCTGACAGTCTTTCCACG 0: 1
1: 0
2: 1
3: 6
4: 129
Right 1162496861 19:11028183-11028205 TGCTGGGCGCACTGGGGAAGGGG 0: 1
1: 0
2: 1
3: 28
4: 323
1162496851_1162496861 11 Left 1162496851 19:11028149-11028171 CCTGACTCCTAGGCTGACAGTCT 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1162496861 19:11028183-11028205 TGCTGGGCGCACTGGGGAAGGGG 0: 1
1: 0
2: 1
3: 28
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162496861 Original CRISPR TGCTGGGCGCACTGGGGAAG GGG Intronic
900592241 1:3465300-3465322 TGCTGGGAGCACAGAGGAGGGGG + Intronic
902865311 1:19274015-19274037 TGCTGGGCGCCATGGAGATGGGG - Intergenic
902867428 1:19288650-19288672 TGCTGGGCGCCATGGAGATGGGG - Exonic
903180282 1:21601799-21601821 TGCGGGGCACACGGGGGCAGCGG + Intronic
903227031 1:21899761-21899783 CCCGGGGCTCACTGGGGAAGGGG - Intronic
903855537 1:26336050-26336072 GGCTGGGGGCGCTGGGGCAGAGG - Intronic
904267524 1:29326223-29326245 TGCAGGGGGCAGTGGGGAGGAGG - Intronic
904311717 1:29633375-29633397 TGCTGGGTGAACTTGGGCAGGGG - Intergenic
904474160 1:30754097-30754119 TTCCGGGCACTCTGGGGAAGAGG + Intronic
905334985 1:37238957-37238979 TTCTGGGCCCTCTGGGGGAGGGG + Intergenic
906077613 1:43063580-43063602 GGCTGTGGGCACTGGGGAAGCGG - Intergenic
906802753 1:48751813-48751835 TCCTGGGGGCAGTGGGGATGGGG - Intronic
907487735 1:54788875-54788897 TGCTGGGTGCTCTGGGAATGTGG + Intronic
908523365 1:64966046-64966068 TGCCGTGCGCGCTGGGGGAGGGG + Intronic
909013031 1:70355150-70355172 TGCAGGGAGCACTGTAGAAGAGG + Intronic
909490570 1:76221532-76221554 CTCAGGGAGCACTGGGGAAGGGG - Intronic
910673412 1:89795369-89795391 TGGTGGGCTCACTGGGAAACTGG + Intronic
911392832 1:97268161-97268183 TCCTGGACACACTGGGGCAGGGG + Intronic
912546636 1:110456100-110456122 TGCTAGGTGCAGTGGAGAAGTGG + Intronic
915299107 1:154941897-154941919 GGCTGAGGGCACTGGGGAAAGGG + Intergenic
915467765 1:156107254-156107276 TGCTGGGCTCACTGAGCCAGCGG - Intronic
915490212 1:156246475-156246497 CACAGGGCGCTCTGGGGAAGGGG + Intronic
915602197 1:156929458-156929480 TGCTGGACGGACAGGGGAGGGGG + Intronic
917490513 1:175494179-175494201 AGCTGGGCTCTCTGGGGATGTGG + Intronic
917975377 1:180234601-180234623 TGCGGAGCGCACTGGGACAGCGG - Intronic
919727214 1:200891982-200892004 TGGAGGGCGCAGTGGGGGAGGGG + Intronic
919858472 1:201721719-201721741 TGCTGGGAGCTCTTGGGAGGTGG - Intronic
921149393 1:212387515-212387537 AGCTGGGAGAACTGGGGAAGTGG - Intronic
924284108 1:242467894-242467916 TACTGGGGGCACAGTGGAAGGGG - Intronic
1067294557 10:44967828-44967850 TGCAGGGCCCAGTGGGGAAATGG + Intronic
1067318702 10:45198009-45198031 TGCTGGGAGGCCTGGGGACGAGG - Intergenic
1067344293 10:45426916-45426938 TGCTGGGAGCATTGGGAAACAGG - Intronic
1067655046 10:48185493-48185515 TGCTGGGCAAAGTGGGGAGGTGG - Intronic
1069774404 10:70918446-70918468 TCCTTGGGGCTCTGGGGAAGGGG - Intergenic
1071337963 10:84617119-84617141 TTCTGGACACACTGGGGCAGGGG - Intergenic
1071489714 10:86128084-86128106 TGCTGGTGGCACAGAGGAAGGGG - Intronic
1072915154 10:99533245-99533267 TGCAGGGCGCAGAGTGGAAGTGG - Exonic
1074080402 10:110163999-110164021 TGCTGAGGGCTCTGGGGACGGGG + Intergenic
1074758567 10:116646816-116646838 TGCTGGGGGCAAATGGGAAGTGG - Intergenic
1074776589 10:116771855-116771877 TGCTGGGGGCGGTGGGGAGGTGG + Intergenic
1075277690 10:121109528-121109550 TGTTGGGAGCACAGGGGGAGGGG - Intergenic
1075427238 10:122351314-122351336 TGCTGGACAGACTGGGGATGGGG + Intergenic
1075448129 10:122528002-122528024 TGCTGGGGGAACTGGGTCAGAGG - Intergenic
1075999697 10:126905236-126905258 GGCTGGGCGCACTGGGACAGAGG + Intergenic
1076149311 10:128149958-128149980 GGCTGGGGGCACTGCGGAGGGGG - Intergenic
1076250960 10:128983454-128983476 GCCTGGGGGCTCTGGGGAAGGGG - Intergenic
1077952817 11:6979822-6979844 TGCTGAGAGGACTGGGGATGGGG + Intronic
1078328013 11:10396201-10396223 TGCTAGGCGCACAGTGAAAGAGG + Intronic
1078350448 11:10588682-10588704 GGTTGGGGGAACTGGGGAAGTGG - Intronic
1078355554 11:10629327-10629349 TCCTAGGCCCTCTGGGGAAGAGG - Intronic
1078518811 11:12047343-12047365 TACTGGCAGCCCTGGGGAAGAGG - Intergenic
1078549350 11:12269656-12269678 TGCTGAGGGCCGTGGGGAAGGGG + Intergenic
1078929635 11:15903281-15903303 TGCTGGGTGCAGTGGAGTAGTGG + Intergenic
1080300194 11:30775606-30775628 TGCTTGGTGGACTTGGGAAGGGG - Intergenic
1080925607 11:36753020-36753042 TGTTGGGCCCTCTAGGGAAGTGG + Intergenic
1081590366 11:44418684-44418706 TGCTGGGCTCCGCGGGGAAGAGG + Intergenic
1081935929 11:46903966-46903988 TGCTGGGCACGCTGGGGAGGGGG - Intronic
1082213391 11:49535084-49535106 TGGTGGGCTCTCTGGGGAACTGG + Intergenic
1083613568 11:64015677-64015699 AGCTGTGAGCCCTGGGGAAGGGG - Intronic
1083697004 11:64449730-64449752 TGCAGGGGGCCCTGGGGCAGAGG - Intronic
1088987435 11:114921993-114922015 TGCTTGGAGCAGTGAGGAAGAGG + Intergenic
1089611118 11:119669764-119669786 ACCTGGGGGCCCTGGGGAAGTGG - Intronic
1091622477 12:2099798-2099820 TGCTGGGGGTAATGGGGAAGCGG - Intronic
1092148420 12:6230675-6230697 TGCATGGAGCACTGGGTAAGAGG - Intronic
1094305047 12:29009199-29009221 TTCTGGGCCCACGGGGGCAGTGG + Intergenic
1094783738 12:33821841-33821863 TTCTGGGCACACTGGGGTGGGGG + Intergenic
1095448772 12:42307692-42307714 TGCTGGGACCACTGGGAAAGGGG + Intronic
1096803706 12:54127617-54127639 TGCGGGGTGGCCTGGGGAAGTGG + Intergenic
1097263536 12:57733069-57733091 GGCTGGGTCCACTGGGGATGGGG + Intronic
1100315650 12:93442078-93442100 GGCGGGGCGCACGGGGGAGGGGG - Exonic
1100483619 12:95003696-95003718 TGCTCGGCGCACCCGGGAGGCGG - Exonic
1101515805 12:105434201-105434223 TCCTGGGCACACTGGGGTGGGGG + Intergenic
1101610378 12:106285932-106285954 TGCTGGGCTCAATGCAGAAGTGG - Intronic
1101966895 12:109287845-109287867 TGCTGGGCACCCGGGGGGAGCGG + Exonic
1102053390 12:109879455-109879477 TCCTGGGCGCATTGGGAAGGCGG - Intronic
1103483647 12:121267872-121267894 TGCTGGGGGCTCTGGGGAACAGG - Intronic
1103561673 12:121796138-121796160 CGCTGGGCCCACTGAGGAACTGG + Intronic
1103685660 12:122730238-122730260 TGCTGGGCGCACTAGGCAATGGG - Exonic
1104061475 12:125272221-125272243 TGCTGGGAGGACTTGGGAAAGGG + Intronic
1104848195 12:131857720-131857742 TGCTGGGTGCTCTGGGGCAGTGG + Intergenic
1105016082 12:132787537-132787559 TCCTGGGGGCTCTGGGGGAGGGG - Intronic
1105492484 13:20902446-20902468 TGCTGGGCAGCCAGGGGAAGGGG + Intronic
1105541743 13:21321783-21321805 AGCTGGGGGCAGTGGGGAATAGG + Intergenic
1107090938 13:36478853-36478875 TGCTGGGCAGATTGGGGATGGGG - Intergenic
1108314162 13:49221313-49221335 AGCTGGGCGAGCAGGGGAAGGGG - Intronic
1112117098 13:96368080-96368102 TGCTGGGCTCTGTGGGGTAGAGG - Intronic
1113534093 13:111050389-111050411 TGGGGTGCGCAGTGGGGAAGGGG + Intergenic
1113874192 13:113584552-113584574 TGCTGCGCGCCCTGGGAGAGCGG - Intergenic
1113938080 13:114005701-114005723 TGCTGGGTGCTCTGGGGACTGGG + Intronic
1114522566 14:23348305-23348327 AGCTGGGGGCAGGGGGGAAGGGG + Exonic
1117113780 14:52488320-52488342 TGCTGGGCAGGATGGGGAAGGGG + Intronic
1122652525 14:103233216-103233238 TGCTGGGGGCGCTGGGGCATTGG - Intergenic
1122817338 14:104320184-104320206 TCCTGGGCTGCCTGGGGAAGGGG - Intergenic
1122887094 14:104714920-104714942 TGCAGTGCCCAATGGGGAAGGGG - Intronic
1123410386 15:20054103-20054125 TCCTGTGCACACTGGGGAGGGGG + Intergenic
1123519718 15:21060810-21060832 TCCTGTGCACACTGGGGAGGGGG + Intergenic
1124101941 15:26703820-26703842 TCCTGGACACACTGGGGTAGAGG + Intronic
1124212763 15:27776902-27776924 TGCTGCGGGCCCTGGTGAAGGGG - Intronic
1124905818 15:33867634-33867656 TGCTGACTGCAGTGGGGAAGTGG + Exonic
1125062677 15:35442860-35442882 AGCTGGGAGCAGTGGGGCAGGGG + Intronic
1125833032 15:42729654-42729676 TTCTGGGTGCGCTGGGGGAGGGG - Intronic
1128344915 15:66847692-66847714 TCCTGGGGGCACTGGGGATGTGG - Intergenic
1129753752 15:78083537-78083559 TGTTGGGGGTACTGGGGCAGGGG + Intronic
1130907702 15:88251979-88252001 TGCTGGGCTTCCTGGGGCAGGGG + Intronic
1131058175 15:89388782-89388804 TCCTGGGAGCCCTGGGGAGGAGG + Intergenic
1131066796 15:89439758-89439780 TTCTGGGGGCACTGGGGACATGG - Intergenic
1131087857 15:89592052-89592074 TGCTGGGCCCACTCTGGAACAGG - Exonic
1131512828 15:93058847-93058869 TGGGGGCCTCACTGGGGAAGAGG + Intronic
1132402788 15:101523629-101523651 TCCTGGGCCCGCTGGGGGAGTGG + Intronic
1132457913 16:34217-34239 TGCTGGGCCCACTGTGGGGGTGG + Intergenic
1132693924 16:1193809-1193831 TGCTGGGGTCCCTGGGGGAGGGG + Intronic
1132881585 16:2163950-2163972 TGCTGGGCCCCCCGGAGAAGCGG - Exonic
1133017559 16:2951307-2951329 GGCTGGGACCACTGGGGAATGGG - Intergenic
1134218308 16:12333643-12333665 GACTGGGAGCCCTGGGGAAGAGG - Intronic
1134261009 16:12650819-12650841 TGGAGGGCACACTGGGGAACTGG + Intergenic
1135800392 16:25488913-25488935 TGCAGGCAGCAATGGGGAAGGGG + Intergenic
1136188581 16:28602087-28602109 TGCTGGGCTCACTCGGGAGATGG + Intergenic
1136191051 16:28615081-28615103 TGCTGGGCTCACTCGGGAGATGG + Intronic
1136566311 16:31072899-31072921 TCCTGAGGGCACTAGGGAAGGGG - Intronic
1138493102 16:57388391-57388413 TGCAGGGTGGACTGAGGAAGAGG - Intergenic
1138659648 16:58509610-58509632 TGCTGGGCCTACTGGGGGAAGGG + Intronic
1139361488 16:66402566-66402588 TGCAGGGGGCAGTGGGGATGGGG + Intronic
1139398723 16:66662661-66662683 TGGTGGGAGGACAGGGGAAGGGG - Intronic
1139473957 16:67193190-67193212 TGCTGGGGGGAGTGGGCAAGGGG + Intronic
1139689256 16:68629495-68629517 TGCTGTGCACACTCGGGTAGGGG - Intergenic
1140266798 16:73428211-73428233 CCCTGGGGTCACTGGGGAAGGGG - Intergenic
1141663156 16:85452612-85452634 GCCTGGGCCCACTGGGGCAGGGG - Intergenic
1141675721 16:85516191-85516213 TCCTGGGAGGCCTGGGGAAGGGG + Intergenic
1141996813 16:87641131-87641153 TGCTGGGACCTCTGGGCAAGAGG + Intronic
1142894353 17:2964355-2964377 GGCTGGGGGCCCTGGGGGAGAGG + Intronic
1144888018 17:18477142-18477164 TCCTGTGCGCTCAGGGGAAGAGG + Intronic
1145144189 17:20467161-20467183 TCCTGTGCGCTCAGGGGAAGAGG - Intronic
1145175644 17:20698574-20698596 TCCTGTGCGCTCAGGGGAAGAGG - Intergenic
1146901344 17:36591697-36591719 GGCAGCGCTCACTGGGGAAGCGG + Intergenic
1147742279 17:42676159-42676181 TGCTGGGGGCCCTGAGGCAGGGG - Intronic
1147965380 17:44191951-44191973 TGCTGGGGTCATTGGGGGAGGGG - Exonic
1148605830 17:48928225-48928247 AGCTGGGGGCACGGGGGAGGCGG - Exonic
1150561940 17:66302379-66302401 TGCTGGGAACACTGGGCAAGGGG - Intergenic
1150611775 17:66739201-66739223 TGCTGGGTGAAATGGGAAAGTGG + Intronic
1151413821 17:73948453-73948475 GGGTGGGCCCACTGGGGCAGTGG + Intergenic
1151454934 17:74220564-74220586 TGCAGGGCCCTCTGGTGAAGGGG + Intronic
1151915960 17:77118169-77118191 GGCAGGCCGCACTGTGGAAGGGG + Intronic
1151944247 17:77310913-77310935 TGATGGGGGCACTGGGGAAAAGG - Intronic
1152109989 17:78352789-78352811 CGCTGGGCGCGTGGGGGAAGGGG - Intergenic
1152522155 17:80862879-80862901 TGCTGAGAACACTGGGGGAGTGG - Intronic
1152568610 17:81111449-81111471 TGTTGGGCCCACTGGGGACCGGG + Intronic
1152686652 17:81696967-81696989 TGCTGGGCATGCTGGGGTAGGGG - Exonic
1155113661 18:22742336-22742358 TGCTGGGTACACTGAGGGAGGGG - Intergenic
1156386143 18:36606919-36606941 TCCTGGGCACACTGGGGTTGGGG + Intronic
1157573503 18:48729201-48729223 TGCTGGACCCCCTGGGTAAGAGG - Intronic
1157776712 18:50401980-50402002 TGCAGGGGTCTCTGGGGAAGGGG - Intergenic
1158405354 18:57155119-57155141 GGCTGGGCTCACTGCAGAAGGGG - Intergenic
1158428740 18:57363941-57363963 AGCTGGGCTCACAGGGAAAGTGG + Exonic
1158721960 18:59933020-59933042 GGCTGGCCCCACTGGGGATGGGG - Intergenic
1159014174 18:63088314-63088336 TGCTGGGGGCAGTGGGGAAGGGG - Intergenic
1159477960 18:68948701-68948723 TGCTGGGAGTAGTGGGGAAATGG - Intronic
1160204761 18:76823044-76823066 CGCGGGGCGCGCTGGGGAGGCGG + Intronic
1160788340 19:912125-912147 TGGGGGGCGGACTGGGGAGGTGG + Intronic
1160894881 19:1397671-1397693 TGCTGCCCGCACTGGGGAGCTGG - Intronic
1161319878 19:3636244-3636266 AGCTGGGCAGACAGGGGAAGTGG + Intronic
1162496861 19:11028183-11028205 TGCTGGGCGCACTGGGGAAGGGG + Intronic
1163302857 19:16458526-16458548 TGCGAGGTGCAGTGGGGAAGCGG - Intronic
1163573798 19:18098952-18098974 TGCTGGGAGCCCTGGGGTAGAGG + Intronic
1163606820 19:18280314-18280336 TCCTGGGCACACTCGGGGAGGGG + Exonic
1163767369 19:19171008-19171030 TGCTGGGATCCCAGGGGAAGGGG - Intronic
1165119709 19:33551275-33551297 GGCTGTGGGCCCTGGGGAAGGGG + Intergenic
1165424100 19:35736523-35736545 TGCAGGGCTCACTGGGTAACTGG + Intronic
1167445297 19:49533932-49533954 TGCTGGGAGCACTGCGGGGGAGG - Intronic
1167487342 19:49770411-49770433 TGCTGGGGACACTGGTGAACAGG + Intronic
1168269629 19:55242372-55242394 TGCTGGCCACCCTGGAGAAGTGG - Exonic
927035363 2:19169602-19169624 TGCTGGGGGCAGAGGGGAGGGGG - Intergenic
927857340 2:26535828-26535850 GGCTGGGCGGAGTTGGGAAGAGG + Intronic
927865618 2:26585463-26585485 TGCTGGGAGCTCTAGGGGAGTGG - Intronic
928217083 2:29370775-29370797 TCCTGAGCTCACAGGGGAAGTGG - Intronic
932190947 2:69741510-69741532 TGCTGGGCGCACAGGGAAGAGGG + Intronic
932799815 2:74731052-74731074 TGCTAGGCAGACTGGGGAAAGGG + Intergenic
933170049 2:79115108-79115130 TGCTTGGGGCAGTGGGGAATGGG - Intergenic
933743444 2:85552956-85552978 TGATGGCCGCACTGGCGAACTGG - Exonic
933973951 2:87492848-87492870 TGCTGGGAGGACGGGGGAAGAGG - Intergenic
935400212 2:102652417-102652439 GGCTGGGCGCCATGGGAAAGAGG - Intronic
936319770 2:111457356-111457378 TGCTGGGAGGACGGGGGAACAGG + Intergenic
936510590 2:113142092-113142114 TGCAGGGAGCAGAGGGGAAGGGG + Intergenic
936555669 2:113496858-113496880 TGCCGGGGGCGCTGGGGAGGAGG + Intergenic
936732872 2:115405333-115405355 TCCTGGGCACACTGGGGTAGAGG + Intronic
936960588 2:118069789-118069811 TGCTTGGCACATTGGGGATGAGG - Intergenic
937732138 2:125245958-125245980 AGGTGGGTGCAGTGGGGAAGAGG - Intergenic
938626012 2:133110447-133110469 TGCAGGGGACACTGGGGAGGAGG + Intronic
939978765 2:148753189-148753211 TGCTGGCTGCACTGGTAAAGAGG + Intronic
940722692 2:157299010-157299032 AGCTGCGCGCTCTGTGGAAGAGG - Intronic
942192965 2:173489116-173489138 TTATGGCCACACTGGGGAAGGGG - Intergenic
945170941 2:206994251-206994273 TGGTGGGGGGACTGGGGAGGAGG + Intergenic
946070896 2:217033528-217033550 TGCCGTGGGCTCTGGGGAAGGGG + Intergenic
947868741 2:233420191-233420213 TGCTGAGGGAACTGGGGGAGGGG - Intronic
1168911931 20:1455202-1455224 TGCTGGGCACACTGAGGCAAAGG + Intronic
1168933574 20:1644584-1644606 TGCTGAGCTCCCAGGGGAAGGGG - Intronic
1169145258 20:3248312-3248334 TGCCGGAGGCTCTGGGGAAGAGG + Intergenic
1169299569 20:4430521-4430543 GGCTGGGCACAGTGGGGCAGAGG + Intergenic
1172274837 20:33673894-33673916 GGCTGGGCTGACTGGGGAAGGGG - Intronic
1172989116 20:39018964-39018986 TTCTGAGCACCCTGGGGAAGAGG + Intronic
1172998885 20:39091498-39091520 AGCTGGGAGCAGTTGGGAAGGGG + Intergenic
1173320333 20:41981863-41981885 TGCTGGGCGCGCTGAGGGAAGGG + Intergenic
1173818457 20:46005330-46005352 GGCTGGGGGAAGTGGGGAAGGGG + Intergenic
1173875407 20:46367389-46367411 TGCTGGGCTCCTTGGGGATGGGG + Exonic
1173999308 20:47362742-47362764 TGCTGGGTGGTTTGGGGAAGTGG - Intergenic
1174170557 20:48615555-48615577 TCCTGGGTGCAGTGGGGGAGAGG - Intergenic
1175040147 20:56041593-56041615 AGCTGGGCAAACTGGGGCAGGGG - Intergenic
1175143060 20:56874683-56874705 TGGTGAGCGCCCTGGGGACGGGG + Intergenic
1175237911 20:57526113-57526135 TGCTGGGAGACCTGGGGGAGGGG + Intergenic
1175753188 20:61513277-61513299 TGCTGGGCGCAGGGTGGAAAGGG + Intronic
1175816785 20:61887178-61887200 CCCTGGGAGCACTGGGGAGGTGG - Intronic
1176019339 20:62954569-62954591 TGCTGGGGGCGCGGGGGACGGGG - Intronic
1176024997 20:62981370-62981392 TGCTGGGGGGAGGGGGGAAGGGG - Intergenic
1176048075 20:63102867-63102889 TGCGGGCCGCTCCGGGGAAGCGG + Intergenic
1177090926 21:16767295-16767317 TGCCAGGCGCTGTGGGGAAGAGG + Intergenic
1179435283 21:41358444-41358466 TGCTGGGGCCCCTGAGGAAGGGG - Intergenic
1179609245 21:42539015-42539037 GGCTGGGCTCAGTGGGGAAGTGG - Intronic
1179798385 21:43798902-43798924 TGCTGGGGGCGGTGGGGAGGGGG - Intronic
1179993226 21:44959459-44959481 TGCTGGGGGGACAGGGGCAGGGG - Intronic
1181570777 22:23766984-23767006 CGCTGGGCGCAAGGGCGAAGGGG - Intronic
1181639130 22:24187668-24187690 GGGTGGTCTCACTGGGGAAGAGG - Exonic
1182782400 22:32878551-32878573 TGCTTGGCCCCCTGGGGTAGTGG - Intronic
1183307669 22:37091425-37091447 TGCTGGGCCCCCAGGGGAGGGGG + Intronic
1183320551 22:37162759-37162781 TGCCAGGGGTACTGGGGAAGAGG + Intronic
1183441081 22:37823492-37823514 TGCTGGGCACAGTGGGCAATGGG + Exonic
1183484244 22:38080891-38080913 GGCCCAGCGCACTGGGGAAGCGG + Exonic
1184411315 22:44327960-44327982 TCTTGGGGGCGCTGGGGAAGGGG + Intergenic
1184460091 22:44632944-44632966 TGCTGGGGGTATGGGGGAAGGGG + Intergenic
1184487120 22:44786490-44786512 TGCTGGGTGCAGTGAGGAAGAGG + Exonic
1184637282 22:45843231-45843253 TGCTTGAAGCAATGGGGAAGTGG - Intronic
1184641784 22:45876794-45876816 AGCTGGCTGCACGGGGGAAGGGG + Intergenic
1184730657 22:46369412-46369434 TGGTGGGCGCTGTGGGGCAGTGG - Intronic
1185044520 22:48522474-48522496 TGGTGGGCTCCCTGGGGCAGTGG + Intronic
1185326691 22:50229078-50229100 TGCCGGGCCCACTGGGGAGCAGG + Intronic
1185348263 22:50320026-50320048 TGCAGGGCCCACTGGGAATGGGG - Intronic
950459197 3:13111207-13111229 CCCTGGGCACACTGGGGAGGTGG - Intergenic
950529187 3:13543288-13543310 GGCTGGCTGCAGTGGGGAAGGGG + Intergenic
953075597 3:39567362-39567384 TGCTGGGTGCAGTGTGGAAGAGG - Intergenic
953551864 3:43909360-43909382 TCCTGGCTGCACTGGGAAAGTGG - Intergenic
954317620 3:49809869-49809891 TGCCGGGCCCACTGTGGAGGAGG + Exonic
954841627 3:53516505-53516527 TGGTGGGGGCACTGGGTGAGTGG + Intronic
956457466 3:69436970-69436992 GGCTGGGGGTACTGGGGAATGGG + Intronic
956730948 3:72196075-72196097 GTCTGGGCTCAGTGGGGAAGAGG - Intergenic
957907017 3:86570121-86570143 TGCTGGGTCTGCTGGGGAAGAGG + Intergenic
958825578 3:99026535-99026557 TGCTGGACAGACTGGGGAAGAGG - Intergenic
959947112 3:112136942-112136964 TGCTGAGGCCACTGAGGAAGGGG - Intergenic
961644656 3:128386425-128386447 GGCTGGGGGCCCTGGGGAACTGG - Intronic
961787045 3:129353531-129353553 TGCTGGGCACCCAGGGGTAGAGG + Intergenic
962381694 3:134903405-134903427 TCCTGGGCACACTGCTGAAGAGG - Intronic
963001838 3:140688553-140688575 TTCTGGGCCCAGTGGGGAAGTGG + Intronic
963114383 3:141713926-141713948 TACTTGGCCCACTGGGGATGTGG - Intergenic
966453254 3:180086125-180086147 TCCTGGACACACTGGGGCAGGGG - Intergenic
968461832 4:730081-730103 TGTTGGGCTCAGTGGGGATGAGG - Intronic
968503867 4:963127-963149 TGCTGGACTCACCCGGGAAGAGG + Exonic
969102326 4:4778435-4778457 AGCTGGGTGCCCAGGGGAAGAGG + Intergenic
969351648 4:6601541-6601563 TGCAGGGAGCACTGGTGAGGTGG + Intronic
969640782 4:8397243-8397265 TCTTGGGCGCCCTGGGGATGGGG - Intronic
969703913 4:8781891-8781913 TGCTGGGCGCTGCGGGGCAGAGG + Intergenic
969854864 4:9991024-9991046 TGCAGGCAGCACTGGGAAAGGGG - Intronic
971585090 4:28395080-28395102 TGCTAGGAGTACAGGGGAAGTGG + Intronic
972294990 4:37729074-37729096 TGCTGGGGGAGGTGGGGAAGGGG + Intergenic
972479038 4:39480454-39480476 CGCTGGCCGCACAGGGGACGTGG - Intergenic
974117888 4:57603030-57603052 TTCTGGGCCTACTGGGGAAAAGG - Intergenic
975297636 4:72751920-72751942 TGCTGGGGGCAAGGGGGCAGGGG + Intergenic
978272444 4:106907202-106907224 TGGTGGTCGCCCTGGAGAAGTGG - Intergenic
979849226 4:125555984-125556006 TCCTGGACACACTGGGGCAGGGG + Intergenic
983177981 4:164614309-164614331 GGCTGGGGGAGCTGGGGAAGTGG - Intergenic
984928632 4:184827214-184827236 TGCTGGGCGCAGTGGTGCAGTGG + Intergenic
985292915 4:188404893-188404915 TCCTGGGGGTACTGGGGTAGGGG - Intergenic
985607396 5:865371-865393 TGCTGGGGTCTCTGGGGATGCGG + Intronic
985641529 5:1065566-1065588 TGCTGGGTCCACAGGGGAGGTGG - Intronic
986399045 5:7361578-7361600 TGCTTGTGCCACTGGGGAAGAGG + Intergenic
986672655 5:10156832-10156854 TTCTGGGCACACTGGGACAGGGG + Intergenic
1000325017 5:160165479-160165501 TGCTGGGCAGCCTGGGGAATCGG - Intergenic
1000477772 5:161732603-161732625 TGCAGGGCGGAGTGGGGGAGGGG + Intergenic
1001133176 5:169081031-169081053 AGCGGGGAGCCCTGGGGAAGGGG - Intronic
1002176064 5:177402190-177402212 AGCTGGCCGCACTGGGGGAATGG + Exonic
1002700920 5:181124390-181124412 TGATGGGGGCACTGAGGAAGGGG - Exonic
1002705174 5:181155835-181155857 TGATGGGGGCACTGAGGAAGGGG + Exonic
1003482496 6:6546383-6546405 AGCCGGGCGCACGTGGGAAGTGG + Intergenic
1003885841 6:10520786-10520808 TGCTACCCACACTGGGGAAGGGG - Intronic
1004924082 6:20402481-20402503 CGCCGGGGGCACTGGGGAGGAGG - Exonic
1005229540 6:23684448-23684470 TTCTGAGCACACTGGGGCAGGGG + Intergenic
1006984065 6:38166245-38166267 TGCTGTGCGCAGGGGGGAGGTGG - Intergenic
1010681822 6:78807569-78807591 TGCTGGGCTCCCTGGGGGGGGGG + Intergenic
1012626758 6:101414288-101414310 TGCTGGGGGCAGTGGAGAAAAGG - Intronic
1012859313 6:104540491-104540513 TCCTGGGCACACTGGTGTAGGGG + Intergenic
1013265571 6:108494184-108494206 TGCTGGACTCACTGGGGCAGGGG - Intronic
1014474929 6:121860377-121860399 TGCTGGGGGCCCTGGGGCAGAGG + Intergenic
1015666324 6:135633832-135633854 TGTTGGTCCCACTGGGGATGGGG + Intergenic
1016072819 6:139761067-139761089 TGTTGGGGTCACTGGGAAAGAGG - Intergenic
1016839919 6:148515936-148515958 TGAAGGGCCCACTGGGGAACAGG - Intronic
1017931420 6:158958941-158958963 TGCTGTACACACTGGGGCAGAGG + Intergenic
1018376673 6:163219586-163219608 TGCAGGCCGCAGTGGGGAGGAGG - Intronic
1018391453 6:163344738-163344760 GGCTGGGCGCACAAGGAAAGAGG - Intergenic
1019713537 7:2528250-2528272 TGCTGGGCCCAGCGGGGAGGTGG - Exonic
1020142389 7:5619725-5619747 AGGTGGGCAGACTGGGGAAGGGG + Intergenic
1021342420 7:19480676-19480698 TTCTGGATTCACTGGGGAAGTGG - Intergenic
1021819247 7:24480018-24480040 TCCCGGGAGCACTGGGGATGTGG - Intergenic
1021843553 7:24742763-24742785 ATCTGGTGGCACTGGGGAAGGGG - Intronic
1024163577 7:46706344-46706366 TGCAGGGTTGACTGGGGAAGAGG - Intronic
1024489186 7:49957948-49957970 TTCTGGGCACACTGGGGTGGGGG - Intronic
1024667772 7:51563541-51563563 AGCTGGGGAGACTGGGGAAGGGG - Intergenic
1024675772 7:51636714-51636736 TTCTTGGTGCACTGGGAAAGGGG - Intergenic
1024902939 7:54342916-54342938 TGCTGGCCACACAAGGGAAGAGG + Intergenic
1026492444 7:70874420-70874442 TGCTGGGAGCACTGGGATGGTGG - Intergenic
1029532065 7:101132083-101132105 TGCTGTGGGCTGTGGGGAAGGGG - Intronic
1029952693 7:104603834-104603856 TGCTGGGCACACTGGGGTGGGGG + Intronic
1031076806 7:117221034-117221056 TGCTGGGGGTGCTGGGGGAGAGG - Intronic
1032157991 7:129485705-129485727 TGCAGAGCGTACTGGGGCAGAGG + Exonic
1035306953 7:157939536-157939558 TGATGGCCCCACTGGGGATGTGG - Intronic
1035491648 7:159284643-159284665 TGCTGAGCTCCCAGGGGAAGAGG + Intergenic
1035536471 8:395059-395081 TGCGGTGAGCACTGGTGAAGGGG + Intergenic
1035828818 8:2672763-2672785 TGCTGGGGGGACTAGGAAAGTGG + Intergenic
1038166700 8:25092570-25092592 TGGTGGGGGCAATGGGGAGGGGG - Intergenic
1041927283 8:63250018-63250040 TGCTGGCTGCACTAGGGGAGAGG + Intergenic
1043921456 8:85988333-85988355 TGCGGAGAGCACTGGGCAAGGGG + Intronic
1044886307 8:96781964-96781986 TCCTGGACACACTGGGGAAGGGG + Intronic
1046131920 8:109975859-109975881 TGCTGGAAGCACTGGGCGAGTGG - Intergenic
1047170370 8:122486783-122486805 TGGTGGCTGCCCTGGGGAAGGGG - Intergenic
1047255301 8:123209313-123209335 TGCTGGGAGCAGTGGAGAATTGG - Exonic
1047970597 8:130081135-130081157 TGCTGGCAGGAGTGGGGAAGAGG + Intronic
1048199417 8:132359429-132359451 TGCTGGGTGCTCCAGGGAAGGGG + Intronic
1048399512 8:134051279-134051301 TCCTGGCTGCTCTGGGGAAGGGG - Intergenic
1049199885 8:141334814-141334836 TGCTGGGTGCCCGGGGGGAGCGG + Intergenic
1049253274 8:141600707-141600729 TGCTGGGGGCTCTGGGGCACAGG + Intergenic
1049705339 8:144039595-144039617 GGCTGGGGGCAGTGGGCAAGTGG + Intronic
1050151407 9:2622235-2622257 TGCTGGGCGCCCCGGGAGAGCGG + Exonic
1051079674 9:13279623-13279645 TGCGGCGCGCGCTGGGGGAGGGG - Intergenic
1051852735 9:21528229-21528251 TGCTTTGGGCCCTGGGGAAGTGG + Intergenic
1052741374 9:32395940-32395962 TTCTGGGCTCACTGGCCAAGAGG - Intronic
1055670054 9:78595539-78595561 TTCTGGACACACTGGGGCAGAGG - Intergenic
1056659531 9:88534407-88534429 GGCGGGGCGCAGTGGGGATGGGG + Intergenic
1056797735 9:89670244-89670266 TGCTGGGTCCACTGGGGCAAAGG - Intergenic
1057996671 9:99825574-99825596 GGCTGGGCGCATTGGGGACTGGG - Intronic
1061063142 9:128260774-128260796 TGCTGGGGGCTCTGGGGGCGGGG + Exonic
1061579655 9:131529272-131529294 TGAGGGGCGCACGGGGAAAGGGG + Intronic
1062200610 9:135300798-135300820 GGCTGGGCGCCCTGGGTGAGGGG + Intergenic
1062492592 9:136813900-136813922 GGCTGGGCGCAGTGGCGCAGTGG - Intronic
1062532802 9:137009220-137009242 GGCTGGGGGGACTGGGGCAGTGG - Intronic
1062532808 9:137009235-137009257 GGCTGGGGGCACTGGGGCTGGGG - Intronic
1062566696 9:137166844-137166866 GGCTGGGCAGGCTGGGGAAGAGG + Intronic
1185599367 X:1328196-1328218 TCCTGGGATCCCTGGGGAAGGGG + Intergenic
1185734603 X:2487292-2487314 AGCTGGCCGCACGGGGGAACTGG + Exonic
1186462244 X:9757577-9757599 TGCTGGGGGCTGTGGGGAGGGGG + Intronic
1187157692 X:16736442-16736464 TGCTGGCCCCACTGGGGAGCTGG + Intronic
1187216540 X:17282447-17282469 TGTTGGACTCACTGGGGGAGTGG - Intergenic
1189796871 X:44653772-44653794 GGCTGGGAGCAGTGGGGAATGGG - Intergenic
1189901171 X:45707847-45707869 GGCTGGGAGGAGTGGGGAAGAGG + Intergenic
1190507819 X:51145160-51145182 TGCTGGGCTCCCTGGAGTAGGGG + Intergenic
1192155654 X:68744659-68744681 TGCTGGAGACACTGGGGCAGAGG - Intergenic
1193017091 X:76746965-76746987 TGTTGGGGACACTGGGGAAAGGG + Intergenic
1193348417 X:80430375-80430397 TGCTGGGAGCCCTGGATAAGGGG + Intronic
1196367828 X:114943141-114943163 TGCTGGGCTCTGTGGGGATGGGG + Intergenic