ID: 1162498665

View in Genome Browser
Species Human (GRCh38)
Location 19:11038375-11038397
Sequence CAGGTAGACATGAGTCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 344}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162498652_1162498665 24 Left 1162498652 19:11038328-11038350 CCAAAAGTAAAGACCTCATTTGC 0: 1
1: 0
2: 1
3: 27
4: 208
Right 1162498665 19:11038375-11038397 CAGGTAGACATGAGTCTGGGGGG 0: 1
1: 0
2: 2
3: 41
4: 344
1162498658_1162498665 -9 Left 1162498658 19:11038361-11038383 CCATTCCGAGGTTCCAGGTAGAC 0: 1
1: 0
2: 4
3: 33
4: 86
Right 1162498665 19:11038375-11038397 CAGGTAGACATGAGTCTGGGGGG 0: 1
1: 0
2: 2
3: 41
4: 344
1162498654_1162498665 11 Left 1162498654 19:11038341-11038363 CCTCATTTGCAAAGAAGGTCCCA 0: 1
1: 1
2: 7
3: 147
4: 3366
Right 1162498665 19:11038375-11038397 CAGGTAGACATGAGTCTGGGGGG 0: 1
1: 0
2: 2
3: 41
4: 344
1162498657_1162498665 -8 Left 1162498657 19:11038360-11038382 CCCATTCCGAGGTTCCAGGTAGA 0: 1
1: 1
2: 3
3: 19
4: 127
Right 1162498665 19:11038375-11038397 CAGGTAGACATGAGTCTGGGGGG 0: 1
1: 0
2: 2
3: 41
4: 344
1162498651_1162498665 25 Left 1162498651 19:11038327-11038349 CCCAAAAGTAAAGACCTCATTTG No data
Right 1162498665 19:11038375-11038397 CAGGTAGACATGAGTCTGGGGGG 0: 1
1: 0
2: 2
3: 41
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162498665 Original CRISPR CAGGTAGACATGAGTCTGGG GGG Intronic
900281986 1:1875843-1875865 CAGGTAGACATGAATTTTGGGGG - Intronic
901442485 1:9286995-9287017 CAGGTGGACATGAATTTTGGGGG + Intergenic
901535975 1:9883232-9883254 CAGGAAGACCGGAGTCTGGGTGG + Intronic
902174359 1:14638212-14638234 CCTGTAGACATGAATTTGGGGGG + Intronic
903422744 1:23230404-23230426 GAGGTCCACCTGAGTCTGGGAGG - Intergenic
905528151 1:38655182-38655204 CAGAGAGCCATGAGTGTGGGTGG - Intergenic
905673907 1:39811830-39811852 GAGGATCACATGAGTCTGGGAGG + Intergenic
905965599 1:42092775-42092797 CAGGAAAACATGAGTTTTGGTGG - Intergenic
906106889 1:43300028-43300050 CAGGGAGAGGTGAGTCTGGGAGG + Intergenic
906508917 1:46400222-46400244 GAGGTGCACATGAGTCTGAGAGG + Intronic
906696522 1:47827130-47827152 CAGGGAGTAAAGAGTCTGGGTGG - Intronic
907551767 1:55310793-55310815 CTGGTAGGCATGAGTCAGGCCGG + Intergenic
907648222 1:56265506-56265528 CTGTTAGAATTGAGTCTGGGTGG - Intergenic
908819740 1:68072948-68072970 CAGGTAAACTTGTGTCTTGGGGG + Intergenic
909865191 1:80659960-80659982 CTGAAATACATGAGTCTGGGAGG + Intergenic
909873324 1:80772578-80772600 CAGACAGACCTGAGTTTGGGCGG + Intergenic
910772807 1:90846884-90846906 GAGGATGACTTGAGTCTGGGAGG + Intergenic
912107570 1:106299024-106299046 GAGGTTGAAATGAGTATGGGGGG + Intergenic
913461702 1:119093385-119093407 TAGGTAGACATGAATTTTGGAGG - Intronic
915376242 1:155398800-155398822 GAGGTTCACTTGAGTCTGGGAGG - Intronic
916860102 1:168794420-168794442 CAGGAAGACATTAGACTCGGTGG - Intergenic
917685327 1:177409890-177409912 CAGGTATACATGTGTCATGGTGG - Intergenic
919095506 1:193029988-193030010 TAGGTAGAAATGAGTCTAGGAGG - Intronic
919812661 1:201419061-201419083 CAGGTAAACATGTGTCATGGAGG - Intronic
920271094 1:204764321-204764343 CATTTAGGCATGAGTGTGGGTGG + Intergenic
922168596 1:223136194-223136216 CAGGAAGACAGGACTCTGGCAGG + Intronic
922343032 1:224672732-224672754 CAGGTAGATATGAATTTTGGAGG + Intronic
922419216 1:225448300-225448322 CAGGTTGAATTGACTCTGGGAGG - Intergenic
923467835 1:234265066-234265088 CAGGGAGACATGAGACAGGAGGG - Intronic
923991401 1:239440947-239440969 AAGGCAGACATTACTCTGGGTGG + Intronic
924515822 1:244765239-244765261 GAGGATGACTTGAGTCTGGGAGG - Intergenic
924696398 1:246405039-246405061 GAGGATGACTTGAGTCTGGGAGG - Intronic
1062795715 10:343644-343666 CAGGGAGGCAGGAGTCTGGATGG - Intronic
1063652457 10:7951589-7951611 GAGGTGGACATGATTTTGGGTGG - Intronic
1064431683 10:15276772-15276794 CAGGGATACTTGAGCCTGGGAGG - Intronic
1064601493 10:16998167-16998189 CTGGTAGGCATAAGTCTCGGGGG - Intronic
1064730482 10:18325832-18325854 GAGGTTGGCTTGAGTCTGGGAGG - Intronic
1065193716 10:23240099-23240121 GAGGTTCACCTGAGTCTGGGAGG + Intergenic
1066426937 10:35315940-35315962 AAGGTAGAAATGGGTCTGGGTGG - Intronic
1067218515 10:44323792-44323814 CAAGTGGACATGAGTTTTGGGGG - Intergenic
1067249846 10:44576964-44576986 CAGGAAGACAGGTGGCTGGGCGG + Intergenic
1069555436 10:69394719-69394741 CAGGTAGACATGAATGCTGGTGG + Intronic
1069964386 10:72102079-72102101 CAGGTAAACATGTGTCACGGGGG - Intronic
1070185697 10:74060213-74060235 GAGGATGACTTGAGTCTGGGAGG + Intronic
1071706155 10:88001048-88001070 CAGGTAAACATGAGCCATGGTGG - Intergenic
1072058135 10:91781375-91781397 CAGGTGGATATGAATTTGGGAGG + Intergenic
1072352977 10:94576201-94576223 CAGGCTCACATGAGCCTGGGAGG - Intronic
1073572132 10:104589522-104589544 CAGGGAGACATGAGAGAGGGAGG + Intergenic
1073973835 10:109076456-109076478 CAGGTAGTCAGGAGGCTGAGGGG + Intergenic
1074872516 10:117588265-117588287 CACCCAGACATGAGCCTGGGAGG + Intergenic
1076525710 10:131111265-131111287 CAGGGAGCCATGAGGGTGGGTGG - Intronic
1076716102 10:132364644-132364666 CAGGTAGATGTAAGTGTGGGTGG - Intronic
1077674130 11:4182308-4182330 CAGCAAGACATGAGCCCGGGTGG - Intergenic
1078159005 11:8824249-8824271 CAGGTAGACTTGTGTCATGGGGG + Intronic
1079302284 11:19288558-19288580 TAGGTAGACATGTGTCCTGGTGG - Intergenic
1080745020 11:35101004-35101026 CGAGAGGACATGAGTCTGGGTGG + Intergenic
1083065669 11:59921575-59921597 CAATTTGACATGAGTTTGGGAGG + Intergenic
1083604957 11:63972933-63972955 GAGGTTGGCTTGAGTCTGGGAGG + Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1084685711 11:70693899-70693921 CAGGTGGACAGGTGACTGGGTGG + Intronic
1084945815 11:72637796-72637818 AAGGTAGAGATGAGTCAGGTTGG + Intronic
1085274839 11:75291816-75291838 CAGGAACACATGAGGCTGAGAGG + Intronic
1085514753 11:77105660-77105682 CTGGAAGGCCTGAGTCTGGGAGG - Intronic
1087901067 11:103641743-103641765 CAGGTGGACATGAATTTTGGGGG - Intergenic
1090051114 11:123380797-123380819 CAGGCAGACATGAGGCTGTGGGG - Intergenic
1090413267 11:126523464-126523486 CATGAAGACATGAGTCTGAAGGG - Intronic
1091351557 11:134901646-134901668 GAGGTGGACAGGAGTGTGGGAGG - Intergenic
1091690348 12:2592080-2592102 TAGGTAGGCATGAGTTTGCGGGG + Intronic
1091757308 12:3062523-3062545 AAGGAACACTTGAGTCTGGGAGG - Intergenic
1093433060 12:19105567-19105589 CAGGTAGACATATGTATGAGGGG - Intergenic
1093675401 12:21933318-21933340 CAGGTAAACTTGAGTCACGGAGG - Intronic
1095290368 12:40472711-40472733 AAGGAAGACATGAATTTGGGTGG + Intronic
1096226493 12:49869717-49869739 CAGGTGGACGCGGGTCTGGGTGG + Exonic
1096260896 12:50090588-50090610 CAGGTAGGCCTGTGTGTGGGAGG + Exonic
1096489133 12:52004216-52004238 CTGGTGGCCATGAGTCTCGGGGG - Intergenic
1096815648 12:54200237-54200259 CAGGAACAAAGGAGTCTGGGCGG + Intergenic
1097350026 12:58538625-58538647 CAGGTAGGCATGAATTTTGGGGG - Intergenic
1097752665 12:63374738-63374760 CAGGTAAACATGTGTCATGGTGG + Intergenic
1098169491 12:67732125-67732147 CAGATGGACAGGAATCTGGGGGG + Intergenic
1098338868 12:69431374-69431396 CTGGGAGACATGAGTCTGGAGGG - Intergenic
1099322049 12:81162651-81162673 GAGGTAGACAGGCTTCTGGGTGG - Intronic
1099467999 12:83010466-83010488 CAGGTAAACAGGAATGTGGGAGG - Intronic
1099813546 12:87617441-87617463 CAGGTATACATGTGCCAGGGTGG + Intergenic
1100208841 12:92380368-92380390 CAGGTAAACATGTGTCATGGTGG - Intergenic
1100279411 12:93104052-93104074 CAGGTAAACATGTGTCATGGGGG - Intergenic
1102285054 12:111649240-111649262 GAGGATCACATGAGTCTGGGAGG - Intronic
1104496806 12:129248607-129248629 CAGGTAGACTTGGGTCATGGGGG + Intronic
1105443280 13:20432656-20432678 TGGGAAGACATGATTCTGGGGGG - Intronic
1106130874 13:26938477-26938499 CAGGTATACATGTGTCATGGTGG + Intergenic
1106702861 13:32248458-32248480 CAGGTAGACATGTGCCATGGTGG - Intronic
1106873213 13:34044032-34044054 CAGGTGGACATAAATCTGGAGGG - Intergenic
1108433186 13:50375512-50375534 CAGGCAGACAGGAGTAGGGGTGG - Intronic
1108631997 13:52293495-52293517 TAGGTAAACATGTGTCAGGGTGG - Intergenic
1108654701 13:52519099-52519121 TAGGTAAACATGTGTCAGGGTGG + Intergenic
1109705880 13:66092327-66092349 CTGGTAGACATGACTATGGCTGG + Intergenic
1111352344 13:87047367-87047389 CAGGTATACATGTGCCAGGGTGG - Intergenic
1111924195 13:94445699-94445721 CTGGTAACCATGAGCCTGGGAGG - Exonic
1112048494 13:95621421-95621443 CAGGTAGATTTGGGTCAGGGAGG + Intronic
1113326809 13:109290328-109290350 CAGGTAGACGTGAGTCCTGTGGG + Intergenic
1113915496 13:113869445-113869467 CAGGATCACTTGAGTCTGGGGGG - Intergenic
1114076426 14:19163772-19163794 CAGGTAGACACGACTCCAGGTGG - Intergenic
1114085742 14:19235797-19235819 CAGGTAGACACGACTCCAGGTGG + Intergenic
1114260801 14:21034775-21034797 TAGGTAAAAATCAGTCTGGGAGG + Exonic
1114496105 14:23133349-23133371 CAGGATCACATGAGCCTGGGAGG + Intronic
1116567407 14:46466814-46466836 CAGGTAAACATGTGTCATGGGGG - Intergenic
1116812911 14:49556417-49556439 GAGGATCACATGAGTCTGGGAGG + Intergenic
1117194319 14:53324392-53324414 CAGGAAGACAGGAGAGTGGGAGG - Intergenic
1117956080 14:61124655-61124677 TAGAGAGAAATGAGTCTGGGTGG - Intergenic
1119128433 14:72150034-72150056 CAGGTAGACGTGAATTTGGGAGG - Intronic
1119541177 14:75439072-75439094 CAGGCAAAGATGAGCCTGGGGGG + Intronic
1119552297 14:75523810-75523832 CAGGCTGGGATGAGTCTGGGTGG + Intronic
1120144292 14:80962594-80962616 CAGGTAGATATGAATTTTGGGGG + Intronic
1120876977 14:89384002-89384024 CAGGTGGACATGAATTTGGTGGG + Intronic
1121740384 14:96247940-96247962 CATGTGGACATGAGTTGGGGTGG - Intronic
1122595016 14:102884391-102884413 CAGATAGACATGAATTTTGGAGG + Intronic
1122921237 14:104881172-104881194 CGGGTAGGCAGAAGTCTGGGAGG + Intronic
1123424502 15:20158485-20158507 CAGGGAGTCTTGTGTCTGGGTGG - Intergenic
1123533726 15:21165016-21165038 CAGGGAGTCTTGTGTCTGGGTGG - Intergenic
1126487674 15:49200375-49200397 CAAGTAGATATGAATTTGGGGGG - Intronic
1127000555 15:54499378-54499400 CAGTTTGACATGAGTTTTGGTGG + Intronic
1127862636 15:63007111-63007133 AGGGTGGACATGAGTTTGGGGGG - Intergenic
1129690127 15:77708474-77708496 CAGATGGACATGAATTTGGGGGG - Intronic
1130758518 15:86792595-86792617 CAGGTAGAACTAGGTCTGGGTGG - Intronic
1131372693 15:91896393-91896415 CAGGTAGAAATGACACTTGGAGG + Intronic
1131777010 15:95813926-95813948 TAGGTATACATGTGTCTTGGTGG + Intergenic
1132206815 15:99992116-99992138 CAGGTATACATGTGTCATGGTGG - Intronic
1132529624 16:439785-439807 CAGGAAGACATGAAGCAGGGAGG + Intronic
1132689526 16:1176362-1176384 CAGCCAGGCATGGGTCTGGGAGG + Intronic
1133758314 16:8778909-8778931 CAGGTAAACATGAATTTAGGGGG + Intronic
1135083012 16:19452414-19452436 CATGTAGAAATGAGACTGGATGG + Intronic
1135246947 16:20865083-20865105 CAGGTAAACATGTGTCATGGGGG - Intronic
1138752255 16:59438137-59438159 CAGGTAGGCATGAATTTGGGGGG - Intergenic
1138877823 16:60974509-60974531 CAGGCAGACATGAGTATAGTAGG + Intergenic
1139532994 16:67552583-67552605 CAGTTAGAGATGAGGCTGAGGGG + Intergenic
1140821918 16:78670602-78670624 CAGATAGACACGAATTTGGGGGG - Intronic
1141437965 16:84011581-84011603 CAGGTAGACATGAATTTTGGGGG - Intronic
1142892088 17:2950346-2950368 CTGTTAGAAATGAGTCTGGCTGG - Intronic
1144418602 17:15074825-15074847 GAGGAAGACATGAGACTAGGAGG + Intergenic
1144571431 17:16402127-16402149 GAGTTAGACATCAGTCTGGGTGG + Intergenic
1146358858 17:32158349-32158371 AGGGTAGACATGAGTCTGGGTGG + Intronic
1146918590 17:36694647-36694669 CAGGAAGAAAGCAGTCTGGGAGG - Intergenic
1147898515 17:43768454-43768476 CAGGCAGACATGAGACATGGCGG - Exonic
1149202891 17:54208338-54208360 CAGGTAAACATGTGTCACGGGGG - Intergenic
1150496046 17:65608526-65608548 GATGAAGAAATGAGTCTGGGAGG - Intronic
1150988590 17:70228448-70228470 GAGGAAGGCATGAGACTGGGAGG - Intergenic
1151448427 17:74182199-74182221 CATGGAGTCATGAGTCTGGAAGG + Intergenic
1152261352 17:79268966-79268988 TAGGTAGACATGAATTTGGGGGG - Intronic
1154405431 18:14086018-14086040 CAGCTAAGCATGAGTCTTGGTGG + Intronic
1155437335 18:25826966-25826988 CAGGTAGTGATGAGTCAGAGAGG + Intergenic
1155608481 18:27635422-27635444 CAGGTAGACTTGTGTCGTGGGGG - Intergenic
1157085552 18:44577022-44577044 CAGGTAAACATGAATTTTGGAGG + Intergenic
1157590333 18:48832918-48832940 CAGGAAGTGCTGAGTCTGGGGGG + Intronic
1158921084 18:62191479-62191501 TAGGTAGACATGTGTCATGGTGG + Intronic
1160046247 18:75390078-75390100 CAGGTAGACAAGAGCCCCGGAGG + Intergenic
1160194306 18:76739680-76739702 AAGGCACACATGAGTCTGGTGGG + Intergenic
1160395916 18:78572236-78572258 CAGGTAGGCAGGGGTGTGGGGGG - Intergenic
1160845174 19:1163115-1163137 CGGGTAGATGTGAGTCTGGAGGG - Intronic
1161228694 19:3161323-3161345 CAGGTGGACATGAATTTTGGGGG + Intronic
1161341567 19:3745941-3745963 CAGGTAGGCATGAATTTGAGGGG + Intronic
1161871308 19:6872546-6872568 CAGGTAGACATGTGCCATGGTGG - Intergenic
1162490755 19:10990077-10990099 GAGGAGGACATGAGCCTGGGAGG - Intronic
1162498665 19:11038375-11038397 CAGGTAGACATGAGTCTGGGGGG + Intronic
1162779410 19:12998992-12999014 CAGGGCTCCATGAGTCTGGGAGG - Intronic
1163550436 19:17963648-17963670 CAGGGAGACTTGAGTTAGGGTGG - Intronic
1164449221 19:28345553-28345575 GAGGAAGACAGGAGTCTGGGAGG - Intergenic
1165755076 19:38288273-38288295 CAGGCAGACAGGAGGGTGGGTGG - Intronic
1166052928 19:40271335-40271357 GAGGTTGACCTGAGCCTGGGAGG + Intronic
1166510042 19:43400669-43400691 CTGGTGGAAATGAATCTGGGTGG - Intergenic
1166772605 19:45293174-45293196 CAGGTTCACTTGAATCTGGGAGG + Intronic
926135639 2:10333782-10333804 GAGGCAGAAATGAGTCTGGAGGG - Intronic
926171673 2:10556555-10556577 CAGGGAGAGATGGGGCTGGGGGG + Intergenic
927666053 2:25033552-25033574 GAGGTGGTCATGAGTCAGGGAGG + Intergenic
928635488 2:33241477-33241499 CAGGTATTTATGAGTCTGGGGGG + Intronic
929542428 2:42832486-42832508 GAGGTGGACATGTTTCTGGGGGG - Intergenic
929910514 2:46085605-46085627 GAGGAAGACCTGAGTCAGGGAGG - Intronic
930814181 2:55575533-55575555 CAGGATCACTTGAGTCTGGGAGG - Intronic
930985685 2:57584951-57584973 CAGGTAAACATGTGTCATGGGGG + Intergenic
931331146 2:61285395-61285417 GAGGAACACCTGAGTCTGGGAGG + Intronic
931442574 2:62301121-62301143 CAGGAAGCCATGAGTCCAGGAGG - Intergenic
933483086 2:82881812-82881834 CAGGTAAACATGTGTCAGGGTGG - Intergenic
934458742 2:94198549-94198571 CAGGGAGTCTTGTGTCTGGGTGG + Intergenic
934526540 2:95055694-95055716 CAGGTACACATGAGTGCTGGCGG + Intergenic
935516438 2:104046434-104046456 AAGGTAGAGCTGAGTCTTGGTGG + Intergenic
936792508 2:116165877-116165899 CAGATATACCTGAGACTGGGAGG - Intergenic
938491022 2:131761287-131761309 CAGGTAGACACGATTCCAGGTGG - Intronic
944304984 2:198169102-198169124 CAGGTGGCCATGAATTTGGGTGG + Intronic
944404158 2:199362827-199362849 TAGGTATACATGAGGCTGGATGG + Intronic
944545886 2:200798473-200798495 CAGGTAGACATGAATTTGGGGGG + Intergenic
947282380 2:228469726-228469748 CAGGTAGACATGAGCAGGGCAGG - Intergenic
947977390 2:234378854-234378876 TAGGTATACATGTGCCTGGGTGG + Intergenic
948732669 2:239977014-239977036 CACCAAGACCTGAGTCTGGGAGG - Intronic
1168873719 20:1154712-1154734 CAGGTGCACATGAGTCAGTGGGG - Intronic
1169303955 20:4471940-4471962 GAGGTGGAAATGAGTCTGTGAGG - Intergenic
1169793018 20:9431399-9431421 TAGGTAGACAGGAGTTTTGGTGG + Intronic
1172103074 20:32497329-32497351 CAGGCTGACAAGAGTCAGGGTGG + Intronic
1172115847 20:32573126-32573148 CAGCTACACTTGAGCCTGGGAGG - Intronic
1172976427 20:38909429-38909451 CAGGTAGACATGAATTTTTGAGG + Intronic
1174495051 20:50933772-50933794 GAGGTTCACTTGAGTCTGGGAGG - Intergenic
1174712882 20:52726102-52726124 CAGTTAGAAATGAGTCTTAGTGG - Intergenic
1176069452 20:63218504-63218526 CAGGTGGACATGAGTTTTGGGGG + Intergenic
1176616977 21:9033499-9033521 CAGGTAGACACGACTCCAGGCGG + Intergenic
1176708153 21:10130147-10130169 CAGGTAGACATGACTCCAGGCGG - Intergenic
1176709946 21:10141840-10141862 CAGGTATACATGTGTCATGGTGG + Intergenic
1178043253 21:28665178-28665200 CAGGATGTCTTGAGTCTGGGAGG + Intergenic
1178625805 21:34217518-34217540 GGGGTGGACAGGAGTCTGGGAGG + Intergenic
1179010966 21:37555878-37555900 CAGGTGGACATGGCTCTGGATGG + Intergenic
1180144648 21:45912517-45912539 CAGGGTGCCATGAGTCTGGGTGG + Intronic
1180292232 22:10857396-10857418 CAGGTAGACACGACTCCAGGTGG - Intergenic
1180495037 22:15886818-15886840 CAGGTAGACACGACTCCAGGTGG - Intergenic
1181357463 22:22307902-22307924 CAGGGAGTCTTGTGTCTGGGTGG - Intergenic
1182050466 22:27309269-27309291 CATGAACACATGAGTCGGGGTGG - Intergenic
1182985749 22:34714494-34714516 CAGATGGACATGAGTTTTGGGGG - Intergenic
1183569365 22:38640760-38640782 GAGGTGGACATGAGTGTTGGTGG + Intronic
1183812175 22:40266524-40266546 CAAGTAAACCTGTGTCTGGGTGG + Exonic
1184190013 22:42888129-42888151 CAGGAAGGCCTGAGCCTGGGTGG - Intronic
1184575205 22:45358328-45358350 CAACTGGCCATGAGTCTGGGAGG + Intronic
1185281126 22:49970345-49970367 CTGGCAGGCATGTGTCTGGGTGG + Intergenic
1185285271 22:49997195-49997217 CAGGTAGACTAGACCCTGGGTGG + Intronic
949183823 3:1166978-1167000 CAGGTATACATGTGTCATGGTGG - Intronic
950835950 3:15919110-15919132 CAGGTAGGCATGAGCCAGGCAGG - Intergenic
951238770 3:20265916-20265938 CAGGTATACATGTGTCATGGTGG + Intergenic
952180838 3:30914830-30914852 CAGGAAGACATGGATATGGGAGG - Intergenic
954925956 3:54234952-54234974 CAGGTAAACATGTGTCTTGGGGG - Intronic
955582181 3:60435703-60435725 CAGGTAAACATGTGTCATGGGGG + Intronic
957191934 3:77021109-77021131 GAGGAATACATGAGCCTGGGAGG + Intronic
957433075 3:80138924-80138946 CAGGTAAACATGTGTCATGGAGG - Intergenic
957436702 3:80187026-80187048 TAGGTATACATGTGTCTTGGTGG + Intergenic
958534733 3:95385819-95385841 CAGGTACTTGTGAGTCTGGGTGG - Intergenic
959222743 3:103542550-103542572 CAGGTATACATGTGTCATGGTGG + Intergenic
959243600 3:103832051-103832073 TAGGTATACATGTGTCAGGGTGG - Intergenic
959483394 3:106900388-106900410 CATGTAGATTTGAGTGTGGGGGG - Intergenic
964686706 3:159403794-159403816 CAGTTAGACATGAGCCAAGGTGG + Intronic
966917452 3:184592929-184592951 CAGGCAGAAGGGAGTCTGGGGGG + Intronic
968915884 4:3496899-3496921 CAGGAAGGCGGGAGTCTGGGTGG + Intronic
969344060 4:6560243-6560265 CTGGTAGCCAAGAGCCTGGGTGG - Intronic
970150879 4:13088686-13088708 CAGGAAGAAATGAGTTAGGGAGG + Intergenic
970211332 4:13713199-13713221 CAGGTAGACATGAATTTTAGGGG - Intergenic
970237174 4:13970724-13970746 CATTTTGACATGAGTCTGTGAGG + Intergenic
971052224 4:22874496-22874518 CAGGTAGCCATGTTCCTGGGCGG - Intergenic
974356588 4:60820437-60820459 CAGCTAGTCGTGAGGCTGGGAGG - Intergenic
975957428 4:79858036-79858058 CAGGATGACAGGAATCTGGGAGG - Intergenic
976074250 4:81278791-81278813 CAGGTATACATGTGTCATGGTGG + Intergenic
976764416 4:88584289-88584311 CAGGTAGACATGAATTTGAAGGG + Intronic
976840505 4:89426941-89426963 CATTTAAACATGAGACTGGGAGG + Intergenic
976956612 4:90909320-90909342 CAAGTAGACATGAATTTTGGAGG + Intronic
977531029 4:98200634-98200656 CAGGTAGACATGAATTTTGGGGG - Intergenic
978651872 4:111015231-111015253 CAGCTAGACAGGTGTCTGGGTGG - Intergenic
980041676 4:127947370-127947392 CAGGTAGAGATCAGCCTGGCCGG + Intronic
980273989 4:130623900-130623922 CAGGTAAACATGTGTCATGGGGG - Intergenic
982945475 4:161616793-161616815 TAGGTAAACATGTGTCAGGGTGG - Intronic
983157116 4:164362401-164362423 CTGGGAGACATGAGTCCAGGGGG + Intronic
984702448 4:182826895-182826917 CAGGGAGACACGAATCTGGGGGG + Intergenic
984806016 4:183752545-183752567 CAGGTGGACATGAATTTGGTGGG + Intergenic
985013435 4:185607232-185607254 CTGGTAGACATGAGGCTGTCAGG + Intronic
986361034 5:6978371-6978393 CAGGAAGACATGATGCCGGGGGG - Intergenic
987478506 5:18422521-18422543 CAGGTAAACATGTGTCATGGTGG - Intergenic
988389683 5:30611767-30611789 CAGGTGGACATTAATTTGGGTGG - Intergenic
988788445 5:34585369-34585391 GAGGGAGACATGAGACTGGAAGG - Intergenic
989262259 5:39431198-39431220 TAGGTAGACATGAATTTTGGAGG - Intronic
989693840 5:44176094-44176116 TAGGTAAACATGAGTCATGGGGG - Intergenic
990059619 5:51630991-51631013 TAGGTAGACATGTGTCATGGTGG - Intergenic
990999706 5:61770360-61770382 CAGGATGACATGAGTTTGGAGGG + Intergenic
992748643 5:79842378-79842400 CAGGTGGACATGAGGCTGCCAGG - Intergenic
993742050 5:91553645-91553667 CAGGTGGACATGAATTTTGGAGG - Intergenic
994280171 5:97892615-97892637 CAGGTAGACATGAATTTTGCAGG - Intergenic
994302896 5:98167053-98167075 CAGGTAAACATGTGTCATGGTGG + Intergenic
994474342 5:100248523-100248545 CAGGTATACATGAGCCATGGTGG - Intergenic
994665157 5:102696431-102696453 CAGGTAGACATGGGCATGGTGGG + Intergenic
995168203 5:109073123-109073145 CAGGTAGACATAAATTTTGGGGG + Intronic
995926693 5:117383350-117383372 CAGGCAGACATGAGTAGGGCAGG - Intergenic
996173745 5:120329614-120329636 CAGGTAGACATGTCTCATGGGGG - Intergenic
997828830 5:137131648-137131670 CAGGTAGACCAGAGCCTGTGTGG - Intronic
998589191 5:143459372-143459394 CAGGTAGAAGAGAGACTGGGAGG + Intergenic
999122485 5:149219846-149219868 CAGGTAGGGATGAGAATGGGAGG - Intronic
1000784921 5:165531080-165531102 CTGGAAGACATGAATTTGGGAGG + Intergenic
1001268127 5:170289977-170289999 GAGGTGGACATGAGCCTGGCTGG + Intronic
1001735706 5:173997687-173997709 CAGGTAGAAATTTGCCTGGGAGG + Intronic
1004160492 6:13208633-13208655 CATGTAGACATGGGGTTGGGGGG - Intronic
1005595759 6:27377566-27377588 CAGGAAGACATGAAGCTGGGAGG - Intronic
1006199526 6:32275437-32275459 CAGGATGACTTGAGCCTGGGAGG - Intergenic
1006339237 6:33437514-33437536 AGGGTAGACATGAGTTTTGGTGG + Intronic
1006350228 6:33515465-33515487 GAGGATCACATGAGTCTGGGAGG + Intergenic
1006441817 6:34058021-34058043 CAGGAAGGCATGAGTCTGAGAGG + Intronic
1006598883 6:35213051-35213073 CACATAGACATGATTCTGTGGGG + Intergenic
1006916610 6:37598605-37598627 CAGGTATACATGTGTCATGGTGG + Intergenic
1007592242 6:43029260-43029282 CAGGGAGACATGGATCTGTGAGG + Exonic
1007742541 6:44021699-44021721 CAGGAAGCCAAGAGTCTCGGAGG - Intergenic
1009400263 6:63246335-63246357 CAGTGGGATATGAGTCTGGGGGG - Intergenic
1013343648 6:109238743-109238765 CAGGTAGACATGAATTTTGGGGG + Intergenic
1013356177 6:109347746-109347768 CAGGTAGACATGAAATTTGGGGG + Intergenic
1015547018 6:134371543-134371565 CAGGTAGACATGATATTTGGGGG + Intergenic
1015555881 6:134460898-134460920 GAGGTAGAGATGGGTCTGTGTGG + Intergenic
1017841266 6:158224717-158224739 CAGGTAGCCATGACTCTTTGGGG - Intergenic
1018099163 6:160420965-160420987 CAGGTAGACATGAGGCTCTGCGG - Intronic
1018568660 6:165184301-165184323 CAGGTGGACATGAATTTTGGAGG + Intergenic
1019593657 7:1848301-1848323 CGGGTAGACAGAAGTGTGGGTGG + Exonic
1021846295 7:24766368-24766390 CAGGTATACATGTGTCATGGTGG + Intergenic
1021860465 7:24900929-24900951 GAGGATGACTTGAGTCTGGGAGG + Intronic
1022887400 7:34660855-34660877 CAGGGAGGGATGAGTCAGGGAGG - Intronic
1023191849 7:37591529-37591551 CAGGCAGAGATGAGGCTGGGTGG - Intergenic
1023550682 7:41366997-41367019 CAGGTATACATGTGTCGTGGTGG - Intergenic
1024246213 7:47472252-47472274 CAGGTGGACATGAATTTCGGGGG + Intronic
1026120858 7:67536051-67536073 CAGGTATACATGTGTCATGGTGG + Intergenic
1026149764 7:67777966-67777988 CAGGTATACATGAGCCATGGTGG + Intergenic
1027136977 7:75631568-75631590 CAGGTAGAGAGGGGTCAGGGTGG - Intronic
1028001947 7:85509755-85509777 CCAGGAGTCATGAGTCTGGGTGG - Intergenic
1028702383 7:93795214-93795236 CAGGTAAACATGTGTCATGGTGG + Intronic
1028815119 7:95134411-95134433 CAGGTATACATGTGTCATGGTGG - Intronic
1028972337 7:96872713-96872735 CAGGTGGACATGAATTTTGGGGG + Intergenic
1030413268 7:109209567-109209589 CAGGTAAACATGTGTCATGGTGG + Intergenic
1032849771 7:135784179-135784201 CAAGCAGACCTGAGTCAGGGAGG - Intergenic
1033057338 7:138070246-138070268 CAGATAGACCTGACTTTGGGGGG + Intronic
1033786878 7:144742590-144742612 CAGGCACACATGAGACTGGGTGG + Intronic
1036612726 8:10363840-10363862 GAGGATGACTTGAGTCTGGGAGG + Intronic
1036638131 8:10565294-10565316 CAGTTGAACATGAGTGTGGGAGG - Intergenic
1037446753 8:18973036-18973058 AATGTAGACCTGAGTCTTGGGGG + Intronic
1037464691 8:19148737-19148759 CAGGTAGACATGAATTTTGGAGG - Intergenic
1038740333 8:30211472-30211494 CAGGTTGCCATGAGGCTGGGAGG + Intergenic
1038982762 8:32777471-32777493 CAGGTAGACATGAGGCATGGGGG - Intergenic
1041117921 8:54558552-54558574 CAGGGAGACAGGGGCCTGGGAGG - Intergenic
1041821065 8:62033380-62033402 CAGGTGGACATGAGTTTGAGGGG + Intergenic
1041969076 8:63716106-63716128 CAGGTAGACATGTGTCAAGGGGG + Intergenic
1042311128 8:67380350-67380372 CAGGCAGACATGAGTAGGGCAGG + Intergenic
1043036798 8:75208959-75208981 CAATTAGACATGAGTTTGGGTGG + Intergenic
1043950905 8:86308073-86308095 CAGCTAGTCATGAGCCTGAGAGG + Intronic
1044773302 8:95660644-95660666 CATGTAGACATGAATTTTGGGGG - Intergenic
1044827199 8:96209961-96209983 GAGGTTCACTTGAGTCTGGGAGG - Intergenic
1045176886 8:99735272-99735294 CAGGTAGAAATGAATTTGGGAGG - Intronic
1045245301 8:100437144-100437166 CAGGTGAACATGAGTTTGAGGGG - Intergenic
1045312041 8:101011391-101011413 GAGGTTCACTTGAGTCTGGGAGG - Intergenic
1045590279 8:103585822-103585844 CAGGTATACATGTGTCATGGTGG - Intronic
1046096148 8:109563641-109563663 CAGGTAAACATGTGTCAAGGGGG + Intronic
1047263552 8:123283677-123283699 GAGGAACACTTGAGTCTGGGAGG + Intergenic
1047508521 8:125498340-125498362 CAGGTAGAAATGAGTCACAGAGG - Intergenic
1048639138 8:136333509-136333531 CAGGCAGACATGAGTGGGGCAGG + Intergenic
1049040953 8:140111325-140111347 CAGGTGGAGAAGAGTCTGGATGG - Intronic
1049048757 8:140174315-140174337 CAGGTAAACATGTGTCATGGGGG - Intronic
1049315463 8:141964654-141964676 CTGGGAGAGATGAGGCTGGGTGG + Intergenic
1049742585 8:144248219-144248241 CAGGCAGGCATGGGTCGGGGAGG - Intronic
1050027660 9:1352406-1352428 CAGGTTCACATGAGCCTTGGGGG - Intergenic
1051888131 9:21916179-21916201 CAGGTATACATGAATTTTGGAGG - Intronic
1051889965 9:21931337-21931359 TAGGCAGACATGAGTAAGGGAGG + Intronic
1052530088 9:29671929-29671951 CAGGTAAACATGTGTCATGGGGG + Intergenic
1053645116 9:40115661-40115683 CAGGTAGACATGACTCCAGGCGG - Intergenic
1053646923 9:40127534-40127556 CAGGTATACATGTGTCATGGTGG + Intergenic
1053689238 9:40574342-40574364 CAGGGAGTCTTGTGTCTGGGTGG + Intergenic
1053758802 9:41336308-41336330 CAGGTATACATGTGTCATGGTGG - Intergenic
1053760602 9:41347867-41347889 CAGGTAGACATGACTCCAGGCGG + Intergenic
1054274795 9:63056718-63056740 CAGGGAGTCTTGTGTCTGGGTGG - Intergenic
1054300484 9:63375281-63375303 CAGGGAGTCTTGTGTCTGGGTGG + Intergenic
1054326139 9:63713559-63713581 CAGGTAGACATGACTCCAGGTGG - Intergenic
1054400030 9:64708212-64708234 CAGGGAGTCTTGTGTCTGGGTGG + Intergenic
1054433617 9:65192472-65192494 CAGGGAGTCTTGTGTCTGGGTGG + Intergenic
1054496768 9:65829197-65829219 CAGGGAGTCTTGTGTCTGGGTGG - Intergenic
1054537656 9:66248636-66248658 CAGGTATACATGTGTCATGGTGG - Intergenic
1054539457 9:66260310-66260332 CAGGTAGACATGACTCCAGGCGG + Intergenic
1054936797 9:70696825-70696847 CAGGCAGAGAAGGGTCTGGGGGG - Intronic
1056255460 9:84795011-84795033 AAGGTAGACATTAATTTGGGGGG - Intronic
1056906897 9:90659581-90659603 CAGGTAAACTTGTGTCTTGGTGG + Intergenic
1057792665 9:98134396-98134418 CAGGTGGACATGAGTTTTGGGGG - Intronic
1058378394 9:104351797-104351819 TAGGTAAACATGTGTCAGGGTGG - Intergenic
1058432303 9:104929722-104929744 CAGGTACTCATAACTCTGGGTGG + Intergenic
1058974929 9:110117207-110117229 GAGGAACACATGAGCCTGGGAGG - Intronic
1059320645 9:113465764-113465786 GAGGCAGACAGGAGCCTGGGTGG + Intronic
1060518814 9:124282461-124282483 CAGATAGACAAGGGTTTGGGGGG + Intronic
1060868512 9:127019794-127019816 CAGGTAAACATGTGTCATGGGGG + Intronic
1060903109 9:127279053-127279075 CAGGTGGACCTGAATTTGGGGGG + Intronic
1061038366 9:128125863-128125885 CTGGTGAACATGAGCCTGGGTGG - Intronic
1061638190 9:131928871-131928893 CAGGGAGACAGTAGCCTGGGTGG + Intronic
1062083898 9:134638696-134638718 CAGCCAGACGTGACTCTGGGAGG + Intergenic
1062635898 9:137491586-137491608 TGGGTAGACATGAATTTGGGGGG - Intronic
1202792916 9_KI270719v1_random:99116-99138 CAGGTAGACATGACTCCAGGCGG - Intergenic
1202794709 9_KI270719v1_random:110837-110859 CAGGTATACATGTGTCATGGTGG + Intergenic
1186166650 X:6833548-6833570 TAGGTAGACGTGAGGCTGAGTGG + Intergenic
1187272451 X:17791511-17791533 CAGGAAGACAGGTATCTGGGAGG + Intergenic
1188171582 X:26933860-26933882 AAAGTAAACATGAGTCTGGCTGG - Intergenic
1189594190 X:42547070-42547092 CAGGTAGTCATGAGTCAATGTGG + Intergenic
1189744061 X:44151709-44151731 AGGGTAGACATGAGTTTTGGAGG + Intronic
1190256856 X:48769887-48769909 CAGGATCACTTGAGTCTGGGAGG + Intronic
1190334286 X:49253045-49253067 GAGGGAGACAGGAGTTTGGGAGG + Intronic
1190943977 X:55072936-55072958 CAGGTAGACATCAGACTGCTGGG + Intergenic
1192703328 X:73499752-73499774 CAGGTTGACTTGGCTCTGGGAGG - Intergenic
1192732088 X:73810661-73810683 CAGGATGACCTGAGCCTGGGAGG - Intergenic
1195297035 X:103489404-103489426 GAGGTGGAACTGAGTCTGGGTGG - Intergenic
1196550175 X:117015229-117015251 CAGGTAAACATGTGTCCTGGAGG - Intergenic
1198187546 X:134268212-134268234 CATGAAGACATATGTCTGGGAGG - Intergenic
1199095953 X:143738757-143738779 CAGGTAAACATGTGTCATGGTGG - Intergenic
1201751402 Y:17435845-17435867 GAGGAAGACATGAACCTGGGAGG + Intergenic