ID: 1162498853

View in Genome Browser
Species Human (GRCh38)
Location 19:11039580-11039602
Sequence CGCTGAGGGCTGCACAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162498853 Original CRISPR CGCTGAGGGCTGCACAACAC TGG Intronic
902956052 1:19924711-19924733 GGCCGAGGGCTGCAGTACACCGG - Intergenic
904443746 1:30550966-30550988 CGCTGAAGGCAGCTCAGCACTGG + Intergenic
906659500 1:47572507-47572529 GGGTGAGGGCTGGACAAGACTGG - Intergenic
906854729 1:49292248-49292270 GGCTGAGGGCAGCTCATCACTGG + Intronic
906913482 1:49982460-49982482 TGCTGAGGGCAGCTCAGCACTGG + Intronic
907369674 1:53992742-53992764 GGCTGAGGGCAGCTCAGCACTGG - Intergenic
911042142 1:93599456-93599478 GGCTGAGGGCAGCCCAACATTGG + Intronic
913090838 1:115475527-115475549 TGAGGAGGGCTGCACAACAGTGG + Intergenic
915520568 1:156439988-156440010 CGCTGAGGGCTGGACAGAAAAGG + Intergenic
916063933 1:161121017-161121039 TGCTGAGGGCTGAGCAGCACTGG + Exonic
916414167 1:164576928-164576950 CACCGAGGTCTGCACAGCACCGG - Intronic
1065201495 10:23317099-23317121 CACTGAGGGTGGCACAGCACAGG - Exonic
1065746438 10:28846673-28846695 AGCTGAGAGCTGTAAAACACAGG + Intronic
1069150937 10:64958871-64958893 CACTGAGGGTTGCAAACCACTGG + Intergenic
1069817601 10:71208500-71208522 TGGTGATGGCTGCACAACATTGG + Intergenic
1070167673 10:73911035-73911057 CGCTGAGCGCTGCAAGACAGGGG + Exonic
1074028740 10:109663682-109663704 GGCTGAGGGCAGCTCAGCACTGG + Intergenic
1076146668 10:128127307-128127329 CTCTGATGGCTGCAGAGCACTGG + Intergenic
1078638322 11:13073278-13073300 CACTGAGGCCTCCAGAACACTGG - Intergenic
1081884163 11:46480502-46480524 GGATGAGGGTTGCACAACCCTGG - Intronic
1084945056 11:72633924-72633946 CGCTGAAGGGAGCACAGCACTGG + Intronic
1085778231 11:79385046-79385068 TGATGTGGGCTGCACAACATAGG + Intronic
1089235194 11:117018370-117018392 AGCTGACCCCTGCACAACACAGG - Intronic
1089560253 11:119340054-119340076 CGCTCAGGGCTGCAAAGCGCGGG + Intronic
1089754890 11:120679436-120679458 CCCAGTGGGCTGCAAAACACTGG - Intronic
1090413479 11:126525032-126525054 TGCTTAGGGCTGCAGAACAATGG - Intronic
1090514696 11:127412509-127412531 GGCTGAGGGCTGCTCTGCACTGG - Intergenic
1091361633 11:134982581-134982603 CTCTGGGGGCTCCACAGCACTGG + Intergenic
1093493046 12:19726238-19726260 GGCTGAGGGCAGCTCAGCACTGG - Intergenic
1097130931 12:56810258-56810280 GGCTGAGGGCAGCTCAGCACTGG - Intergenic
1097446528 12:59678843-59678865 GGCTGAGGGCAGCTCAGCACTGG - Intronic
1097572941 12:61356237-61356259 TGCTGAGGGCAGCTCAGCACTGG - Intergenic
1099433880 12:82620260-82620282 ACCTGAAGGCAGCACAACACTGG - Intergenic
1102012903 12:109629688-109629710 CAATGAGGGTTGCACAACAGAGG + Intergenic
1104075724 12:125388053-125388075 CATGGAGGGCTGCATAACACAGG + Intronic
1106621556 13:31375545-31375567 CCCTGATGGCTGCCCAACAATGG - Intergenic
1110439161 13:75508094-75508116 AGCTGAGGGCAGCTCAGCACAGG - Intergenic
1111293870 13:86255477-86255499 GGCTGTGCGCTGCACAACTCGGG - Intergenic
1113728999 13:112626297-112626319 CGCAGGGGGCTGCTCATCACAGG - Intergenic
1118947058 14:70398412-70398434 TGCTGAGGGCAGCTCAGCACTGG - Intronic
1123050730 14:105540792-105540814 CGCTTAGGGCTGCAGAGCCCTGG + Intergenic
1125997847 15:44181568-44181590 TGGTGAGGGTTGCACAACTCTGG - Intronic
1128900948 15:71422635-71422657 ACCTGAAGGCAGCACAACACTGG + Intronic
1129306126 15:74664493-74664515 CACTGAGGGTTACACAACAATGG - Intronic
1130185315 15:81674980-81675002 CACTCAGGGCTGCCCAACATAGG - Intergenic
1130205280 15:81869836-81869858 CGATGAGGGCTGCATGACAGCGG - Intergenic
1132381727 15:101370873-101370895 TGCTGTGGGGTGCACAGCACAGG + Intronic
1133863762 16:9621853-9621875 TGCTGAGGGGTGCTCAACTCAGG - Intergenic
1135124875 16:19800256-19800278 GGCTGTGCGCTGCACAACTCGGG + Intronic
1140218297 16:73025458-73025480 CCGTGAGGGCTCCACAATACGGG - Intronic
1141174003 16:81707612-81707634 CACTGAGGGCTGCGCTGCACCGG + Intronic
1142335382 16:89486238-89486260 GGCTGAGGCCTACACAACACAGG + Intronic
1142388166 16:89780192-89780214 CGAGGAGGGCCGCACATCACGGG - Intronic
1146848013 17:36196860-36196882 TGCTGAGTGTTGCACAACTCAGG + Intronic
1154493673 18:14940348-14940370 CTCTGGGGGCTCCACAGCACTGG - Intergenic
1156094354 18:33510956-33510978 ACCTGAAGGCTGCACATCACTGG - Intergenic
1158788002 18:60739710-60739732 TGCTGAGGGCAGCTCAGCACAGG + Intergenic
1160770988 19:831016-831038 GGCTGAGGGCGGCACAGCAGGGG + Intronic
1160896377 19:1404053-1404075 CGGTGATGGTTGCACAACAATGG + Intergenic
1161594319 19:5143524-5143546 CCCTGGGGGTTGCAGAACACGGG + Intronic
1161716326 19:5877972-5877994 CGCTGAGGTCTGCCCACCCCTGG + Intronic
1162109946 19:8394585-8394607 AGCTGAGGCCTGCAAAGCACTGG + Intronic
1162498853 19:11039580-11039602 CGCTGAGGGCTGCACAACACTGG + Intronic
1165101206 19:33439647-33439669 GGCTGAGGGATGCCCACCACAGG + Intronic
1168518879 19:57032719-57032741 TGGTGATGGCTGCACAACAATGG - Intergenic
927237032 2:20883924-20883946 GGGTGATGGCTGCACAACAATGG - Intergenic
927886489 2:26721660-26721682 CTCTGGGGGCTGCAAGACACAGG - Intronic
928823571 2:35391948-35391970 TGCTGAGGGCAGCTCAACACGGG - Intergenic
929450886 2:42036249-42036271 CGCAAAGGGCTGCACATCAGGGG - Intergenic
929492413 2:42408141-42408163 GGCTGAGGGCAGCTCAGCACTGG + Intronic
935087656 2:99864173-99864195 TGATGATGGCTGCATAACACAGG + Intronic
935478509 2:103556442-103556464 ACCTGAAGGCAGCACAACACTGG + Intergenic
936092810 2:109511909-109511931 TGCTGTGGGCAGCACCACACTGG - Intergenic
937206867 2:120242318-120242340 TGATGATGGCTGCACGACACTGG + Intronic
937362531 2:121239007-121239029 TGTTGTGGGCTGCACAGCACGGG - Intronic
941002976 2:160220913-160220935 CCCTGAGGGCTGGAGAACAAAGG - Intronic
948396653 2:237649751-237649773 TGGTGAGGCCTGAACAACACTGG - Intronic
949037787 2:241825683-241825705 CGGTGATCGCCGCACAACACTGG + Intergenic
1173207644 20:41007279-41007301 GGCTGAGGGCAGCTCAGCACTGG - Intergenic
1174410780 20:50333683-50333705 GGCTGAGAACTGCAGAACACGGG + Intergenic
1174841770 20:53907974-53907996 GGGTGAGGTCTGCACAGCACTGG - Intergenic
1182042246 22:27247315-27247337 CTCTGTGGGCTGCAAAACCCAGG - Intergenic
1183365818 22:37406392-37406414 CCCAGAGGGCTGCACATCTCGGG + Intronic
1184341277 22:43887391-43887413 GGCTGCGGGCTGCTCAACAGTGG + Intronic
1184720360 22:46309043-46309065 CTCTGAGGCCTACAAAACACAGG + Intronic
950355847 3:12408345-12408367 TGCACAGGACTGCACAACACTGG + Intronic
950548188 3:13651451-13651473 CCCTGAGGCCTGCAGGACACCGG + Intergenic
951047066 3:18051671-18051693 CGCTGATGACTTTACAACACAGG - Intronic
951264757 3:20552622-20552644 AGCTGAGGGCAGCTCAGCACTGG - Intergenic
952408500 3:33026404-33026426 TGCTGAGGGCAGCTCAGCACTGG + Intronic
958839606 3:99187276-99187298 CCCTGAAGCCAGCACAACACCGG - Intergenic
959382109 3:105653728-105653750 GGTTAAGGGCTGCCCAACACTGG - Intergenic
960634278 3:119768272-119768294 TGCTGAGGGCAGCTCAGCACTGG - Intergenic
965229161 3:166028861-166028883 TGCTGAGGGCTGCACTTCTCAGG - Intergenic
965924335 3:173958806-173958828 TGCTGAGGGCAGCTCAACACTGG - Intronic
967260648 3:187638482-187638504 AGATGAGGGCTGCAAAGCACAGG + Intergenic
968609372 4:1550200-1550222 CCCTCAGGGCTGCACCACCCAGG + Intergenic
969414298 4:7048650-7048672 TGGTGATGGCTGTACAACACTGG - Intronic
969705164 4:8787727-8787749 CCATGATGGCTGCACAACACGGG + Intergenic
969803783 4:9590357-9590379 AGCTGAGGGCAGCACGAAACTGG - Intergenic
971491868 4:27221071-27221093 CACTGAATGCTGCAAAACACTGG - Intergenic
974683534 4:65195194-65195216 CACTGAGGGCAGCTCAGCACTGG - Intergenic
980450107 4:132959104-132959126 TGCTGAGGGCAGCTCAGCACTGG + Intergenic
980671108 4:136008507-136008529 TGCTGAGGGCAGCCCAGCACTGG + Intergenic
984169401 4:176343097-176343119 CACTGAGGGCTGCAGACAACAGG - Intergenic
985416571 4:189741543-189741565 TGGTGATGGCTGCACAACAATGG - Intergenic
985634634 5:1030036-1030058 CCCTGGGGGCTTCACCACACAGG + Intronic
986199080 5:5565116-5565138 AGCTGAGGGCTCCACCACAGAGG - Intergenic
986767662 5:10942202-10942224 CCCCGAGGGCTGGGCAACACAGG - Intergenic
989107272 5:37875335-37875357 TGCTGAGAGCTGCACCCCACCGG - Intergenic
989821731 5:45800884-45800906 CGCTGAGGGCTGCACTCGTCAGG + Intergenic
992162471 5:74016509-74016531 CTCTCTGGGGTGCACAACACCGG - Intergenic
992218984 5:74553438-74553460 CGATGATGGCTACACAACAATGG - Intergenic
993651683 5:90529675-90529697 CGCGGAGGGCAGCCCAAAACGGG + Intronic
993703387 5:91143846-91143868 GGCTGAGGGCAGCTCAGCACTGG - Intronic
996319403 5:122197700-122197722 CTCAGAGGGCTGCAAACCACTGG + Intergenic
996627662 5:125589163-125589185 TGTTGAGGGCTGAAGAACACTGG - Intergenic
999315261 5:150579434-150579456 GGCTGAGGGCAGCTCAGCACTGG + Intergenic
999437111 5:151571440-151571462 TGCTGGGGCCTGCCCAACACGGG - Intergenic
1000232492 5:159329111-159329133 TGCTAAGGGCTTCCCAACACTGG + Intronic
1002083482 5:176751969-176751991 TGCTGATGGCTGCACAACAATGG + Intergenic
1007725601 6:43913912-43913934 AGCTGAGGGATGCAGAACAGGGG + Intergenic
1012889894 6:104885829-104885851 GGCTGAGGGCAGCTCAGCACAGG + Intergenic
1016622931 6:146133737-146133759 AGGTGAGGGCTGCAAAGCACAGG - Intronic
1017203324 6:151778316-151778338 TGGTGATGGCTGCACAACACTGG + Intronic
1018817206 6:167342592-167342614 AGGTGATGGTTGCACAACACGGG + Intronic
1023087134 7:36582272-36582294 AGTTGAGGGATGCACAAGACGGG + Intronic
1023491937 7:40752241-40752263 CGGTCATGGCTGCAGAACACTGG + Intronic
1023783300 7:43679457-43679479 AGCTGAGGGCCACACAACAAGGG + Intronic
1024213656 7:47228195-47228217 TGGTGATGGCTGCACAACAGTGG + Intergenic
1025996076 7:66528311-66528333 CCCTGAGGGCTGAACACCATTGG + Intergenic
1026019513 7:66696734-66696756 TGCTGAGGGCTGGGAAACACTGG + Intronic
1026880874 7:73905848-73905870 TGCTGAGGGCTGGGAAACACTGG - Intergenic
1027867253 7:83663400-83663422 AGCTGTGAGGTGCACAACACAGG + Intergenic
1030981143 7:116186482-116186504 GGCTGAGGGCAGCTCAGCACAGG - Intergenic
1032121893 7:129162624-129162646 CACTGAGGGGTGGACAGCACAGG - Intronic
1035378835 7:158425431-158425453 AGCTGAGGCCTGCGCACCACCGG + Intronic
1035378938 7:158425881-158425903 AGCTGAGGCCTGCACAGCGCCGG + Intronic
1035379198 7:158427079-158427101 AGCTGAGGCCTGCGCACCACCGG + Intronic
1035379403 7:158427978-158428000 AGCTGAGGCCTGCACAGCGCCGG + Intronic
1038022578 8:23562576-23562598 CTCTGTGGCCTGCACAACCCTGG + Intronic
1045248797 8:100466198-100466220 GGCTCAGGGCTGCACAACACAGG + Intergenic
1048101737 8:131359322-131359344 CACAGAGGCCTGCACAAGACTGG - Intergenic
1049272677 8:141704281-141704303 CGCTGAGGGTTGCAACTCACGGG + Intergenic
1050045131 9:1535154-1535176 AGGTGACGGTTGCACAACACTGG - Intergenic
1051229939 9:14945524-14945546 CTCTGAGCCCAGCACAACACTGG - Intergenic
1052806114 9:33014776-33014798 CTCTGATGGCAGCACAACAAAGG - Intronic
1057128131 9:92635119-92635141 CTCTCAGGGCTGCCCAACAGGGG + Intronic
1057725263 9:97563915-97563937 ACGTGAGGGCTGCACATCACAGG - Intronic
1058795982 9:108498614-108498636 AGCGGAGGGCTGCAGAACAGTGG - Intergenic
1060375530 9:123112767-123112789 CTCTGAGGCCTGCTGAACACGGG + Intronic
1061267314 9:129514339-129514361 GGCTGAGGGCAGCTCAGCACTGG + Intergenic
1061444553 9:130630607-130630629 CCCTGCGGACAGCACAACACAGG - Exonic
1185463065 X:341155-341177 CGGTGGGGGCTGCACGGCACAGG - Intronic
1189009637 X:37034427-37034449 AGCTGAGGGCTGAATCACACTGG - Intergenic
1189038933 X:37521290-37521312 AGCTGAGGGCTGAATCACACTGG + Intronic
1190360595 X:49645091-49645113 TGCTGAGGGCAGCTCCACACTGG - Intergenic
1191022513 X:55877815-55877837 TGCTGTGGCTTGCACAACACTGG + Intergenic
1193554109 X:82932416-82932438 AGCTGAGGGCAGCTCAGCACTGG + Intergenic
1194867421 X:99086096-99086118 CTCTGCAGGCTGAACAACACTGG - Intergenic
1196883697 X:120223538-120223560 GGCTGAGGGCAGCTCAGCACTGG - Intergenic
1197507393 X:127323391-127323413 GACTGTGGGCTGCTCAACACTGG - Intergenic
1197774733 X:130111423-130111445 CGCTGGGGCCTGCACACCCCAGG - Intergenic
1198804949 X:140484972-140484994 CAGTAAGGGCTGCACAATACTGG - Intergenic
1200247338 X:154533196-154533218 CCCTGAGGGCTGCACATCTGTGG - Intronic