ID: 1162499848

View in Genome Browser
Species Human (GRCh38)
Location 19:11046551-11046573
Sequence CTGTGCTTCCAGCACTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1322
Summary {0: 1, 1: 0, 2: 11, 3: 133, 4: 1177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162499848_1162499854 20 Left 1162499848 19:11046551-11046573 CCTCCTGAGTGCTGGAAGCACAG 0: 1
1: 0
2: 11
3: 133
4: 1177
Right 1162499854 19:11046594-11046616 CACTGTAATGTGATTTGCACAGG 0: 1
1: 0
2: 1
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162499848 Original CRISPR CTGTGCTTCCAGCACTCAGG AGG (reversed) Intronic
900660883 1:3782836-3782858 CTGTGGTCCCAGCACTCAGGAGG + Intronic
900811303 1:4803315-4803337 CTATGCTTCCAGAACACAGCAGG - Intergenic
900852846 1:5157563-5157585 CTGTGCCTCCCAGACTCAGGCGG + Intergenic
900961724 1:5926697-5926719 TGGTGCTTCCATCACTCAGGAGG - Intronic
900989116 1:6089957-6089979 CTGTAATCCCAGCACTCTGGGGG - Intronic
901085642 1:6610566-6610588 CTGTAATCCCAGCTCTCAGGAGG + Intronic
901407167 1:9057032-9057054 CTGTAATCCCAGCACTCTGGGGG + Intronic
901503854 1:9671701-9671723 CTGTAATTCCAGCACTTTGGGGG - Intronic
901963114 1:12843141-12843163 CTGTCATTCCAGCACTTTGGGGG + Intergenic
902035161 1:13452657-13452679 CTGTACTTCCAGCACTTTGGGGG - Intergenic
902054629 1:13590083-13590105 CTGTAATTCCAGCACTTGGGAGG - Intronic
902063539 1:13665335-13665357 CTGTAATCCCAGCTCTCAGGAGG - Intergenic
902102111 1:13999224-13999246 CTGTAATCTCAGCACTCAGGAGG + Intergenic
902118975 1:14145320-14145342 CTGTAGTCCCAGCTCTCAGGAGG + Intergenic
902140283 1:14348005-14348027 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
902407503 1:16193124-16193146 CTGTGATCCCAGCACTTTGGGGG + Intergenic
902510457 1:16964056-16964078 CTGTAATCCCAGCACTCTGGTGG - Intronic
902835071 1:19041908-19041930 GTGTGCTTTGAGCACTCAGAAGG + Intergenic
903085537 1:20854435-20854457 CTGTAATCCCAGCACGCAGGAGG + Intronic
903378574 1:22881714-22881736 TTGTAATCCCAGCACTCAGGAGG - Intronic
903595701 1:24492582-24492604 CTGTGGTCCCAGCTCTTAGGAGG - Intergenic
903746766 1:25592323-25592345 CTGTAATCCCAGCACTGAGGAGG - Intergenic
903828165 1:26159744-26159766 CTCAGCCTCCAGGACTCAGGGGG + Intronic
904027274 1:27512442-27512464 CTGTAATCCCAGCACTCTGGGGG - Intergenic
904171693 1:28595782-28595804 CTGTAATCCCAGCACTTAGGAGG + Intronic
904531082 1:31169969-31169991 CTGTAATCCCAGCACTCTGGAGG - Intergenic
904739554 1:32662727-32662749 CTGTAATTCCAGCACTTGGGAGG + Intronic
904761553 1:32808339-32808361 CTGTAATCCCAGTACTCAGGAGG - Intronic
904820098 1:33236821-33236843 CTGTAATCCCAGCACTGAGGTGG + Intergenic
905073517 1:35248651-35248673 CTGTAATTCCAGCACTTCGGAGG - Intergenic
905202999 1:36326485-36326507 CTGTAATTCCAGCACTTTGGAGG - Intronic
905576130 1:39046133-39046155 CTGTAATTCCAGCACTTGGGAGG - Intergenic
905620862 1:39445700-39445722 CTGTAATTCCAGCACTTGGGAGG + Intronic
905729112 1:40283381-40283403 CTGTAATCCCAGTACTCAGGAGG + Intronic
905955942 1:41996134-41996156 CTGTAATCCCAGCAATCAGGAGG + Intronic
906029714 1:42708847-42708869 CTGTAATCCCAGCACTCTGGGGG - Intergenic
906230577 1:44159400-44159422 CTGTAATTCCAGCACTTGGGTGG - Intergenic
907013722 1:50990535-50990557 CTGTAATCCCAGCACTCCGGGGG - Intergenic
907039126 1:51242367-51242389 CTGTCATCCCAGCACTTAGGTGG + Intronic
907099450 1:51815277-51815299 CTGTAATTCCAGCACTTGGGAGG - Intronic
907210173 1:52814276-52814298 CTGTAATCCCAGCACTTAGGGGG - Intronic
908243163 1:62205092-62205114 CTGTAATTCCAGCACTTTGGAGG + Intronic
908604119 1:65775848-65775870 CTGTGCTTCCAGGTTGCAGGTGG - Intergenic
909067333 1:70950970-70950992 CTGTAATTCCAGCACTTTGGAGG - Intronic
909560711 1:77006577-77006599 CTGTAATTCCAGCACTTTGGAGG - Intronic
909587099 1:77302154-77302176 CTGTAATCCCAGCACTTAGGAGG - Intronic
909643922 1:77895604-77895626 CTGTAATTCCAGCACTTTGGGGG + Intronic
909702143 1:78537743-78537765 CTGTGCTACCAGTACTAAGAGGG + Exonic
910278306 1:85471230-85471252 CTATGGTTCCAGCTCTCAGCTGG + Intronic
910358585 1:86392141-86392163 CTGTGCTTGCAGGAGTAAGGTGG - Intronic
910754511 1:90673194-90673216 CTGTGAATTCAACACTCAGGTGG + Intergenic
910817426 1:91306208-91306230 CTGTAATCCCAGCACTCGGGAGG + Intronic
910884495 1:91950766-91950788 CTGTAATCCCAGCACTTAGGAGG + Intronic
910901036 1:92121020-92121042 CTGTAATCCCAGCACTCTGGGGG - Intronic
910962053 1:92773082-92773104 CTGTAATCCCAGCACTCGGGAGG + Intronic
911116712 1:94253224-94253246 CTGTAATTCCAGCACTTAGGGGG - Intronic
911192279 1:94960070-94960092 CTGTAATCCCAGCACTGAGGTGG - Intergenic
911303911 1:96209573-96209595 CTGTGCTTCCAACACTCTGGAGG + Intergenic
911578094 1:99602106-99602128 CTGTGATCCCAGCACTTGGGAGG + Intergenic
911614124 1:99989885-99989907 CTGTGGTCCCAGCATTCAAGAGG - Intronic
912920282 1:113860104-113860126 CTGTGGTCCCAGCTTTCAGGAGG - Intronic
913074465 1:115330010-115330032 CTGTAATCCCAGCACTTAGGGGG - Intronic
913103058 1:115587337-115587359 CTGTCCTCCCAGTGCTCAGGTGG - Intergenic
914049145 1:144117251-144117273 CTGTAATCCCAGCACTCTGGAGG + Intergenic
914130039 1:144848194-144848216 CTGTAATCCCAGCACTCTGGAGG - Intergenic
915084122 1:153373346-153373368 CTGTAGTTCCAGTACTCAGGAGG - Intergenic
915190696 1:154148000-154148022 CTGTAATCCCAGCACTCTGGGGG + Intronic
915403785 1:155643768-155643790 CTACACTTCCAGCACCCAGGAGG - Intergenic
915872490 1:159575734-159575756 CTGTAGTCCCAGCACTCGGGAGG + Intergenic
916234375 1:162571384-162571406 CTGTAATTCCAGCACTTGGGAGG - Intronic
916347565 1:163811207-163811229 CTGTAATTCCAGCACTCTGGGGG + Intergenic
916674765 1:167055769-167055791 CTGTACCTCCAGCAATGAGGAGG - Exonic
916758800 1:167798438-167798460 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
916917108 1:169419320-169419342 CTGTAATCCCAGCACTCTGGGGG + Intronic
917119652 1:171634342-171634364 CTGTAATCCCAGCACTCTGGAGG + Intergenic
917616427 1:176750346-176750368 CTGTAATTCCAGCACTTGGGAGG + Intronic
917636713 1:176944197-176944219 CTGTAATCCCAGCACTCAGGAGG - Intronic
917672315 1:177284432-177284454 CTTTGCTTCTAGAACACAGGTGG + Intergenic
917715092 1:177726923-177726945 CTGCAGTCCCAGCACTCAGGAGG + Intergenic
918030572 1:180804231-180804253 CTGTAATCCCAGCACTCGGGAGG - Intronic
918049661 1:180963235-180963257 CTGTAATCCCAGCACTCTGGGGG + Intergenic
918967737 1:191373421-191373443 CTGTAATTCCAGCACTTTGGGGG - Intergenic
919875757 1:201866246-201866268 CTGTGATCCCAGCACTTTGGGGG - Intronic
919968796 1:202557239-202557261 CTGTAATCCCAGCACTCTGGAGG - Intronic
920082264 1:203383400-203383422 CTGTAATTCCAGCACTTAGGAGG - Intergenic
920082604 1:203386161-203386183 CTGTAATTCCAGCACTTTGGGGG - Intergenic
920129636 1:203721916-203721938 CTGTAATCCCAGCACTCTGGGGG - Intronic
920217683 1:204373028-204373050 CTGTAGTCCTAGCACTCAGGGGG - Intronic
920241662 1:204556438-204556460 CTGTTATTCCAGCACTGGGGTGG + Exonic
920272781 1:204778841-204778863 CTGTAATTCCAGTACTCAAGAGG + Intergenic
920337463 1:205254777-205254799 CTGTGCTTCCCGGGATCAGGAGG - Intronic
920617819 1:207511077-207511099 CTGTAATTCCAGCACTTTGGGGG - Intronic
920832045 1:209474284-209474306 ATGGCCTGCCAGCACTCAGGAGG - Intergenic
920919817 1:210289277-210289299 CTGTAATCCCAGTACTCAGGAGG - Intergenic
921619386 1:217309351-217309373 CTGTAGTCCCAGCACTTAGGAGG + Intergenic
921729007 1:218555773-218555795 CTGTAGTCCCAGCACTCGGGAGG - Intergenic
921803561 1:219429533-219429555 CTGTGGTTCCACCACTTGGGGGG + Intergenic
922101753 1:222482808-222482830 CTGTAATTCCAGCACTTTGGGGG - Intergenic
922645651 1:227283933-227283955 CTGTAATCCCAGCACTCGGGAGG + Intronic
922766970 1:228161108-228161130 CTGTGGTCCCAGTACTCAGGAGG + Intergenic
922810034 1:228410215-228410237 CTGTGGTCCCAGGACTCAGGAGG - Intronic
922947416 1:229529032-229529054 CTGTAATCCCAGCACTCTGGGGG + Intronic
923123293 1:231014022-231014044 CTGTAATTCCAGCACTTTGGGGG + Intergenic
923128233 1:231051257-231051279 CTGTAATCCCAGTACTCAGGAGG + Intergenic
923407981 1:233681513-233681535 CTGTGCTTCCACTACTTGGGAGG - Intergenic
923447826 1:234089017-234089039 CTGTAATCCCAGCACTCTGGGGG - Intronic
923582334 1:235230157-235230179 CTGTAATCCCAGCACTTAGGAGG + Intronic
923825582 1:237496145-237496167 CTGTTATTCCAGCACTTGGGAGG + Intronic
924048867 1:240060445-240060467 CTGTAATTCCAGCACTTTGGAGG + Intronic
924156479 1:241181950-241181972 CTGTAATTCCAGCACTTTGGGGG - Intronic
1062788119 10:282245-282267 CCCTGCTTCCAGGACTCAGCGGG + Intronic
1063502457 10:6567521-6567543 CTGTGCTTACATTCCTCAGGAGG + Intronic
1063689370 10:8271801-8271823 CTGTAGTTCCAGCTATCAGGAGG + Intergenic
1064124456 10:12647877-12647899 CAGTGCTGCCGGCTCTCAGGAGG - Intronic
1064198721 10:13266503-13266525 CTATAATCCCAGCACTCAGGAGG - Intergenic
1064275168 10:13898923-13898945 CTGTAATTCCAGCTCTCTGGAGG + Intronic
1064394655 10:14971858-14971880 CTGTAATTCCAGCACTTGGGAGG + Intronic
1064426578 10:15234917-15234939 CTGTAATCCCAGCACTCTGGGGG - Intronic
1064483527 10:15762679-15762701 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1064559828 10:16585064-16585086 CTGTAATTCCAGCACTTTGGAGG - Intergenic
1064623041 10:17234235-17234257 CTGTGGTTCCAGCTCTTAGGGGG - Intronic
1064823743 10:19371138-19371160 CTGTCGTCCCAGCTCTCAGGAGG + Intronic
1064983782 10:21189722-21189744 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1065137507 10:22686590-22686612 CTGTGGTCTCAGTACTCAGGAGG - Intronic
1065353385 10:24815621-24815643 CTGTAGTTCCAGTACTCGGGAGG + Intergenic
1065438886 10:25728847-25728869 CTGTGATTCCAGCACTTTGTGGG - Intergenic
1065707400 10:28483253-28483275 CTGTAATTCCAGCACTTTGGAGG + Intergenic
1066245312 10:33577500-33577522 CTGTAGTCCTAGCACTCAGGAGG + Intergenic
1066369446 10:34808054-34808076 CTGTAATCCCAGCACTCTGGAGG + Intronic
1066420020 10:35256474-35256496 CTGTAATTCCAGCACTCTGGGGG + Intronic
1066601623 10:37114223-37114245 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1067117628 10:43447362-43447384 CTGTAATCCCAGCTCTCAGGAGG - Intronic
1067254369 10:44621363-44621385 CTGTAATCCCAGCACTCAGGAGG - Intergenic
1067451092 10:46382512-46382534 CTCCGCTGCCTGCACTCAGGTGG + Intronic
1067533808 10:47093407-47093429 CTGTGGTTCCAGCAATCTTGGGG + Intergenic
1067548223 10:47212083-47212105 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1067586151 10:47477239-47477261 CTCCGCTGCCTGCACTCAGGTGG - Intronic
1068523317 10:58101453-58101475 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1068550660 10:58404380-58404402 CTGTAATTCTAGCACTCTGGGGG + Intergenic
1068978363 10:63035223-63035245 CTGTAATTCCAGCACTTGGGAGG + Intergenic
1069036271 10:63648969-63648991 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1069258308 10:66361793-66361815 CTGTAATTCCAGCACTTTGGGGG - Intronic
1069376545 10:67798885-67798907 CTGTAATCCCAGCACTCGGGAGG - Intronic
1069746614 10:70718951-70718973 CTGTAATCCCAGCACTCTGGGGG - Intronic
1069874306 10:71552297-71552319 CTGTCCCTCCAGCTCTCATGTGG - Intronic
1069923689 10:71833334-71833356 CTGTGGTTCCAGTACTCAGGAGG + Intronic
1070094202 10:73320787-73320809 CTGTAGTTCCAGCTATCAGGAGG - Intronic
1070540343 10:77411122-77411144 CTATACTCCTAGCACTCAGGAGG - Intronic
1070568456 10:77621669-77621691 CTGTAATTCCAGCACTTTGGGGG + Intronic
1070569138 10:77627837-77627859 GTGGGCTTCCAGCACTGGGGAGG + Intronic
1070638269 10:78146686-78146708 CTCTCCTTCCAGCAGTCAGTAGG - Intergenic
1070837279 10:79457314-79457336 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1070957099 10:80471378-80471400 CTGTGCCTCCAGACCTCAGGAGG - Intronic
1071182708 10:83005514-83005536 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1071390911 10:85174618-85174640 GTGTGCTTCCAGGATGCAGGTGG - Intergenic
1072586927 10:96790902-96790924 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1072687608 10:97547819-97547841 CTGTGATCCCAGCACTTGGGAGG - Intronic
1072700266 10:97635676-97635698 CTGTGGTGCCAGCACTCGGGAGG + Intronic
1072788024 10:98297330-98297352 CTCTGCTTCCACCACTCAAAGGG - Intergenic
1072844530 10:98815158-98815180 CTGTGGTCCCAGTACTCAGGAGG + Intronic
1073219826 10:101861925-101861947 CTGTAGTCCCAGCACTCGGGAGG + Intronic
1073700046 10:105916412-105916434 CTCTTCTTCCATCACTCAGTTGG + Intergenic
1073833627 10:107415516-107415538 CTGTCCTCCCAGTACACAGGTGG + Intergenic
1073849960 10:107603382-107603404 CTGTGGTCCCAGCACTCAAGAGG + Intergenic
1073912264 10:108359937-108359959 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1074060433 10:109960484-109960506 CTGTAATTCCAGCACTTGGGAGG - Intergenic
1074096153 10:110314807-110314829 CTGTAATCCCAGCACTCAGGAGG - Intergenic
1074096179 10:110314941-110314963 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1074129174 10:110558032-110558054 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1074613524 10:115043199-115043221 CTGTAATCCCAGTACTCAGGAGG + Intergenic
1074752300 10:116598428-116598450 CTGTGACTCCAGCAATCAGTTGG + Intronic
1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG + Intronic
1075502112 10:122984593-122984615 CTGTGATCCCAGCACTTGGGAGG + Intronic
1076104780 10:127812969-127812991 TTGTGAGTCCACCACTCAGGAGG - Intergenic
1076247025 10:128955200-128955222 CCCTGCTTCCAGCACTGTGGAGG + Intergenic
1076365202 10:129917109-129917131 CTGTAATTCCAGCACTTGGGAGG + Intronic
1077229701 11:1453223-1453245 CTGTGACTCCAGCACCCACGTGG - Intronic
1078049991 11:7955756-7955778 CTGTAATCCCAGCACTCTGGAGG - Intergenic
1078208255 11:9248978-9249000 CTGTAATCCCAGCACTTAGGTGG + Intronic
1079061388 11:17251895-17251917 CTGTAATCCCAGCACTCTGGGGG + Intronic
1079254245 11:18812939-18812961 CTCTGCTTCTAGCACTCTGGTGG + Intergenic
1079408615 11:20165962-20165984 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1079921878 11:26442886-26442908 CTGTAATCCCAGTACTCAGGAGG - Intronic
1080381023 11:31772375-31772397 CTGTAATTCCAGCACTTGGGAGG - Intronic
1080467742 11:32513836-32513858 CTGTAATTCCACTACTCAGGAGG + Intergenic
1080865627 11:36192353-36192375 CTGTGCTTCCATCATTAAGGTGG - Intronic
1080916947 11:36669434-36669456 CTGTAATTCCAGCACTTGGGAGG + Intergenic
1081320598 11:41687713-41687735 CTGTAATTCCAGCACTTTGGAGG + Intergenic
1081472147 11:43384396-43384418 CTGTAATCCCAGCACTCTGGGGG + Intronic
1081943339 11:46964540-46964562 CTGTAATCCCAGCACTCTGGGGG - Intronic
1082614898 11:55347846-55347868 CTGTAATTCCAGCACTCTAGGGG - Intergenic
1082931107 11:58606322-58606344 CTGTAATCCCAGCACTCTGGAGG - Intronic
1083388202 11:62328341-62328363 CTGTAATTCCAGCACTTGGGAGG + Intergenic
1083943737 11:65912506-65912528 CTATACTCCCAGCACTCAGGAGG - Intergenic
1084126321 11:67101452-67101474 CTGTAGTCCCAGTACTCAGGAGG + Intergenic
1084469370 11:69347560-69347582 CTGTAATCCCAGCACTCGGGAGG - Intronic
1084552524 11:69854450-69854472 TTGGGATTACAGCACTCAGGTGG + Intergenic
1085056908 11:73410147-73410169 CTGTAGTTCCAGCACTTTGGAGG + Intronic
1085690826 11:78662443-78662465 CTGTAATCCCAGCACTCTGGGGG - Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1086103458 11:83125817-83125839 CTGTGGTCCCAATACTCAGGAGG - Intergenic
1087167086 11:95015554-95015576 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1087244240 11:95815690-95815712 CTGTAATGCCAGCACTTAGGAGG + Intronic
1087247079 11:95851713-95851735 CTGTGCATGTAGCACTCTGGTGG - Intronic
1087299370 11:96414080-96414102 CTGTTCTACCACCACTCAGCTGG - Intronic
1087510191 11:99082438-99082460 CTGTAATTCCAGCACTTTGGAGG - Intronic
1087879543 11:103399411-103399433 CTGTAATCCCAGCACTCTGGGGG - Intronic
1088055364 11:105569670-105569692 CTTTACTTTCAGTACTCAGGAGG + Intergenic
1088193959 11:107255833-107255855 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1088330986 11:108651615-108651637 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1088501489 11:110487599-110487621 CTGTAATCCCAGCCCTCAGGGGG + Intergenic
1088658345 11:112023721-112023743 CTGTAATCCCAGCACTCGGGAGG + Intergenic
1088839842 11:113616591-113616613 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1088871515 11:113894134-113894156 CTGTACTTCCAGCACTTTGGGGG + Intergenic
1089371420 11:117962013-117962035 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1089393193 11:118115979-118116001 ATGTGCTTCCAGCATTCTGCAGG - Intronic
1089984521 11:122800728-122800750 TTGTGGTCCCAGCACTCAGGAGG - Intronic
1090050064 11:123370055-123370077 CTGTGATTCTAGCACACTGGGGG + Intergenic
1090204554 11:124877266-124877288 GTGTCCTTCCCGCACTCAGAGGG + Exonic
1090276147 11:125421113-125421135 ATGTGATTTCAGCACTAAGGGGG + Intronic
1090326455 11:125890200-125890222 CTGTAATTCCAGCACTTTGGAGG - Intronic
1090962505 11:131569697-131569719 CTGTAGTCCCAGCTCTCAGGTGG - Intronic
1091458927 12:629386-629408 CTGTGCTCCCTCCACCCAGGTGG - Intronic
1091465953 12:684673-684695 CTGTGATTCCAGCACTTGGAAGG + Intergenic
1091490942 12:932099-932121 CTGTAATTCCAGCATTTAGGAGG + Intronic
1091761411 12:3089651-3089673 CTGTACTCCCAGCACTCTGGGGG + Intronic
1091947653 12:4562603-4562625 CTGTGCTTCCAGCCCTCACTGGG + Intronic
1092082230 12:5725719-5725741 CTGTCCTTGCAGCCCTAAGGTGG + Intronic
1092898654 12:13037939-13037961 CTATAGTCCCAGCACTCAGGAGG + Intergenic
1093505588 12:19862113-19862135 CTGTAGTCCCAGCTCTCAGGAGG + Intergenic
1093592054 12:20914019-20914041 CTGTAATCCCAGCACTCTGGGGG - Intronic
1093716459 12:22388554-22388576 CTGTAGTTCCAGTACTGAGGAGG + Intronic
1094192957 12:27715382-27715404 CTGTAATCCCAGCACTGAGGCGG - Intronic
1094522467 12:31207332-31207354 CTGTGCTTCCAGGTCCTAGGTGG - Intergenic
1094591537 12:31826332-31826354 CTGTAATCCCAGCACTTAGGAGG + Intergenic
1094621754 12:32086696-32086718 CTGTAATCCCAGCACTCAGGAGG - Intergenic
1095196578 12:39325596-39325618 CTGTAATTCCAGCACTTGGGAGG - Intronic
1095448562 12:42305690-42305712 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1095479402 12:42619845-42619867 CTGTAATCCCAGCACTCGGGAGG - Intergenic
1095572076 12:43694768-43694790 CTGTAATCCCAGTACTCAGGAGG + Intergenic
1095581830 12:43808686-43808708 CTGTAGTCCCAGCTCTCAGGAGG + Intergenic
1095710013 12:45278212-45278234 CTGTAATCCCAGCACTCTGGGGG - Intronic
1095800717 12:46268332-46268354 CTGTGCTTCCCGAACGCACGCGG - Intronic
1096018980 12:48306522-48306544 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1096095347 12:48931641-48931663 CTGGGCTTCCAAGACTCATGGGG + Intronic
1096108523 12:49014004-49014026 CTGTAATTCCAGCTCTCAGGAGG - Intronic
1096248493 12:50011077-50011099 CTGTAATGCCAGCACTCTGGTGG + Intronic
1096365740 12:51026917-51026939 CTGTACTCCCAGCACTTTGGAGG + Intronic
1096731162 12:53613782-53613804 CTGTAATTCCAGCACTTTGGGGG - Intronic
1096735472 12:53649929-53649951 CTGTAATCCCAGCACTCTGGAGG + Intronic
1097025331 12:56050990-56051012 CTGTAGTCCCAGTACTCAGGAGG - Intergenic
1097056099 12:56250312-56250334 CTGTAATTCCAGCACTGAGGTGG - Intronic
1097115719 12:56695367-56695389 CTGTGATCCCAGTACTTAGGGGG + Intergenic
1097147752 12:56953434-56953456 CTGGGCTTCCTGCAGTCAGTGGG + Intronic
1099272726 12:80532342-80532364 CTGTGGTCCCAGCTTTCAGGAGG - Intronic
1099343837 12:81473148-81473170 CTGTAATCCCAGCACTCTGGGGG + Intronic
1099366578 12:81772537-81772559 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1099385156 12:82005336-82005358 TTGTTTTTCCAGCACTGAGGTGG + Intergenic
1099651646 12:85435648-85435670 CTGTAATTCCAGCACTTTGGAGG + Intergenic
1099739409 12:86612616-86612638 CTGTAGTACCAGCTCTCAGGAGG + Intronic
1099850929 12:88096303-88096325 CTGTAATTCCAGCACTTGGGAGG - Intronic
1099983292 12:89631886-89631908 CTGTAATTCCAGCACTTTGGGGG - Intronic
1100422037 12:94444274-94444296 CTGTAATCCCAGTACTCAGGAGG + Intronic
1101108411 12:101462035-101462057 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1101137198 12:101756450-101756472 CTGTGGTTCCACTAGTCAGGAGG + Intronic
1101166862 12:102046415-102046437 CTGTAGTCCCAGCACTCGGGAGG - Intronic
1101523375 12:105505405-105505427 CTGTAGTCCCAGTACTCAGGAGG - Intergenic
1101813106 12:108124591-108124613 CTGTGGTCCCAGGACTCAGAAGG - Intergenic
1101858010 12:108460361-108460383 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1101917549 12:108907535-108907557 CTGTAATCCCAGCACTTAGGAGG - Intergenic
1101957455 12:109223498-109223520 CTGTAATCCCAGCACTCGGGAGG + Intronic
1101994006 12:109511765-109511787 CTAAGCTTCCAGCCCTCCGGTGG - Intronic
1102138355 12:110594009-110594031 CTGTAGTTCCTGTACTCAGGAGG - Intergenic
1103202974 12:119103879-119103901 CTGTAATCCCAGCACTCTGGAGG + Intronic
1103466558 12:121146412-121146434 CTGTAATCCCAGCATTCAGGAGG - Intronic
1103594375 12:122014965-122014987 CTGTACTCCCAGCACTTTGGAGG - Intergenic
1103649260 12:122420811-122420833 CTGTAATTCCAGTACTCAGGAGG + Intronic
1103687532 12:122743898-122743920 CTGTACTCCTAGTACTCAGGAGG - Intergenic
1103691454 12:122778107-122778129 CTGTAATTCCAGCACTTTGGCGG + Intronic
1103746157 12:123125718-123125740 CTGTAATCCCAGCTCTCAGGAGG + Intronic
1103756075 12:123208280-123208302 CTGTAATTCCAGCACTTGGGAGG + Intronic
1103912101 12:124357551-124357573 CTGTAATTCCAGCACTCTGGAGG - Intronic
1103958720 12:124594164-124594186 CTGTGGTCTCAGCTCTCAGGAGG - Intergenic
1103993812 12:124816302-124816324 CTGCGCCCCCAGCACACAGGAGG + Intronic
1104022591 12:125003287-125003309 CTCTTCTTGCAGCAGTCAGGCGG - Intronic
1104037709 12:125109371-125109393 CTGTAATTCCAGCACTCAGGAGG - Intronic
1104182577 12:126396879-126396901 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1104627851 12:130374599-130374621 CTGTGCTGCCAGAACTCAAGTGG + Intergenic
1104964987 12:132504870-132504892 CTGTAATCCCAGCACTCTGGGGG + Intronic
1105271662 13:18882046-18882068 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1105336505 13:19475481-19475503 CTGTAATCCCAGCACTCTGGGGG - Intronic
1105502565 13:20985614-20985636 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
1105514536 13:21077707-21077729 CTGGGATCCCAGCACTCAGGAGG - Intergenic
1105531065 13:21220896-21220918 CTGTAATCCCATCACTCAGGAGG + Intergenic
1105728679 13:23189431-23189453 CTGTAATTCCAGCACTTTGGAGG - Intronic
1105728875 13:23191926-23191948 CTGTAATCCCAGCACTTAGGTGG + Intronic
1106011928 13:25832193-25832215 CTGTAATTCCAGCACTCTGGGGG - Intronic
1106014241 13:25853129-25853151 CTGTAATTCCAGCACTTTGGGGG + Intronic
1106017449 13:25883295-25883317 CTGTAATTCCAGTACTCAGGAGG + Intronic
1106323179 13:28661203-28661225 CTGTAATTCCAGCACTTTGGGGG + Intronic
1106606573 13:31234558-31234580 CTGTGCTTCCACCTCTCACCTGG - Intronic
1106727760 13:32503786-32503808 CTGTAATTCCAGCACTTCGGGGG + Intronic
1106881267 13:34133800-34133822 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1106953015 13:34905900-34905922 CTGTCCATCCAACTCTCAGGAGG + Intergenic
1107102535 13:36609634-36609656 ATGAGTTCCCAGCACTCAGGTGG - Intergenic
1107724563 13:43285681-43285703 CTGTAATCCTAGCACTCAGGAGG + Intronic
1107845743 13:44510850-44510872 CTGTAATTCCAGCACTTGGGAGG - Intronic
1107917491 13:45167806-45167828 CTGTAATTCCAGCACTTGGGAGG - Intronic
1107932822 13:45320249-45320271 CTGTAATCCCAGCACCCAGGAGG + Intergenic
1107936370 13:45348721-45348743 CTGTAATCCCAGGACTCAGGAGG - Intergenic
1108214756 13:48173226-48173248 CTGTAATCCCAGCACTCGGGAGG - Intergenic
1108644209 13:52410058-52410080 CTGTAGTTCCAGCCATCAGGAGG + Intergenic
1108705060 13:52977824-52977846 CAGTGCTTCCAGCATCCTGGAGG - Intergenic
1108721332 13:53135842-53135864 CTGAGCTTCCGGCACTGAGGTGG + Intergenic
1109462467 13:62679647-62679669 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1109507943 13:63331582-63331604 CTGTTCTTCCAGGAGTAAGGTGG + Intergenic
1109583261 13:64367754-64367776 CTGTGATTCCAGCACTTTGGGGG - Intergenic
1110174127 13:72536149-72536171 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1110562217 13:76921536-76921558 CTGTAATCCCAGCTCTCAGGAGG - Intergenic
1110759088 13:79210301-79210323 CTGTAATTCCAGCACTTTGGAGG + Intergenic
1110768491 13:79307507-79307529 CTCTGCTTCCTGGACTCAAGTGG + Intergenic
1111314894 13:86542333-86542355 CTGTAGTCCCAGCACTCGGGAGG + Intergenic
1112069761 13:95836562-95836584 CTAAATTTCCAGCACTCAGGAGG - Intronic
1113626529 13:111852111-111852133 CTGTGATTCCAGCTCTATGGAGG + Intergenic
1113829275 13:113282137-113282159 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1114434686 14:22695522-22695544 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1114501637 14:23173761-23173783 CTGTGGTCCCAGCACTAGGGAGG - Intronic
1114595924 14:23911507-23911529 GTTTGCTTTCAGCAATCAGGTGG + Intergenic
1115056884 14:29139120-29139142 CTTTAGTCCCAGCACTCAGGAGG + Intergenic
1115147326 14:30240340-30240362 TAGTGCTTCCTGCCCTCAGGGGG + Intergenic
1115203913 14:30880954-30880976 CTGTAATTCCAGCACTTTGGAGG + Intronic
1115323482 14:32111142-32111164 CTGTAATTCCAGCACTTTGGGGG + Intronic
1115567575 14:34637970-34637992 CTGTAATCCCAGCACTTAGGAGG + Intergenic
1115822107 14:37223756-37223778 CTGTAATCCCAGCACTCTGGGGG - Intronic
1116208092 14:41895364-41895386 CTGTAATCCCAGCACTCTGGGGG + Intronic
1116528142 14:45933133-45933155 CTGTAGTCCCACCACTCAGGGGG + Intergenic
1116642197 14:47478495-47478517 CTGTAGTCCCAGCTCTCAGGAGG - Intronic
1116716497 14:48432581-48432603 CTGTATTCCCAGCACTCAAGAGG - Intergenic
1116719170 14:48471518-48471540 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1116834206 14:49753801-49753823 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1116879374 14:50149151-50149173 CTGTAATCCCAGCACTTAGGAGG - Intronic
1116921909 14:50587530-50587552 CTGTGGTCCCAGCTCTCAGGAGG - Intronic
1116951774 14:50884835-50884857 CTGTAATCCCAGGACTCAGGAGG - Intronic
1117575470 14:57092866-57092888 CTGGGCACCCAGCACTGAGGCGG + Intergenic
1117939020 14:60940672-60940694 CTGTAATTCCAGCACTTTGGGGG - Intronic
1117980351 14:61336809-61336831 CTGTAATTCCAGCACTATGGGGG + Intronic
1118075709 14:62296238-62296260 CTGCCCTTCCAGCCCTCAGAAGG + Intergenic
1118278792 14:64410347-64410369 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1119120566 14:72072428-72072450 CTGTAGTCCCAGCACTCAGAAGG - Intronic
1119317906 14:73710930-73710952 CTGTGGTCCCAGCACTAAGGTGG - Intergenic
1119454388 14:74742235-74742257 CTGTAATCCCAGCTCTCAGGAGG - Intergenic
1119728948 14:76938932-76938954 CTGTAATCCCAGCACTCGGGAGG + Intergenic
1120192485 14:81451923-81451945 CTGTAATCCTAGCACTCAGGAGG + Intergenic
1120501132 14:85298746-85298768 CTGTCCTGCCCGCACTCAGAGGG - Intergenic
1120681273 14:87483876-87483898 CTGAGCTTCCCCCACTCAGGAGG + Intergenic
1120698996 14:87677170-87677192 CAGAGCATCCAGCACACAGGAGG - Intergenic
1120717673 14:87857381-87857403 CTGTGCTTCCAACAATAAGAGGG - Intronic
1120798581 14:88664153-88664175 CTGTAGTCCCAGCACTCAGGAGG + Intronic
1120987439 14:90346603-90346625 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1120999900 14:90444029-90444051 CACTGGTTCCAGCACCCAGGAGG + Intergenic
1121129273 14:91430495-91430517 CTGTAATCCCAGTACTCAGGAGG + Intergenic
1121205779 14:92165981-92166003 CTGTAATCCCAGTACTCAGGAGG - Exonic
1121363677 14:93286978-93287000 CTGTAATACCAGCACTGAGGCGG + Intronic
1121375483 14:93406323-93406345 CTGTTATTCCAGCACTTTGGGGG + Intronic
1121424580 14:93840487-93840509 CTGTGCTTGGAACTCTCAGGGGG - Intergenic
1121653046 14:95574106-95574128 CTGTGGTTCCATCCCCCAGGGGG + Intergenic
1121817762 14:96941599-96941621 CTGTAATCCCAGCACTCTGGCGG - Intergenic
1122343154 14:101041852-101041874 CTGTGGTCCCAGTACTTAGGAGG + Intergenic
1122521308 14:102345734-102345756 CTGTAATTCCAGCACTTTGGTGG - Intronic
1122737443 14:103851081-103851103 CTGTGATCCCAGCACTTGGGAGG + Intergenic
1122740486 14:103869094-103869116 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1122748941 14:103918763-103918785 CTGTAATTCCAGCACTTTGGGGG + Intronic
1122942882 14:104990419-104990441 CTGTAGTCCCAGTACTCAGGAGG - Intronic
1123051021 14:105542508-105542530 CTGTGCTCCAGGTACTCAGGAGG - Intergenic
1123414706 15:20086848-20086870 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1123452661 15:20380580-20380602 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1123524048 15:21093962-21093984 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1123764892 15:23468258-23468280 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1124638463 15:31380038-31380060 CTGTAATCCCAGCACTCTGGGGG + Intronic
1125047363 15:35257650-35257672 CTGTAGTTCCAGTACTCATGAGG - Intronic
1125533951 15:40432199-40432221 CTGTAATTCCAGCACTTTGGGGG - Intronic
1125544707 15:40494575-40494597 CTGTGGTCCCAATACTCAGGAGG - Intergenic
1126224272 15:46251749-46251771 CTGTAATCCCAGCACTCAGGAGG + Intergenic
1126669222 15:51101136-51101158 CTGTGGTTCCAGCTTTCATGAGG + Intronic
1126938467 15:53738727-53738749 CTGTAATCCCAGTACTCAGGAGG - Intronic
1127296871 15:57616380-57616402 CTGTGATCCCAGCACTTTGGGGG + Intronic
1127456233 15:59158470-59158492 CTTGGATTCCAGCTCTCAGGTGG + Intronic
1127747963 15:62000241-62000263 CTATGATCCCAGCTCTCAGGAGG + Intronic
1128083711 15:64871954-64871976 CTGTAGTCCCAGCTCTCAGGAGG - Intronic
1128092993 15:64931546-64931568 CGGTGCTCCCAGCCCTGAGGAGG - Exonic
1128297087 15:66531711-66531733 CTGTAATTCCAGCACTTGGGAGG - Intronic
1128316575 15:66663005-66663027 CTCTGCTGCCAGCACTCTGGTGG - Intronic
1128526264 15:68414426-68414448 CAGTGGTCTCAGCACTCAGGAGG - Intronic
1128556106 15:68632847-68632869 CTGTAATCCCAGCACTTAGGGGG - Intronic
1128965588 15:72054413-72054435 CTGTAATCCCAGCACTCTGGGGG + Intronic
1129409646 15:75342414-75342436 CTGTGGTTCCAGCACTTGGGAGG + Intronic
1129606268 15:77026562-77026584 CTGAGCTCCCAGCACTTGGGAGG - Intronic
1129802025 15:78422285-78422307 TTGTAATTCCAGCACTTAGGAGG - Intergenic
1130099478 15:80881590-80881612 CTGTGCTCCCACAACTCTGGTGG - Intronic
1130207959 15:81895342-81895364 CTGTGGTCCCACTACTCAGGAGG + Intergenic
1130653480 15:85775722-85775744 TTGTGCTGCCAGCCCTCAGGAGG - Intronic
1131129211 15:89884902-89884924 CTGTGATCCCAGCACTTTGGGGG - Intronic
1131180665 15:90237214-90237236 CTGTAATCCCAGCACTCTGGGGG - Intronic
1131295101 15:91141020-91141042 AAGTGCTACAAGCACTCAGGTGG + Intronic
1131819842 15:96261022-96261044 CTGTAGTTCCAGTACTCGGGAGG + Intergenic
1132402195 15:101518840-101518862 CTGTAGTCCCAGTACTCAGGAGG + Intronic
1132437360 15:101819634-101819656 CTGTAATCCCAGCCCTCAGGAGG - Intergenic
1132539212 16:500423-500445 CTGTACTCCCAGCACTTTGGGGG + Intronic
1132794122 16:1710349-1710371 CTGTAGTCCCAGCACTCGGGAGG + Intronic
1132949879 16:2555412-2555434 CTGTGGTCCCACTACTCAGGAGG + Intronic
1132964469 16:2644755-2644777 CTGTGGTCCCACTACTCAGGAGG - Intergenic
1133189920 16:4126026-4126048 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1133365323 16:5204353-5204375 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1133618163 16:7499174-7499196 TTGTCCTCCCAGCACTCAGAAGG - Intronic
1133624492 16:7558095-7558117 CTGTAATTCCAGCACTTTGGGGG + Intronic
1133688130 16:8186614-8186636 CTATGGATCCAGCACTCAGTAGG + Intergenic
1133781803 16:8944846-8944868 CTGTGATCCCAGCACTTGGGAGG + Intronic
1133808995 16:9146767-9146789 CTGTGGTCCCAGCACTTGGGAGG + Intergenic
1134152369 16:11815229-11815251 CTGTAATCCCAGCACTCTGGAGG - Intergenic
1134668095 16:16034282-16034304 CTGTAATCCCAGCACTCTGGAGG - Intronic
1134766439 16:16762939-16762961 CTGTAGCTCCAGCACTCAGGGGG - Intergenic
1134810970 16:17166768-17166790 CTGTGGTCCCAGCACTTTGGAGG - Intronic
1135272462 16:21081174-21081196 CTGTAATTTCAGCACTCTGGGGG - Intronic
1135530347 16:23247680-23247702 CTGTAATCCCAGCACTCGGGAGG + Intergenic
1135555191 16:23430304-23430326 CTGTAGTCCCAGTACTCAGGAGG + Intronic
1135571500 16:23552746-23552768 CTGTGATCCCAGCACTTGGGAGG - Intronic
1135678675 16:24438827-24438849 CTGTGATCCCAGCACTTTGGGGG + Intergenic
1135679916 16:24447548-24447570 CTGTAATCCCAGCACTGAGGTGG - Intergenic
1135829324 16:25759665-25759687 CTGTCATTCCAGCACTTTGGAGG + Intronic
1135950727 16:26911694-26911716 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1135989919 16:27211924-27211946 CTGTAATCCCAGCACTTAGGAGG - Intronic
1136107033 16:28037281-28037303 CTGTGATCCCAGCACTTTGGGGG - Intronic
1136371899 16:29841837-29841859 CTGCGCTGCCAGCACTCACCGGG - Exonic
1136509802 16:30730022-30730044 CTGTGATCCCAGCACTTTGGAGG - Intronic
1136524925 16:30822899-30822921 CTGTGATCCCAGCACTTGGGAGG - Intergenic
1136989502 16:35143412-35143434 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1137243237 16:46677656-46677678 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1137288674 16:47037318-47037340 CTGTGGTCCCAGCACTTTGGAGG - Intergenic
1137289035 16:47039092-47039114 CTGTAGTTCCAGCACTTTGGAGG - Intergenic
1137429515 16:48407236-48407258 CTGTAATCCCAGCACTCTGGGGG - Intronic
1137481567 16:48856024-48856046 CTGTGATTCCAACACTTTGGGGG - Intergenic
1138019492 16:53465048-53465070 CTGTAATCCCAGCACTCTGGGGG - Intronic
1138348325 16:56333332-56333354 CTATAATCCCAGCACTCAGGAGG - Intronic
1138368155 16:56500501-56500523 CTGTGGTCCCAGTACTCAGGAGG + Intronic
1138397844 16:56719718-56719740 CTGTAGTCCCAGCTCTCAGGAGG - Intronic
1138468342 16:57210589-57210611 CTGTAATCCCAGTACTCAGGAGG + Intronic
1139135844 16:64204041-64204063 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
1139399374 16:66668264-66668286 CTGTAATCCCAGCACTCTGGGGG - Intronic
1139543603 16:67637272-67637294 CTGTGATCCCAGCACTTTGGGGG + Intronic
1139639495 16:68280854-68280876 CTGTTGTCCCAGCACTCAGGAGG - Intronic
1139747153 16:69083745-69083767 CCATGCTGCCAGCACTCAAGAGG - Exonic
1140123313 16:72101374-72101396 CGGTGCCACCAGCACTCTGGGGG + Intronic
1140135577 16:72202706-72202728 GTGTGCTCCCAGCAGTCAGGAGG - Intergenic
1140228707 16:73099748-73099770 CTGTGTGTCCTGCTCTCAGGAGG + Intergenic
1140324590 16:73989423-73989445 CTGTAGTCCCAGCACTCAGGTGG + Intergenic
1140384596 16:74524085-74524107 CTGTAATCCCAGCACTCAGGTGG + Intronic
1140461493 16:75143501-75143523 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1140485120 16:75287654-75287676 CTGTAGTCCCAGCACTCAAGAGG + Intergenic
1140512447 16:75517748-75517770 CTGTACTCCCAGCACTCTGGGGG + Intergenic
1141541411 16:84725659-84725681 CTGTAATCCCAGCACTCTGGGGG - Intronic
1141817376 16:86421605-86421627 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1141990892 16:87608913-87608935 CTGTGGTCCCACCACTCAGGAGG + Intronic
1142067233 16:88069592-88069614 CTGGGCTTCCATCACACAGCAGG - Intronic
1142271580 16:89092489-89092511 GTCTGCTTCCAGGACTCAGCAGG - Intronic
1142301061 16:89257970-89257992 CTGTGATCCCAGCAGTCTGGGGG - Intergenic
1142366777 16:89654338-89654360 CTGTAATCCCAGCACTCTGGGGG + Intronic
1142371996 16:89687683-89687705 CTGTAATTCCAGCACTTGGGAGG - Intronic
1203138058 16_KI270728v1_random:1742239-1742261 CTGTAATCCCAGCACTCTGGAGG - Intergenic
1142827030 17:2519855-2519877 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1142853722 17:2718174-2718196 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1143006085 17:3835502-3835524 CTGTGCTTCCAGCACCCGAAGGG + Intronic
1143064009 17:4229164-4229186 CTGTGATCCCAGCACTTTGGGGG + Intronic
1143065013 17:4240320-4240342 CTGTAATCCCAGCACTTAGGAGG - Intronic
1143074916 17:4333417-4333439 CTGTGATCCCAGCACTTGGGAGG + Intronic
1143182499 17:4992402-4992424 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1143648145 17:8245678-8245700 CTGTAATCCCAGCACTCTGGGGG + Intronic
1143658221 17:8309841-8309863 CTGTAATCCCAGCACTTAGGGGG - Intergenic
1144084013 17:11792022-11792044 CTGTAATCCCAGCACTCTGGGGG + Intronic
1144245154 17:13355765-13355787 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1144259671 17:13505899-13505921 CTGTAATCCCAGTACTCAGGAGG + Intronic
1144377121 17:14655402-14655424 CTGTAATCCCAGCACTTAGGGGG + Intergenic
1144574570 17:16420871-16420893 CTGTAATCCCAGCACTCTGGGGG - Intronic
1144587418 17:16495672-16495694 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1144736782 17:17559925-17559947 CTGACTTCCCAGCACTCAGGTGG - Intronic
1144745919 17:17614395-17614417 CTGTGGTCCCAGCACTTGGGAGG - Intergenic
1145919885 17:28602710-28602732 CTGTAATCCCAGTACTCAGGAGG - Intronic
1146048373 17:29529607-29529629 CTGTAATCCCAGCACTTAGGAGG + Intronic
1146081903 17:29787984-29788006 CTGTAATTCCAGCACTTGGGAGG - Intronic
1146159088 17:30550137-30550159 CTGTGCTTCATGCCCTAAGGTGG + Intergenic
1146379970 17:32321222-32321244 TTGGGCCTCCAGCCCTCAGGGGG - Exonic
1146487585 17:33256583-33256605 CTGTTTTTCCAGCACTGAGGTGG + Intronic
1146801506 17:35827446-35827468 CTGTAATTCCAGCACTTTGGAGG + Intronic
1147395141 17:40137032-40137054 CTGTGATCCCAGCACTTTGGTGG + Intergenic
1147410742 17:40250087-40250109 CTGTAATCCCAGCACTCTGGGGG - Intronic
1147696805 17:42361221-42361243 CTGTAATCCCAGCACTCTGGGGG + Intronic
1147810687 17:43167756-43167778 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1148035845 17:44658535-44658557 CTGTAATCCCAGCACTCTGGGGG + Intronic
1148205033 17:45774740-45774762 CTGTGATTCCAGCAAACTGGAGG - Intergenic
1148495335 17:48050219-48050241 CTGTGATCCCAGCACTTTGGGGG + Intronic
1148515633 17:48214528-48214550 CTGTAATTCCAGCACTTGGGAGG - Intronic
1148620854 17:49033598-49033620 CTGTAATCCCAGCACTCTGGGGG - Intronic
1148667987 17:49388837-49388859 CTGTAATTCCAGCACTTGGGAGG + Intronic
1148791388 17:50175245-50175267 CTGTGCCTCCAGCATCCAGATGG + Exonic
1148884545 17:50762341-50762363 CTGTTATCCCAGCACTTAGGAGG + Intergenic
1148932003 17:51134639-51134661 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
1148933629 17:51147512-51147534 CTGTAATCCCAGCACTTAGGAGG - Intergenic
1148938806 17:51188879-51188901 CTGTAATCCCAGCACTCGGGAGG - Intronic
1149126499 17:53240975-53240997 CTGTAATTCTAGCACTCAGGTGG + Intergenic
1149309053 17:55376618-55376640 CTGTAATCTCAGCACTCAGGAGG + Intergenic
1149607582 17:57935821-57935843 CCATGCTTCCAGCAGTCAAGGGG - Intronic
1149749770 17:59134671-59134693 CTGTAGTCCCAGCTCTCAGGAGG - Intronic
1149837439 17:59925901-59925923 CTGTAATCCCAGCACTTAGGTGG - Intronic
1150063903 17:62092495-62092517 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1150096433 17:62380257-62380279 CTGTGATCCCAGCACTTTGGGGG - Intronic
1150153345 17:62829289-62829311 CTGTGGTCCCACTACTCAGGAGG + Intergenic
1150170654 17:62990539-62990561 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1150219070 17:63485651-63485673 CTGTAGTCCCAGTACTCAGGAGG + Intronic
1150676528 17:67248932-67248954 CTGTGGTGCCAGCATTCGGGAGG - Intergenic
1150741125 17:67779708-67779730 CTGTGGTCCCAGCACTTGGGAGG - Intergenic
1150792597 17:68210688-68210710 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1150800385 17:68277251-68277273 CTGTAATCCCAGCACTCAGGAGG - Intronic
1151440338 17:74124645-74124667 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1151722132 17:75863192-75863214 CTGTAATTCCAGCACTTGGGAGG + Intergenic
1151775370 17:76197688-76197710 CTGTAATCCCAGCACTCGGGAGG - Intronic
1151832637 17:76563904-76563926 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1151874906 17:76862299-76862321 CTGTGTTTCCAGCACTGGGATGG + Intergenic
1152017156 17:77758167-77758189 CTGGGGTTCCAACGCTCAGGTGG + Intergenic
1152396055 17:80034320-80034342 CTGTAATCCCAGTACTCAGGAGG - Intronic
1152442962 17:80320472-80320494 CTGTAATTCCAGCACTTGGGAGG - Intronic
1152674350 17:81630407-81630429 CTGTGGTTCCAGCTCTCGGGAGG - Intronic
1152866716 17:82728365-82728387 CTGTAATCCCAGCACTCGGGAGG - Intronic
1152880296 17:82810786-82810808 CTGTGCTGTCAGCACTTTGGAGG + Intronic
1153078994 18:1198222-1198244 CTGTAGTTCCAGTACTCAGGAGG - Intergenic
1153121762 18:1737271-1737293 CTGAGCTTCCAGCTCACAGATGG - Intergenic
1153615025 18:6926300-6926322 CTGTAATGCCAGCACTTAGGGGG + Intergenic
1153706703 18:7752697-7752719 CTGTAATCCCAGCACTTAGGAGG - Intronic
1153753644 18:8259069-8259091 CTGTAGTTCCAGCTTTCAGGAGG - Intronic
1153853724 18:9123746-9123768 CTGTGATCCCAGCACTTGGGAGG - Intronic
1153892000 18:9526010-9526032 CTGTAATCCCAGCACTCTGGGGG - Intronic
1154016529 18:10623546-10623568 CTGTGGTTCCAGCTACCAGGGGG - Intergenic
1154114206 18:11596895-11596917 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1154188982 18:12212117-12212139 CTGTGGTTCCAGCTACCAGGGGG + Intergenic
1154271250 18:12921912-12921934 CTGTAATCCCAGCACTCTGGGGG + Intronic
1154275852 18:12959436-12959458 CTGTAATCCCAGCACTCTGGGGG - Intronic
1155074494 18:22342648-22342670 CTCTAATCCCAGCACTCAGGAGG - Intergenic
1156438336 18:37157685-37157707 CTGTAGTCCCAGCACTCGGGAGG + Intronic
1156541543 18:37916698-37916720 CTGTAATCCCAGCACTCTGGAGG + Intergenic
1157427466 18:47596060-47596082 CTGTGCTGGCAGCACTCTGCAGG - Intergenic
1158514902 18:58122988-58123010 CTGTAATCCCAGCACTCTGGGGG - Intronic
1158593003 18:58793005-58793027 CTGTAATCCCAGCACTCGGGAGG + Intergenic
1159024626 18:63171716-63171738 CTGTGATCCCAGCACTTGGGAGG + Intronic
1159215271 18:65384097-65384119 CTGTCCTTCAATAACTCAGGGGG + Intergenic
1159594987 18:70374424-70374446 CTGTAATTCCAGCACTTTGGTGG + Intergenic
1159986116 18:74842971-74842993 CTGTAATTCCAGCACTTTGGAGG - Intronic
1160094673 18:75860593-75860615 CTGTAATTCCACTACTCAGGAGG + Intergenic
1160682161 19:416885-416907 CTGTGCACCCAGTCCTCAGGTGG + Exonic
1160772373 19:838645-838667 CTGTGTTCCCAGCACTTTGGCGG + Intergenic
1160809292 19:1006399-1006421 CTGTGATCCCAGCACTTGGGAGG - Intronic
1161079378 19:2302933-2302955 CTGTGCCTCCAGCACCCGCGCGG - Intronic
1161205318 19:3037862-3037884 CTGTGATCCCAGCACTTAGTTGG + Intronic
1161243983 19:3238806-3238828 CTGTAATCCCAGTACTCAGGAGG + Intronic
1161295485 19:3517954-3517976 CTGTAGTCCCAGGACTCAGGAGG - Intronic
1161704356 19:5812125-5812147 CTGTAATCCCAGCACTTAGGAGG - Intergenic
1161839828 19:6673134-6673156 CTGTAATCCCAGCACTTAGGGGG + Intergenic
1161862686 19:6810055-6810077 CTGTAGTCCCAACACTCAGGAGG + Intronic
1161919257 19:7253905-7253927 CTGTAATCCCAGCACTCAGGAGG + Intronic
1161939267 19:7392591-7392613 CTGTAATTCCAGCACTCGGGAGG + Intronic
1162002330 19:7753723-7753745 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1162080205 19:8213419-8213441 CTGTGGTCCCAGCTCTCAGGAGG - Intronic
1162123023 19:8484016-8484038 CTGTCATCCCAGCACTCTGGAGG - Intronic
1162380936 19:10331429-10331451 CTGTAATTCCAGCACTTTGGAGG + Intronic
1162443674 19:10709020-10709042 CTGTAATCCCAGCACTCTGGAGG - Intronic
1162480635 19:10924973-10924995 CTGTAATTCCAGCACTTAGGAGG + Intronic
1162499848 19:11046551-11046573 CTGTGCTTCCAGCACTCAGGAGG - Intronic
1162565337 19:11442959-11442981 CTGTAATCCCAGCACTCTGGGGG - Intronic
1162713985 19:12617379-12617401 CTGTAATCCCAGCACTCTGGGGG - Intronic
1162738292 19:12758792-12758814 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1162828390 19:13268553-13268575 CTGTAGTCCCAGCACTCGGGAGG - Intronic
1162875764 19:13619796-13619818 CTGTGGTCCCAGCTCTCGGGAGG - Intronic
1163148280 19:15396993-15397015 CTGTGCTGCCTGCACTGAGCTGG + Intronic
1163269568 19:16243531-16243553 CTGTAATTCCAGCACTGTGGAGG - Intronic
1163292580 19:16389194-16389216 CTGTGATCCCAGCACTTTGGAGG + Intronic
1163385035 19:16994638-16994660 CTGTGGTCCCAGCTATCAGGAGG - Intronic
1163691540 19:18741288-18741310 CTGAGCTGCCAGCTCCCAGGAGG - Intronic
1163825527 19:19522045-19522067 CTGTAATTCCAGCACTTTGGGGG + Intronic
1164013085 19:21225724-21225746 CTGTAGTCCCAGTACTCAGGAGG - Intronic
1164031329 19:21408384-21408406 CTGTAATCCCAGCACCCAGGAGG - Intronic
1164207324 19:23069792-23069814 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1164240180 19:23380135-23380157 CTGTAATCCAAGCACTCAGGAGG + Intronic
1164522736 19:28991247-28991269 CTGTCCTGCCACCACCCAGGGGG - Intergenic
1164627033 19:29736541-29736563 CTGTAATTCCAGTACTCAGGAGG + Intergenic
1164797882 19:31049610-31049632 CTCTGATTCCAGTTCTCAGGGGG + Intergenic
1164847224 19:31442947-31442969 CTGTGGTCCCAGGACTCAGGAGG + Intergenic
1164975417 19:32569407-32569429 CTGTAATCCCAGCACTTAGGGGG - Intergenic
1164987196 19:32657204-32657226 CTGTAATTCCAGCACGCTGGGGG + Intronic
1164991166 19:32685220-32685242 CTGTACTCCCAGCACTTTGGGGG - Intergenic
1165207652 19:34204594-34204616 CTGTAGTCCTAGCACTCAGGAGG + Intronic
1165325471 19:35111969-35111991 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1165342371 19:35222247-35222269 CTGTAATTCCAGCACTTGGGAGG - Intergenic
1165534615 19:36433098-36433120 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1165647608 19:37455847-37455869 CTGTTCTTCCAGCCATCAGTGGG - Intronic
1165836893 19:38763309-38763331 CTGTAATCCCAGCACTCAGGAGG + Intronic
1165861118 19:38909992-38910014 CTGTGGTCCCAGCTCTCAGGAGG - Intronic
1165880843 19:39042032-39042054 CAGTGATCCCAGCACTCGGGAGG - Intergenic
1166034342 19:40156511-40156533 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1166093660 19:40526292-40526314 CTGTGATCCCAGTACTCAGGAGG - Intronic
1166103469 19:40585361-40585383 CTGTATTTCCAGCACTTTGGAGG - Intronic
1166138879 19:40794885-40794907 CTGTGATCCCAGCACTTTGGGGG + Intronic
1166195250 19:41201580-41201602 TTGTAATCCCAGCACTCAGGTGG + Intronic
1166352084 19:42204045-42204067 TCCTGCTTCCTGCACTCAGGTGG + Intronic
1166563252 19:43747491-43747513 CTGTGCTTCATGCGCTCTGGGGG + Exonic
1166670112 19:44704471-44704493 CTGTAATCCCAGCACTCTGGGGG + Intronic
1166829791 19:45632434-45632456 CTGTAATCCCAGCACTCTGGGGG - Intronic
1166958215 19:46480207-46480229 CTGTGATCCCAGCACTTTGGGGG + Intergenic
1167066952 19:47193562-47193584 CTGTAATTCCAGCACTTTGGGGG + Intronic
1167192070 19:47998154-47998176 CTGTAATCCCAGCACTTAGGGGG + Intronic
1167207908 19:48114922-48114944 CTGTAATCCCAGCACTTAGGGGG + Intergenic
1167241241 19:48344543-48344565 CTGTAATCCCAGCATTCAGGAGG - Intronic
1167578335 19:50328328-50328350 CTCTGCTTCCAGGACGCGGGCGG - Exonic
1167835866 19:52069193-52069215 CTGTGGTCCCAGCTCTCAGGAGG - Intronic
1168062637 19:53901593-53901615 CTGTAATTCCAGCACTTGGGAGG + Intronic
1168146521 19:54422435-54422457 CTGTGCCGGCAGCTCTCAGGCGG + Intronic
1168165625 19:54545478-54545500 CTGTAATCCCAGCACTCTGGGGG + Intronic
1168379394 19:55907313-55907335 CTGTAATCCCAGCACTCAAGAGG + Intronic
1168435950 19:56317091-56317113 CTGTAATCCCAGCACTCTGGAGG - Intronic
1168599042 19:57703361-57703383 CTGTAGTCCCAGGACTCAGGAGG + Intronic
1168622931 19:57893429-57893451 CTGTAATTCCAGCACTTTGGGGG - Intronic
1202688595 1_KI270712v1_random:70145-70167 CTGTAATCCCAGCACTCTGGAGG + Intergenic
924990512 2:309074-309096 TTGTTTTTCCAGCCCTCAGGTGG + Intergenic
925097223 2:1216670-1216692 CTGTGCCTCCAGCATGCTGGTGG - Intronic
925287570 2:2725986-2726008 CTGTGCATCCAGCTCCCAAGTGG + Intergenic
925379135 2:3412437-3412459 CTGTAATCCCAGTACTCAGGAGG + Intronic
925641357 2:5988692-5988714 CTGGGCCTCTAGCTCTCAGGTGG - Intergenic
926241015 2:11085221-11085243 CTGTAGTCCCAGCACCCAGGAGG - Intergenic
926713999 2:15909486-15909508 CTGTAATCCCAGCACTCTGGGGG + Intergenic
926898938 2:17728311-17728333 CTGTAGTACCAGCTCTCAGGAGG + Intronic
927278481 2:21282061-21282083 CTATGCTCCCGGCACTCTGGAGG - Intergenic
927664479 2:25020779-25020801 CTGTAATCCCAGCACTCTGGGGG - Intergenic
927829212 2:26333940-26333962 CTGTAATCCCAGTACTCAGGAGG - Intronic
927838697 2:26422796-26422818 CTGTAGTCCCAGTACTCAGGAGG + Intronic
928181280 2:29070765-29070787 CTGTTCTTCCAGCATTCTGCTGG + Exonic
928255231 2:29716547-29716569 CTGTCCTAGCAGCCCTCAGGAGG - Intronic
928608542 2:32968087-32968109 CTGTAGTCCCAGCACTCAGAAGG - Intronic
928812980 2:35252223-35252245 CTGTGCTTCAAGATTTCAGGAGG - Intergenic
929015335 2:37487924-37487946 CTGTAATCCCAGCACTTAGGTGG + Intergenic
929249560 2:39737988-39738010 CTGTGTATCCAGCTCTCTGGTGG - Intronic
930085524 2:47494571-47494593 CTGGGCTTCCAGGGCCCAGGTGG - Intronic
930134731 2:47890545-47890567 CTGTAATCCCAGCACTCAGGAGG + Intronic
930199711 2:48541226-48541248 CTATAATCCCAGCACTCAGGAGG + Intronic
930664639 2:54090021-54090043 CTGTAATCCCAGTACTCAGGAGG + Intronic
930681602 2:54262960-54262982 CTGTGATGCCAGCACTATGGGGG + Intronic
930690849 2:54362667-54362689 CTGTAATCCCAGCACTCAGAAGG - Intronic
930725830 2:54680536-54680558 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
930820694 2:55643485-55643507 CTGTAATCCCAGCACTCTGGGGG + Intronic
930924465 2:56800197-56800219 CTGTAATCCCAGCACTCAGGAGG - Intergenic
931327733 2:61244356-61244378 CTGTGATCCCAGCACTTCGGAGG + Intronic
931333339 2:61312263-61312285 CTGTGATTCCTGCATTCAGAAGG + Intronic
931411419 2:62035791-62035813 CTGTAATTCCAGCACTTTGGGGG + Intronic
931922911 2:67040118-67040140 CAGTGCATCCAGCACTGAGTTGG + Intergenic
932183626 2:69672487-69672509 CTGTAATTCCAGCACTTTGGGGG - Intronic
932337832 2:70941037-70941059 CTGTGGTCCCAGCTCTCAGGAGG - Exonic
932618971 2:73254868-73254890 CTGTACCTCCAGCCCCCAGGGGG - Exonic
932630212 2:73335543-73335565 CTGTAATCCCAGCACTCTGGTGG + Intergenic
932708222 2:74043375-74043397 CTGTGCTTCCTGCCCACAGCTGG - Intronic
932829874 2:74978827-74978849 CTGTAATTCAAACACTCAGGAGG - Intergenic
932847028 2:75146378-75146400 CTGTAATTCCAGCACTTTGGGGG - Intronic
933326298 2:80842493-80842515 CTGTAATTCCAGCACTTGGGAGG + Intergenic
933725610 2:85425385-85425407 CTGTAATCCCAGCCCTCAGGAGG - Intronic
933852013 2:86375648-86375670 CTGTGCTCCCAGCCCTTGGGAGG - Intergenic
933957833 2:87385942-87385964 CTGTAATCCCAGCACTCTGGAGG - Intergenic
934241955 2:90277859-90277881 CTGTAATCCCAGCACTCTGGAGG - Intergenic
934271217 2:91538829-91538851 CTGTAATCCCAGCACTCTGGAGG + Intergenic
934319127 2:91956424-91956446 CTGTAATTCCAGCACTTTGGGGG - Intergenic
934508847 2:94920207-94920229 CTGTGATTCCAGCACTTGGGAGG + Intergenic
934618307 2:95789050-95789072 CTGTGTTCCCAGCACCCAGCAGG - Intergenic
934642586 2:96035509-96035531 CTGTGTTCCCAGCACCCAGCAGG + Intronic
934686768 2:96327039-96327061 CTTTGATTCCAGCAGTGAGGAGG + Exonic
934898358 2:98138522-98138544 CTGTGCTTCCTGGGCTCAGGGGG - Intronic
934973272 2:98780738-98780760 CTGTAATTCCAGCACTTTGGGGG - Intergenic
935077762 2:99762244-99762266 CTGTAGTCCCAGGACTCAGGAGG - Intronic
935103053 2:100015059-100015081 CTGTAATTCCAGCACTTTGGGGG - Intronic
935162630 2:100542471-100542493 CTGTAATTCCAGCACTTGGGAGG + Intergenic
935620770 2:105127720-105127742 CTGTGCTTCCTGCACTGGGCAGG + Intergenic
935687810 2:105699406-105699428 CTGCGCTTCCTGCACTGAGTGGG - Intergenic
936025459 2:109028010-109028032 CTGTAATTCCAGCACACTGGGGG + Intergenic
936513009 2:113163790-113163812 CTGTGATCCCAGCACTTTGGGGG - Intronic
936704902 2:115060468-115060490 CTGTAGTCCCAGCACTCGGGAGG + Intronic
936832646 2:116667291-116667313 CTGTAATTCCAGCACTTTGGGGG - Intergenic
937108006 2:119337175-119337197 CTGTAGTGCCAGCACTCAGGAGG - Intronic
937108950 2:119347613-119347635 CTGTAATCCCAGCACTTAGGAGG + Intronic
937456188 2:122043776-122043798 CTGTAATCCCAGCACTTAGGAGG - Intergenic
937750582 2:125472251-125472273 GGCTGCTTCCAGCACACAGGTGG - Intergenic
938855594 2:135307186-135307208 CTGTGGTCCCACTACTCAGGAGG - Intronic
938953891 2:136281476-136281498 CTGTGCAGCCATCACACAGGAGG - Intergenic
939187448 2:138877782-138877804 CCTTGCCTCCAGCATTCAGGTGG - Intergenic
939299811 2:140320783-140320805 CTGTAATCCCAGCACTCTGGGGG + Intronic
940288166 2:152052720-152052742 CTGTAATTCCAGCACTTTGGGGG + Intronic
940608377 2:155957834-155957856 CTGTAATCCCAGCACTCTGGGGG - Intergenic
941173104 2:162163725-162163747 CTGTAATTCCAGCACTTTGGAGG + Intergenic
941229453 2:162892566-162892588 CTGTAATCCCAGCACTCTGGGGG - Intergenic
941790079 2:169542606-169542628 CTGTAATTCCAGCACTTGGGAGG + Intronic
943340956 2:186681814-186681836 CTGTAATCCCAGCACTCTGGGGG - Intergenic
943512501 2:188842549-188842571 CTGTAATTCCAGCACTTTGGAGG + Intergenic
943644104 2:190389598-190389620 CTGCGGTTGCAGCACTCAGGAGG + Intergenic
944029488 2:195216946-195216968 CTGTAGTCCCAGCACTCAGAAGG - Intergenic
944702833 2:202261017-202261039 CTGTAATCCCAGCTCTCAGGAGG + Intergenic
945521151 2:210829039-210829061 GTCTTCTTCCAGTACTCAGGGGG + Intergenic
946026351 2:216673998-216674020 CTTTGCTGCCAGCCATCAGGTGG - Exonic
946323580 2:218969625-218969647 CTGTAGTTCCAGTACTCGGGAGG - Intergenic
946667370 2:222065273-222065295 CTGTGATTCCAGCACTTTGGGGG + Intergenic
946749074 2:222874848-222874870 CTGTAATCCCAGTACTCAGGAGG + Intronic
946845513 2:223855368-223855390 CTGTAATCCCAGCACTCAGGAGG + Intergenic
946873793 2:224108354-224108376 CTGTCCTCCCAGTGCTCAGGTGG + Intergenic
947428311 2:230003857-230003879 CTCTGCTTCCAGGACTCTGGTGG + Intronic
947575867 2:231273670-231273692 CTGTAATTCCAGCACTTTGGGGG - Intronic
947621883 2:231596038-231596060 CTGTAATCCCAGTACTCAGGAGG - Intergenic
947789202 2:232853397-232853419 CTGTAGTCCCAGCACTCGGGAGG - Intronic
948488823 2:238298289-238298311 CTGTAATCCCAGCACTCTGGGGG - Intergenic
948497395 2:238360756-238360778 CTGTAGTCCCAGCACTCAGGAGG + Intronic
948571736 2:238922057-238922079 GGGGGCTTACAGCACTCAGGAGG + Intergenic
949039293 2:241839626-241839648 CTGTAATCCCAGCACTCAGGAGG - Intergenic
1169436838 20:5600429-5600451 CTGTAATCCCAGCACTCTGGGGG + Intronic
1169614195 20:7420824-7420846 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1169693257 20:8357556-8357578 CTGTAATCCCAGCACTCTGGGGG + Intronic
1169871979 20:10257587-10257609 CTGTAATCCCAGCTCTCAGGAGG + Intronic
1169875270 20:10290581-10290603 CTGTGCTTCCAGAGATTAGGAGG - Intronic
1170200508 20:13738433-13738455 CTGTGGTCCCACTACTCAGGAGG - Intronic
1170822969 20:19769778-19769800 CTGTGTTTCAAGACCTCAGGAGG + Intergenic
1170853238 20:20023026-20023048 CTGTACTCCCAGCACTTTGGGGG + Intronic
1170959009 20:21008507-21008529 CTGTAATTCCAGCACTTGGGAGG - Intergenic
1171955692 20:31461447-31461469 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1171996179 20:31733360-31733382 CTGTAATCCCACCACTCAGGAGG - Intergenic
1172022880 20:31926846-31926868 CTGTAATTCCAGCACTTTGGAGG + Intronic
1172023512 20:31932738-31932760 CTGTGATCCCAGCACTCTGGAGG + Intronic
1172392394 20:34574696-34574718 CTGTGGTTCCAGCACCCATAGGG - Intronic
1172544859 20:35752398-35752420 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1172551649 20:35805158-35805180 CTGTGGTCCCAGCACTCAGGAGG - Intronic
1172703800 20:36868308-36868330 CTGTAATCCCAACACTCAGGGGG - Intergenic
1173293281 20:41733253-41733275 CCGTGCTTCAACCACTCAGAGGG + Intergenic
1173954761 20:47022569-47022591 CTGTAATCCCAGCACTCTGGGGG - Intronic
1174010095 20:47442685-47442707 CTGTAATTCCAGCACTTTGGAGG + Intergenic
1174038310 20:47681805-47681827 CTGTAATCCCAGCACTCAGGAGG - Intronic
1174323535 20:49761190-49761212 CTGTGCTCCCAGCTATCAGGAGG - Intergenic
1174589346 20:51632863-51632885 CTGTAATTCCAGCACTTTGGGGG + Intronic
1175358619 20:58389556-58389578 CCGTCCTTCCAGCACTGGGGCGG - Intronic
1176004331 20:62852060-62852082 CTGTGATCCCAGCACTTGGGAGG - Intronic
1176124857 20:63470878-63470900 CAGGGCTTCCAGGACCCAGGAGG + Intronic
1176269397 20:64227841-64227863 CTGCGGTTCCAGCACTAAGGTGG + Intronic
1176358063 21:5969247-5969269 TTGAGCTCCCAGCACTCGGGTGG + Intergenic
1176677500 21:9793218-9793240 CTGTGCTTCCAGTAATCACAGGG + Intergenic
1176865234 21:14046995-14047017 CTGTAATCCCAGCACTCAGGAGG + Intergenic
1177436969 21:21068215-21068237 CTCTGCCTCCAGGACTCAAGAGG + Intronic
1177495533 21:21885289-21885311 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1177646824 21:23909500-23909522 CTGTAATCCCAGCACTTAGGAGG + Intergenic
1177796196 21:25780854-25780876 CTGTAATTCCAGCACTTGGGAGG + Intergenic
1177865837 21:26512457-26512479 CTGTGATCCCAGCACTTTGGGGG - Intronic
1178101420 21:29272587-29272609 CTGTAATGCCAGCACTTAGGAGG + Intronic
1178300287 21:31447312-31447334 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
1178340465 21:31781868-31781890 CTGTGCTTCCAGCTAGCACGAGG + Intergenic
1178517206 21:33258045-33258067 CTGTAATTCCAGCACTTTGGGGG + Intronic
1178885942 21:36484833-36484855 CTGTAATCCCAGCACTCGGGAGG - Intronic
1179712256 21:43269958-43269980 CTTTGCTCCCAGCAGTCAGAAGG + Intergenic
1179765455 21:43569304-43569326 TTGAGCTCCCAGCACTCGGGTGG - Intronic
1179827594 21:43975653-43975675 CAGTGCTCCCAGCGCCCAGGAGG - Intronic
1180552890 22:16554869-16554891 CTGTAATCCCAGCACTCTGGAGG - Intergenic
1180822241 22:18838523-18838545 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1181190731 22:21137523-21137545 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1181208474 22:21272984-21273006 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1181227177 22:21399507-21399529 CTGTAGTCCCAGCACTCAGGAGG + Intergenic
1181351205 22:22259570-22259592 CTGTAATCCCAGCACTCTGGAGG + Intergenic
1181534676 22:23535167-23535189 AAGTGCTCCCAGCACACAGGAGG - Intergenic
1181609828 22:24004910-24004932 CTGTAATCCCAGCACTCTGGAGG + Intergenic
1181807161 22:25382020-25382042 CTGTTATCCCAGCACTCTGGGGG + Intronic
1181976468 22:26734294-26734316 CTGTGGTTCCAGTACCCATGAGG + Intergenic
1182138977 22:27935523-27935545 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1182272128 22:29161248-29161270 CTGTGATCCCAGCACTTTGGGGG + Intronic
1182281169 22:29218526-29218548 CTGTGCCCCCAGGCCTCAGGAGG + Intronic
1182337553 22:29594561-29594583 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1182498524 22:30728271-30728293 CTGTGGTCCCAGCACTCGGGAGG + Intronic
1182545401 22:31072717-31072739 CTGTAATCCCAGCACTCTGGGGG - Intronic
1182675245 22:32034210-32034232 TTGTAATCCCAGCACTCAGGGGG - Intergenic
1182702854 22:32254545-32254567 CTGTAATTCCAGCACTTTGGAGG + Intronic
1182739840 22:32559706-32559728 CTGTAGTCCCAGCACTCTGGAGG + Intronic
1183226373 22:36552987-36553009 CTGTAATCCCAGCACTCGGGAGG - Intergenic
1183523043 22:38307427-38307449 CTGTAATCCCAGCTCTCAGGAGG + Intronic
1183567463 22:38625819-38625841 CTGTAATCCCAGTACTCAGGAGG + Intronic
1183643784 22:39110314-39110336 CTGTAATCCCAGCACTCTGGAGG + Intergenic
1183726312 22:39591815-39591837 CTGTGATCCCAGCACTTTGGGGG - Intronic
1183961076 22:41412363-41412385 CTGTAATCCCAGCACTCTGGAGG - Intergenic
1184000612 22:41670585-41670607 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1184071165 22:42148261-42148283 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1184107064 22:42373923-42373945 CTGTAGTCCCAGTACTCAGGAGG - Intergenic
1184467703 22:44678570-44678592 CTGTGATCCCAGCACTTTGGGGG - Intronic
1184526690 22:45028064-45028086 CTGTAATTCCAGCACTTGGGAGG + Intergenic
1184669766 22:46006559-46006581 CTGTGCTTCCTGCAAGGAGGGGG + Intergenic
1184730674 22:46369458-46369480 ATCTGCGTCCAGCACCCAGGAGG - Intronic
1184958663 22:47912429-47912451 CTGTAGTCCCAGCACTCAGGAGG - Intergenic
1184966362 22:47975147-47975169 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1185300652 22:50078479-50078501 CTGTGATCCCAGCACTTTGGGGG + Intronic
1185302302 22:50088324-50088346 CTGTAATCCCAGCACTCGGGAGG + Intergenic
1185368702 22:50448595-50448617 GTGTCCTTCCAGCGCTCAGCGGG + Exonic
1185381932 22:50513259-50513281 CTGTGATCCCAGCACTTTGGGGG + Intronic
1185381963 22:50513379-50513401 CTGTGATCCCAGCACTTTGGGGG + Intronic
1203218459 22_KI270731v1_random:22428-22450 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1203272375 22_KI270734v1_random:64408-64430 CTGTAATTCCAGCACTTTGGGGG - Intergenic
949186609 3:1199435-1199457 CTGTAATTCCAGCACTTTGGGGG - Intronic
949732078 3:7125194-7125216 CTGTAATCCCAGCACTTAGGAGG - Intronic
950237354 3:11334833-11334855 CTGTAATCCCAGCTCTCAGGAGG + Intronic
950239687 3:11357751-11357773 CTGTAATTCCAGCACTTTGGAGG + Intronic
950735949 3:15008263-15008285 CTGTGATCCCAGCACTTTGGAGG + Intronic
950963955 3:17133101-17133123 CTGTAATCCCAGTACTCAGGAGG + Intergenic
951443936 3:22755001-22755023 CTGTAATTCCAGCACTTTGGGGG + Intergenic
951534134 3:23726140-23726162 CTGTAATCCCAGCACTCTGGGGG + Intergenic
951893065 3:27584774-27584796 CTGTAATTCCAGCACTTTGGAGG - Intergenic
951905625 3:27704129-27704151 CTATAATTCCAGCACTCTGGGGG - Intergenic
952040379 3:29254371-29254393 CTGTGTTTCCAGCCCTGCGGTGG + Intergenic
952321719 3:32283991-32284013 CTGTAATTCCAGCACTTTGGGGG + Intronic
952325028 3:32313276-32313298 CTGTTCTCCCAGTGCTCAGGTGG - Intronic
952625565 3:35398698-35398720 CTGTAATTCCAGCACTTGGGAGG + Intergenic
953602208 3:44378256-44378278 CTGTAATCCCAGCTCTCAGGAGG + Intronic
953690865 3:45117917-45117939 CTGTAATCCCAGCACTGAGGAGG - Intronic
954177319 3:48854796-48854818 CTGTAATCCCAGCACTTAGGAGG + Intergenic
954242014 3:49301195-49301217 CTGCGGTTCCAGCACTTTGGAGG - Intronic
954267321 3:49479895-49479917 CTGTAATCCCAGCACTCTGGGGG - Intronic
954357993 3:50098697-50098719 CTGTAATTCCAGCACTTTGGGGG - Intronic
954585943 3:51736949-51736971 CTGTAGTCCCAGCACTCGGGAGG - Intergenic
954602707 3:51882510-51882532 CTGTAATCCCAGCATTCAGGAGG - Intergenic
954867010 3:53738205-53738227 CTGTGCCTCCAGGACTCTGTTGG + Intronic
955093603 3:55775407-55775429 CTGTGGTTCGAGCTCTCAGGAGG + Intronic
955188674 3:56739520-56739542 CTGTGGTCCCAGCTATCAGGAGG - Intronic
955301828 3:57787596-57787618 CTGTAATCCCAGCTCTCAGGAGG - Intronic
955835329 3:63048228-63048250 CTGTAGTTCCAGCACTCAGGAGG + Intergenic
955909212 3:63843042-63843064 CTGTAATTCCAGCACTTGGGAGG - Intronic
956062680 3:65363901-65363923 CTGGGCATCCAGCAGCCAGGTGG - Intronic
956216413 3:66853915-66853937 TTATGCTACCAGCACACAGGAGG + Intergenic
956440138 3:69272263-69272285 CTGTAGTTCCAATACTCAGGAGG - Intronic
957331548 3:78770806-78770828 CTGTGATTCCACCACTTATGAGG + Intronic
958101849 3:89021521-89021543 CTGTAATCCCAGCATTCAGGAGG - Intergenic
958432528 3:94059455-94059477 CTGTGGTCCCAGCACTTTGGGGG - Exonic
958707567 3:97675220-97675242 CTGTAATTCCAGCACTTGGGAGG + Intronic
958843609 3:99238794-99238816 CTGTAATCCCAGCACTCGGGAGG - Intergenic
959297648 3:104557647-104557669 CTGTAATTCCAGCACTTTGGGGG + Intergenic
959574473 3:107919480-107919502 CTGTGCTTCCAGCAGACATCGGG - Intergenic
960080489 3:113535013-113535035 CTGTAATCCCAGCACTCTGGAGG + Intronic
960103010 3:113764857-113764879 CTGTAATCCCAGCACTGAGGTGG + Intronic
960163520 3:114376324-114376346 CTGTGATGCCAGCACTCAAGGGG + Intronic
960665174 3:120101737-120101759 CTGTAATCCCAGCACTCTGGGGG - Intergenic
960891534 3:122453199-122453221 CTGTAATTCCAGCACTTGGGAGG - Intronic
960927947 3:122815038-122815060 CTGTCATTCCAGCCCACAGGAGG + Intronic
961073726 3:123962213-123962235 CTGTAATTCCAGCACTTTGGAGG - Intergenic
961184122 3:124899730-124899752 CTGTGGTCCCACCACTCAGGAGG + Intronic
961304252 3:125945301-125945323 CTGTAGTCCCAGCACTCAAGAGG - Intergenic
961657008 3:128448454-128448476 CTGTAATCCCAGCACTCTGGGGG - Intergenic
961672517 3:128544040-128544062 CTGTAATCCCAGCACTCTGGGGG - Intergenic
961723714 3:128912211-128912233 CTGTGATTCCAGCCCACTGGAGG - Intronic
961776894 3:129293824-129293846 CTGTAATCCCAGCACTTAGGGGG - Intronic
961796991 3:129416293-129416315 CTGTAATCCCAGCACCCAGGAGG + Intronic
962016758 3:131448762-131448784 CTGTAGTCCCAGCTCTCAGGAGG + Intergenic
962228898 3:133642245-133642267 CTGTAATCCCAGCACTCGGGAGG - Intronic
962748962 3:138418656-138418678 CTCTCCCTCCAGCACTCCGGTGG + Intergenic
962786204 3:138770450-138770472 CTGTAATCCCAGCACTCTGGGGG + Intronic
964331410 3:155607561-155607583 CTCTACTCCCAGCACTCAGAAGG - Intronic
964513743 3:157482478-157482500 CTGTAATTCCAGCACTTTGGGGG - Intronic
965801839 3:172502482-172502504 CTGTGTTCCCATGACTCAGGAGG - Intergenic
965812201 3:172602848-172602870 CTGTAATCCCAGCACTCTGGGGG - Intergenic
966418560 3:179714990-179715012 CTGTGCTCCCAGTACTTGGGAGG - Intronic
966576997 3:181513122-181513144 CTGTAATTTCAGCTCTCAGGAGG - Intergenic
966609238 3:181851946-181851968 CTGTAATCCCAGCACTCTGGGGG + Intergenic
966689033 3:182725054-182725076 CTCTGCTTTCAGCAGTGAGGAGG - Intergenic
966707706 3:182934620-182934642 CTGTACTCCCAGCACTTTGGGGG + Intergenic
966926735 3:184649188-184649210 CTGTAATTCCAGCACTTTGGAGG + Intronic
966952052 3:184829471-184829493 CTGTAATACCAGCACTCTGGGGG - Intronic
966998908 3:185313065-185313087 CTGTAGTTTCAGCTCTCAGGAGG + Intronic
967151741 3:186657575-186657597 CTGTAGTCCCAGTACTCAGGAGG + Intergenic
967160980 3:186737815-186737837 CTGTAATTCCAGCACTTTGGGGG - Intronic
967950186 3:194834604-194834626 CTGTAATCCCAGCACTCTGGGGG + Intergenic
968114089 3:196075866-196075888 CTGTAATCCCAGCACTCTGGGGG + Intronic
968202664 3:196768922-196768944 CTGTAATCCCAGCACTCTGGGGG - Intronic
968311723 3:197689145-197689167 CTGTAATCCCAGCACTCTGGAGG - Intronic
968312894 3:197698734-197698756 CTGTAATCCCAGCACTCGGGAGG + Intronic
968561889 4:1288078-1288100 CGGGGCTTCCAGCTCACAGGTGG - Intergenic
969318395 4:6395707-6395729 CTGAGCTGCCAGCAGTCACGGGG - Intronic
969414981 4:7052233-7052255 CTGTGCTTCCACCGCGCAGGCGG - Intronic
969480575 4:7444974-7444996 CTGTGGTTGCAACACCCAGGTGG + Intronic
969601280 4:8177903-8177925 CTGGGATTCCCCCACTCAGGGGG + Intergenic
969986168 4:11213226-11213248 CTGTAATTCCAGCACTTTGGGGG - Intergenic
970007468 4:11425519-11425541 CGGTGCTTGTAGCATTCAGGTGG + Intronic
970301381 4:14684784-14684806 CTGTAATCCCAGTACTCAGGAGG - Intergenic
970333859 4:15011355-15011377 CTGTAATCCCAGCACTCTGGAGG - Intronic
971046048 4:22806350-22806372 CTGTGATTCCACCACCCAGATGG + Intergenic
971252203 4:24982802-24982824 CTGTAATCCCAGCTCTCAGGAGG - Intergenic
971288587 4:25313616-25313638 CTGTAGTTCCAGCACTTGGGGGG + Intronic
971706569 4:30051003-30051025 CTGTAATTCCAGCACTTGGGAGG + Intergenic
971740961 4:30520598-30520620 CTGTAGTTCCAGCCCTGAGGTGG + Intergenic
971762869 4:30790799-30790821 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
971815627 4:31484316-31484338 CTGTAATCCCAGCACTCAGGAGG + Intergenic
972230468 4:37066935-37066957 CTGTAATCCCAGCACTCTGGGGG + Intergenic
972467855 4:39374441-39374463 CTGTAATCCCAGCACTCTGGAGG - Intergenic
972533744 4:39982465-39982487 CTGTACTCCCAGCACTTTGGGGG + Intergenic
972571899 4:40318662-40318684 CTGTGGTCCCAGCTCTCTGGAGG + Intergenic
972665656 4:41162731-41162753 CTGCGGTCCCAGCACTCAGGAGG + Intronic
972774947 4:42231833-42231855 CTGTAATTCCAGCACTTGGGAGG - Intergenic
972838391 4:42903044-42903066 CTGGGCTTCTAGAACTCAGGAGG + Intronic
973079965 4:45979029-45979051 CTGTATTTCCAGCACTTTGGGGG + Intergenic
973160781 4:47013414-47013436 CTGTAATCCCAGCACTCGGGAGG - Intronic
973196989 4:47455986-47456008 CTGTAATCCCAGCACTCTGGTGG + Intronic
973986485 4:56359510-56359532 CTATACTCCCAGCACTCTGGGGG - Intronic
974498928 4:62672317-62672339 CTGTAATTCCAGCACTCGGGAGG - Intergenic
974550952 4:63373786-63373808 CTGTAATCCCAGCACTCGGGAGG + Intergenic
974745618 4:66071451-66071473 CTGTAATCCCAGCACTGAGGTGG - Intergenic
975334585 4:73161214-73161236 CTGTGCTTTCAGCTCTCATACGG + Exonic
975382199 4:73714055-73714077 CTGTGCTTACAGCACTATGTTGG + Intergenic
975981823 4:80170109-80170131 CTGTAATTCCAGCACTTTGGAGG - Intergenic
976271032 4:83230399-83230421 CTGTTGTTCCAGCACTTTGGGGG + Intergenic
976672125 4:87665531-87665553 CTGTGCCTCAGGCACCCAGGAGG - Intergenic
977235330 4:94501339-94501361 CTGTGATACCAGCACTTTGGGGG - Intronic
978426513 4:108588364-108588386 CTGTAATCCCAGCTCTCAGGAGG + Intergenic
979110638 4:116750495-116750517 CTGTAATTCCAGCACTTTGGGGG - Intergenic
979263417 4:118673672-118673694 CCCTACTTCCAGCACTGAGGTGG + Intergenic
979333997 4:119446374-119446396 CTGTGATCCCAGCACTTTGGGGG - Intergenic
979515797 4:121608591-121608613 ATGTGGTTCCAGCACTGTGGAGG - Intergenic
979786504 4:124721752-124721774 CTGTAATCCCAGCTCTCAGGAGG - Intergenic
981038176 4:140193919-140193941 CTGTAATCCCAGCACTTAGGGGG + Intergenic
981529164 4:145735214-145735236 CTGTGCTCCATGCACTCAGGAGG - Intronic
981748302 4:148071356-148071378 CTGTAATCCCAGCACTCTGGGGG + Intronic
981989750 4:150903478-150903500 CTGTGATCCCAGCACTCTTGGGG + Intronic
982423286 4:155223455-155223477 CCGTACTCCCAGCACTCGGGAGG - Intergenic
982693992 4:158579388-158579410 CTGTAGTTCCTGTACTCAGGAGG - Intronic
982695295 4:158592314-158592336 CTGTAATCCCAGCACTCTGGGGG + Intronic
982708847 4:158739500-158739522 CTGTACTTCCAGCATTTTGGGGG - Intergenic
982775553 4:159437994-159438016 CTGTAGTCCCAGTACTCAGGAGG - Intergenic
983597392 4:169485756-169485778 CTATAATCCCAGCACTCAGGAGG + Intronic
983632042 4:169859529-169859551 CTGTAATCCCGGCACTCAGGAGG - Intergenic
983764309 4:171458254-171458276 CTGTAGTCCCAGTACTCAGGAGG + Intergenic
984002564 4:174268556-174268578 CTGTAGTCCCAGCACTCTGGAGG - Intronic
984002761 4:174270736-174270758 CTGTAATCCCAGCACTCGGGAGG - Intronic
984247803 4:177296418-177296440 CTATAATTCCAGCACTCTGGAGG + Intergenic
984598983 4:181704773-181704795 CTGTACTCCCAGCACTTTGGGGG + Intergenic
984705700 4:182845706-182845728 CTGTAATTCCAGCACTTTGGGGG - Intergenic
984717183 4:182936688-182936710 CTGTAATCCCAGCTCTCAGGAGG + Intergenic
984731391 4:183070985-183071007 CTGTAATCCCAGCACTTAGGAGG + Intergenic
984783773 4:183550254-183550276 CTGTAATTCCAGCACTTGGGAGG + Intergenic
984827526 4:183940023-183940045 CTGTAATTCCAGTACTCAGGAGG - Intronic
985080981 4:186263740-186263762 CTGTAATTCCAGCACTTGGGAGG + Intergenic
985398035 4:189565559-189565581 CTGTGCTTCCAGTAATCACAGGG - Intergenic
985510979 5:313795-313817 CTGTGATCCCAGCACTTTGGGGG - Intronic
985882657 5:2651565-2651587 CTGTGCTTCCAGCTGACGGGAGG - Intergenic
986016667 5:3763656-3763678 CTGTGATCCCAGCAATCTGGGGG + Intergenic
986546507 5:8903844-8903866 CTGTGCTTCCAGCTCACTGGAGG - Intergenic
986572366 5:9178584-9178606 CTGTAATCCCAGCACTTAGGAGG - Intronic
986835226 5:11629790-11629812 CTGTAATTCCAGCACTTGGGAGG - Intronic
986859100 5:11904841-11904863 CTGTGATTCCAGAGCTAAGGAGG + Intergenic
987575574 5:19723965-19723987 CTGTAATCCCAGCACTTAGGAGG - Intronic
988112683 5:26843369-26843391 CTATAGTCCCAGCACTCAGGAGG + Intergenic
989025037 5:37058041-37058063 CTGTAATTCCAGCCCTCAGGAGG - Intronic
989122821 5:38021214-38021236 CTGTAATCCCAGCTCTCAGGAGG + Intergenic
989316817 5:40090715-40090737 CTGTAGTCCCAGCACTCGGGAGG - Intergenic
989620864 5:43383073-43383095 CTGTAATTCCAGCACTTCGGGGG - Intronic
989733594 5:44676352-44676374 CTGTAGTTCCAGCACTTGGGGGG + Intergenic
989764925 5:45071042-45071064 CTGTAATTCCAGTACTCGGGAGG + Intergenic
990394405 5:55361713-55361735 CTGTAATCCCAGCACTCTGGGGG - Intronic
991055194 5:62312815-62312837 CTGTAATTCCAGCACTTTGGAGG + Intronic
991069786 5:62464079-62464101 CTGTAATCCCAGCACTCTGGGGG - Intronic
991573822 5:68082183-68082205 CTGTAATCCCAGCACTCTGGGGG + Intergenic
991686719 5:69188623-69188645 CTGTACTCCCAGCACTTTGGGGG - Intergenic
991710087 5:69400471-69400493 CTGTAATCCCAGCACTCTGGGGG - Intronic
991721889 5:69501171-69501193 CTGTAATTCCAGCACTTGGGAGG - Intronic
991769861 5:70030002-70030024 CTGTAATTCCAGCACTTTGGGGG - Intronic
991849156 5:70905421-70905443 CTGTAATTCCAGCACTTTGGGGG - Intronic
991906198 5:71513839-71513861 CTGTAGTCCCAGCATTCAGGAGG - Intronic
991916565 5:71611278-71611300 CTATGGTTCCAGCTTTCAGGAGG + Intronic
992133912 5:73723308-73723330 CTGTAGTCCCAGTACTCAGGAGG - Intronic
992247558 5:74842162-74842184 CTGTAATTCCAGCACTTTGGGGG + Intronic
992252053 5:74885665-74885687 CTGTAGTCCCAGCATTCAGGAGG + Intergenic
992305257 5:75430778-75430800 CTGTAATCCCAGCACTCTGGAGG + Intronic
992732318 5:79684376-79684398 CTATAGTCCCAGCACTCAGGAGG - Intronic
992889295 5:81189161-81189183 CTGTACTTCCTGCAGGCAGGTGG - Intronic
993376135 5:87150923-87150945 CTGTAATTCCAGCACTTTGGAGG + Intergenic
993486664 5:88495485-88495507 CTGTGATCCCAGCACTTTGGAGG - Intergenic
993554812 5:89322986-89323008 CTGTAATCCCAGCACTCGGGAGG + Intergenic
993610422 5:90046704-90046726 CTGTAATTCCAGCTCTCAGGAGG + Intergenic
993953819 5:94207766-94207788 TTGTGCTTCCAGAATACAGGGGG + Intronic
994218299 5:97164146-97164168 CTGTGATCCCAGCACTTTGGGGG - Intronic
994513386 5:100737338-100737360 CTGTAATTCCAGCACTTCGGAGG - Intergenic
994978877 5:106846512-106846534 CTGTAATCCCAGCACTTAGGAGG + Intergenic
995025600 5:107417959-107417981 CTGTTCTTCCAGCATGCACGAGG + Intronic
995916659 5:117254669-117254691 CTGTGATTCCAACACTTTGGAGG - Intergenic
996506638 5:124275484-124275506 CTGTGATCCCAGCACTTTGGGGG + Intergenic
996557559 5:124794713-124794735 CTGTAATTCCAGCACTTTGGGGG - Intergenic
996714467 5:126576002-126576024 CTGTAATCCCAGCACTCTGGGGG + Intronic
996799298 5:127385393-127385415 CTGTAATCCCAGCACTCAGGAGG - Intronic
996886621 5:128363310-128363332 CTGTAATCCCAGCACCCAGGAGG - Intronic
997281911 5:132654398-132654420 CTGTAATTCCAGCACTTTGGGGG - Intergenic
997331274 5:133063688-133063710 CTGTAATTCCAGCACTTTGGGGG - Intronic
997591485 5:135075830-135075852 CTCTGCTACCAGAACTCATGGGG - Intronic
997708422 5:135981220-135981242 CTTTAGTTCCAGCACTCAGGAGG - Intergenic
998105395 5:139465725-139465747 CTATAGTCCCAGCACTCAGGAGG + Intergenic
998251305 5:140555131-140555153 CTGTAATTCCAGCACTTTGGAGG - Intronic
998258031 5:140604270-140604292 CTGTAGTAACAGCACTCAGGAGG + Intergenic
998641174 5:144013035-144013057 CTGTTCTCCCAGGACACAGGTGG + Intergenic
999254585 5:150202950-150202972 CTGTAATCCCAGTACTCAGGAGG + Intronic
999462267 5:151767887-151767909 CTGTAATCCCAGCACTTAGGGGG - Intronic
999797497 5:155002096-155002118 CTGTAGTCCCAGTACTCAGGCGG + Intergenic
1000327318 5:160182175-160182197 CTGTGCTTCCGGCTTTCAGTGGG - Intergenic
1000391104 5:160724378-160724400 CTGTAATTCCAGCACTTTGGGGG - Intronic
1000903661 5:166937099-166937121 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1001088060 5:168715927-168715949 CTGTAATTCCAGCACTTTGGGGG - Intronic
1001665650 5:173431693-173431715 CTGTGATTCCAGCACTTGGGAGG + Intergenic
1001852309 5:174980309-174980331 CTGAGCTTCCTGAGCTCAGGGGG - Intergenic
1002511849 5:179725422-179725444 CTGTAATTCCAGCACTTTGGGGG + Intronic
1002542430 5:179915069-179915091 CTGTAATTCCAGCACTTGGGAGG + Intronic
1003184302 6:3817468-3817490 CTGTAATCCCAGCATTCAGGAGG + Intergenic
1003194799 6:3905103-3905125 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1003235643 6:4293363-4293385 CTGTAATCCCAGCACTTAGGAGG + Intergenic
1003602770 6:7533148-7533170 CTGTAGTTCCAGCACTTCGGTGG + Intergenic
1003883306 6:10497850-10497872 CTGTAATCCCAGCACTCGGGAGG + Intronic
1004404193 6:15316757-15316779 CTGTAATCCCAGCACTCAGGAGG - Intronic
1004634112 6:17450305-17450327 CTGTATTTCCAGCACTTTGGGGG - Intronic
1004725766 6:18309810-18309832 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1004727292 6:18323534-18323556 CTGTGATGCCAGCACTTGGGAGG - Intergenic
1004865278 6:19847302-19847324 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1005214816 6:23513030-23513052 CTGCAGTCCCAGCACTCAGGAGG + Intergenic
1005270692 6:24160098-24160120 CTGTAATTCCAGCACTTGGGAGG + Intergenic
1005516780 6:26562418-26562440 CTGTGTTTTCAGCTCTCAGCTGG - Intergenic
1005587016 6:27286873-27286895 CTGTAATCCCAGTACTCAGGAGG + Intronic
1006096010 6:31657261-31657283 CTGTGCTCCCTTCAGTCAGGTGG - Exonic
1006130749 6:31868072-31868094 CTGTAATCCCAGCACTTAGGAGG - Intronic
1006632458 6:35439218-35439240 CTGTGATCCCAGCACTTTGGAGG - Intergenic
1006674575 6:35753091-35753113 CTGTAATCCCAGCACTCTGGAGG - Intergenic
1006762212 6:36473020-36473042 CTGTAATTCCAGCTATCAGGAGG - Intronic
1006805034 6:36782545-36782567 CTGTAATCCCAGCACTCTGGGGG + Intronic
1006839533 6:37019623-37019645 GTGTGCTTACAGGACTCTGGGGG + Intronic
1006957316 6:37885384-37885406 CTGTAATCCCAGCACTCTGGGGG + Intronic
1007185280 6:39966300-39966322 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1007224928 6:40306954-40306976 CTGTGCTTCCAGCCCCTGGGAGG + Intergenic
1007263191 6:40578006-40578028 CTGTGCTGGGAGCACTCAGGGGG - Intronic
1010075937 6:71798292-71798314 CTGTTCTTGCAGGACTAAGGTGG + Intergenic
1010203992 6:73307171-73307193 CTGTAATCCCAGCACCCAGGAGG + Intronic
1010422504 6:75691098-75691120 CTGTAATTCCAGCACTTTGGAGG - Intronic
1010825153 6:80464247-80464269 CTGTGGTCCCAGTACTCAGGAGG - Intergenic
1011670987 6:89682823-89682845 CTGTGGTCCCAGCACTCAGGAGG + Intronic
1011681329 6:89786332-89786354 CTGTCATTCCAACACTTAGGAGG + Intronic
1011744132 6:90392853-90392875 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1012048601 6:94310183-94310205 CTGTAATCCCAGCACTTAGGGGG - Intergenic
1012068850 6:94585780-94585802 CTGTAATCCCAGTACTCAGGAGG + Intergenic
1012139890 6:95613091-95613113 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1013060374 6:106628208-106628230 CTGTAATCCCAGCACTTAGGGGG + Intronic
1013133381 6:107256769-107256791 CTGTAATTCCAGCACTTGGGAGG + Intronic
1013199512 6:107879446-107879468 CTGTAATCCCACCACTCAGGAGG - Intronic
1013238548 6:108221666-108221688 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1013458705 6:110356184-110356206 CTGTAATTCCAGCACTTTGGGGG + Intronic
1013484426 6:110583184-110583206 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1013508529 6:110822991-110823013 CTGTAATCCCAGTACTCAGGAGG + Intronic
1014112128 6:117630130-117630152 CTGTAATCCCAGCACTCTGGAGG - Intergenic
1014325573 6:119988515-119988537 CTGTAATACCAGCACTTAGGAGG + Intergenic
1014447122 6:121541526-121541548 CTGTAATTCCATCACTCTGGGGG + Intergenic
1014461165 6:121697459-121697481 CTGTGATCCCAGCATTTAGGAGG + Intergenic
1015167990 6:130220255-130220277 CTGTAATCCCAGCACTCTGGGGG - Intronic
1015289010 6:131517102-131517124 CTGTAATCCCAGCACTCAGGAGG - Intergenic
1015735371 6:136393895-136393917 CTGTAATCCCAGCACTCAGGGGG - Intronic
1015753600 6:136585751-136585773 TTGGGATTACAGCACTCAGGAGG - Intronic
1015765963 6:136716898-136716920 CTGTGATCCCAGCACTTTGGGGG + Intronic
1015894974 6:138008334-138008356 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1015955429 6:138593206-138593228 CTGTGATTCCAGCACTGACACGG + Intronic
1016013344 6:139160669-139160691 CTGTAATTCCAGCACTTGGGAGG - Intronic
1016302936 6:142652116-142652138 CTGTGATCCCAGCACTTTGGAGG - Intergenic
1016475348 6:144421248-144421270 CTGTAATTCCAGCACTTGGGAGG - Intronic
1017020640 6:150137261-150137283 CTGTAATTCCAGCACTTGGGAGG + Intergenic
1017115113 6:150968770-150968792 CTGTAATTCCAGCACTTTGGGGG - Intronic
1017300880 6:152856201-152856223 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1017514751 6:155146118-155146140 CTGTGATCCCAGCACTTTGGAGG + Intronic
1017590938 6:155977288-155977310 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1017825276 6:158077115-158077137 CTGTAATCCCAGCACTCAGGAGG - Intronic
1017841391 6:158225526-158225548 CTGTGGTCCCACTACTCAGGAGG + Intergenic
1017915739 6:158830432-158830454 CTGTAATTCCAGCACTTTGGAGG - Intergenic
1018146402 6:160894004-160894026 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1019385830 7:755607-755629 CTGTGGTTCCAGCTCCCGGGAGG + Intronic
1019401795 7:858895-858917 CTGTGATTCCAGCACTCTGGAGG + Intronic
1019492714 7:1322630-1322652 CTGGGCTCCCAGGACCCAGGCGG - Intergenic
1020046209 7:5042510-5042532 CTGTAATCCCAGCACTCTGGGGG + Intronic
1020049290 7:5071481-5071503 CTGTGGTTCCAGTACTCAGGAGG + Intronic
1020064673 7:5178173-5178195 CTGTGGTCCCAGCTCTCGGGAGG + Intergenic
1020128353 7:5545652-5545674 TTGTGGTTCCAGCACACAGCAGG + Intronic
1020291569 7:6726425-6726447 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1020700516 7:11476557-11476579 CTGTACTTCCAGCACTTTAGGGG + Intronic
1021223454 7:18000790-18000812 CTGTAGTCCCAGCACTCGGGAGG - Intergenic
1021709469 7:23401052-23401074 CTGTAATTCCAGCACTTTGGGGG - Intronic
1021714280 7:23447365-23447387 CTGTAATCCCAGCACTTAGGAGG + Intronic
1021999095 7:26207951-26207973 CTGTAATTCCAGCACTTTGGGGG + Intronic
1022000241 7:26219209-26219231 CTATAATCCCAGCACTCAGGTGG - Intergenic
1022680208 7:32537719-32537741 CTGTAATTCCAGCACTTTGGGGG - Intronic
1022909874 7:34890554-34890576 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1023337846 7:39188568-39188590 CTGTACTCCCAGCACTTTGGGGG - Intronic
1023721786 7:43103298-43103320 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1023941794 7:44773121-44773143 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1023941799 7:44773151-44773173 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1023941804 7:44773181-44773203 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1024041923 7:45562652-45562674 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1024188044 7:46974660-46974682 CTGTAATTCCAGCACTTGGGAGG + Intergenic
1024326546 7:48113832-48113854 CTGTAGTCCCAGCTCTCAGGAGG - Intergenic
1024598872 7:50962411-50962433 CTGGGCATCCAGCACCCAGAGGG + Intergenic
1024622835 7:51177514-51177536 CTGTAATCCCAGCACTCTGGGGG + Intronic
1024650374 7:51398366-51398388 CTGTAATTCCAGCACTCTGGGGG - Intergenic
1024774666 7:52769609-52769631 CTGTAATCCCAGCACTTAGGAGG - Intergenic
1024968737 7:55049657-55049679 CTGTGCTGGCAGTCCTCAGGTGG - Intronic
1025091358 7:56066740-56066762 CTGTAATCCCAGCTCTCAGGAGG - Intronic
1025998324 7:66542522-66542544 CTGTAGTCCCAGCTCTCAGGAGG + Intergenic
1026022714 7:66722182-66722204 CTGTAATCCCAGCACTCTGGGGG + Intronic
1026087459 7:67274259-67274281 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1026497863 7:70919270-70919292 CTGTAATCCCAGCACTTAGGGGG + Intergenic
1026500535 7:70939721-70939743 CTGTAATCCCAGCACTCGGGAGG - Intergenic
1026726776 7:72875978-72876000 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1026932397 7:74230834-74230856 CTGTAATGCCAGCACTTAGGAGG + Intergenic
1026991276 7:74587320-74587342 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
1027117064 7:75489643-75489665 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1027151109 7:75734322-75734344 CTGTAGTCCCAGCACTCAGGAGG + Intronic
1027366150 7:77460414-77460436 CTGTTCTTCCTGCCCTCTGGTGG - Intergenic
1027415909 7:77974897-77974919 CTGTAATTCCAGCACTTGGGAGG + Intergenic
1027631152 7:80607891-80607913 CTGTAGTCCCAGCACTCGGGAGG - Intronic
1028556040 7:92125871-92125893 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
1028789423 7:94835917-94835939 CTGTAATCCCAGCTCTCAGGAGG + Intergenic
1028826670 7:95281488-95281510 CTGTGCATCCAGCACTGAGGAGG - Intronic
1028905956 7:96154552-96154574 CTGTAATCCCAGCACTCTGGGGG - Intronic
1029009635 7:97245498-97245520 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1029028067 7:97439048-97439070 CTGCAATCCCAGCACTCAGGAGG + Intergenic
1029262498 7:99312737-99312759 CTGTGATTCCAGAACTTTGGGGG + Intergenic
1029429371 7:100519954-100519976 CTATACTTCCAGCACTTTGGGGG - Intergenic
1029513154 7:101009364-101009386 CTGTGTTCCCAGCACCCAGCAGG - Intronic
1029565926 7:101337823-101337845 CTGTAATTCCAGCACTTTGGAGG + Intergenic
1029632575 7:101762331-101762353 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1029720439 7:102360419-102360441 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1030697602 7:112603329-112603351 CTGGGCTTCCCTCACTCTGGGGG - Intergenic
1030699088 7:112619128-112619150 CTGTAATTCCACTACTCAGGAGG + Intergenic
1030844337 7:114390812-114390834 CTGTAATTCCAGCACTTAGCAGG - Intronic
1031049712 7:116932607-116932629 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1031058954 7:117027316-117027338 CTGTAGTCCCAGCACTGAGGAGG + Intronic
1031617174 7:123895136-123895158 TGGTGCTCCCAGCACTCAGCTGG + Intergenic
1032004845 7:128292651-128292673 TGGTTCTTCCAGCACTCAGCTGG + Intergenic
1032234523 7:130108595-130108617 CTGTGGTCCCAGCACTCATCAGG + Intronic
1032353158 7:131184781-131184803 CTGTGATCCCAGCACTTTGGAGG - Intronic
1032419044 7:131762939-131762961 CTGTGGCTCCAGCCATCAGGAGG - Intergenic
1032811169 7:135419783-135419805 CTGTACTCCCAGCACTTTGGGGG + Intronic
1033413320 7:141140021-141140043 CTGTAATCCCAGCACTCTGGGGG - Intronic
1033427286 7:141255810-141255832 CTGTAATTCCAGCACTTTGGGGG - Intronic
1033443932 7:141404046-141404068 CTGTAATCCCAGCACTCTGGGGG + Intronic
1033803543 7:144928642-144928664 CTCTGCTTCCAGGGCTCACGTGG + Intergenic
1033893446 7:146043207-146043229 CGGTTCTCCCAGCACTCAGCTGG - Intergenic
1034059186 7:148070458-148070480 CTGTAATCCCAGCACTCGGGAGG + Intronic
1034113700 7:148563396-148563418 CTGTGATCCCAGCACTTTGGGGG - Intergenic
1034503260 7:151465519-151465541 CTATGCTCCCTCCACTCAGGAGG + Intergenic
1034652264 7:152700884-152700906 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1034654655 7:152719921-152719943 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1034661847 7:152777826-152777848 CTGTAGTCCCAGCACTCAGGAGG + Intronic
1035063506 7:156088362-156088384 CTCTGGTTCCAGCACACTGGTGG + Intergenic
1035423251 7:158747223-158747245 CTGTAATCCCAGCTCTCAGGAGG + Intronic
1035562675 8:617954-617976 CTGAGCACCCAGCACTCAGAGGG - Intronic
1036092917 8:5688595-5688617 CTGTAATTCCAGCACTTGGGAGG + Intergenic
1036938376 8:13027144-13027166 CTGTGTATCCAGCACACAGCAGG - Exonic
1037308579 8:17530827-17530849 CTGTACTACCAGCACTTTGGGGG - Intronic
1037531101 8:19774886-19774908 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1037824421 8:22152617-22152639 CTGTGGTCCCAGCACTTGGGAGG + Intronic
1037860787 8:22404164-22404186 CTGTAATTCCAGCACTTTGGGGG + Intronic
1037872787 8:22514800-22514822 CTGTAATCCCAGTACTCAGGAGG - Intronic
1037896652 8:22661004-22661026 CTGTAGTCCCAGCACTCAGCAGG - Intronic
1038051960 8:23822292-23822314 CTGTAATCCCAGCACTGAGGTGG - Intergenic
1038099661 8:24359198-24359220 CTGTAATCCCAGCTCTCAGGAGG + Intergenic
1038508951 8:28112387-28112409 CTGTAATCCCAGCACTTAGGAGG - Intronic
1038561533 8:28585315-28585337 CTGTGGTTCCAGTTATCAGGAGG - Intergenic
1038656463 8:29457018-29457040 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1038785808 8:30615018-30615040 CTGTAATCCCAGCACTCTGGGGG + Intronic
1038799675 8:30738401-30738423 CTGTAATCCCAGCACTCGGGAGG + Intronic
1038955536 8:32464149-32464171 CTGTAATCCCAGCACTCTGGGGG - Intronic
1039027818 8:33277113-33277135 CTGTAATCCCAGCACTCGGGAGG + Intergenic
1039180287 8:34859120-34859142 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1039506502 8:38056374-38056396 CTGTCCTTACAGCACTCCTGTGG - Intronic
1040863309 8:52022961-52022983 CTGTGTTTCAAGCACTGATGTGG + Intergenic
1041265760 8:56062960-56062982 CTGTGATCCCAGCACTTTGGAGG + Intergenic
1041284791 8:56249210-56249232 CTGTAATCCCAGCACTCAGGAGG + Intergenic
1041447542 8:57969327-57969349 TTGTGCTTACAGAACTCAGCTGG - Intergenic
1041504997 8:58586925-58586947 CTGTGCTTCAGGCACTTTGGCGG - Intronic
1041652326 8:60313221-60313243 CTGTAATCCCAGCACTCTGGAGG + Intergenic
1042139783 8:65666282-65666304 CTGTAATCCCAGCTCTCAGGAGG + Intronic
1042139926 8:65667682-65667704 CTGTAATTCCAACACTCTGGAGG - Intronic
1042181923 8:66098323-66098345 CTGTGGTCCCAGTATTCAGGAGG - Intronic
1042251857 8:66764118-66764140 CTGTAATCCCAGCACTCTGGGGG - Intronic
1042261472 8:66864694-66864716 CTGTACTCCCAGCACTTTGGGGG + Intergenic
1042269672 8:66942245-66942267 CTGTAATCCCAGTACTCAGGAGG + Intergenic
1042281043 8:67056312-67056334 CTGTAGTCCCAGCACTCAGGAGG - Intronic
1042601157 8:70501145-70501167 CTGTGATTCCAGCACTTGGAAGG - Intergenic
1042942170 8:74118614-74118636 CTGTACTCCCAGCACTTTGGGGG - Intergenic
1043466499 8:80513224-80513246 CTCTGCCTCCCGGACTCAGGCGG + Intronic
1044572058 8:93731036-93731058 CTGTAGTCCCAGCTCTCAGGAGG + Exonic
1044918869 8:97147247-97147269 CTGTAATTCCAGCACTTTGGAGG + Intronic
1044971956 8:97628494-97628516 CTGTGGTCCCAGCTATCAGGAGG + Intergenic
1044980217 8:97708855-97708877 CTGTAATCCCAGCACTCTGGGGG - Intronic
1045101084 8:98844720-98844742 CTGTAATCCCAGCACTCTGGAGG - Intronic
1045146619 8:99352574-99352596 CTGTAATCCCAGCACTGAGGTGG + Intronic
1045463903 8:102451559-102451581 CTGTAGTCCCAGCACTCAGGAGG + Intergenic
1045759718 8:105589975-105589997 CTGTAATCCCAGCACTCTGGGGG - Intronic
1045783540 8:105896376-105896398 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1046340739 8:112851507-112851529 CTGCGATCCCAGCACTTAGGAGG + Intronic
1046402407 8:113721386-113721408 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1046725132 8:117665773-117665795 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1046926435 8:119794272-119794294 CTGTAATCCCAGCTCTCAGGAGG + Intronic
1047155054 8:122307647-122307669 CTGTAATTCCAGCACTCTGGAGG + Intergenic
1047278969 8:123428453-123428475 CTGTACTCCCAGCACTTTGGGGG - Intronic
1047498637 8:125426349-125426371 CTGTGTCTCCAGCACTTAGTGGG + Intergenic
1047610378 8:126515027-126515049 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1047614304 8:126550583-126550605 CTGTGATCCCAGCACTCAGGAGG - Intergenic
1047729924 8:127719226-127719248 CTGTAATCCCAGCACTCAGATGG + Intergenic
1047738737 8:127789890-127789912 CTGTGCTTCCACCACACCTGGGG + Intergenic
1047874978 8:129126149-129126171 CTGTAATCCCAGCACTCAGGAGG + Intergenic
1048275301 8:133061556-133061578 CTGTGCTTCCACCATCCAGAGGG - Intronic
1048349672 8:133605983-133606005 CTATGATCCCAGCACTTAGGGGG - Intergenic
1049038816 8:140097439-140097461 CTGCGCAGCCAGGACTCAGGCGG - Intronic
1049322929 8:142006692-142006714 CTGAGCTTCCAGCCCTCACTTGG + Intergenic
1049687112 8:143943438-143943460 CTGTCCGGCCAGCACTGAGGTGG - Intronic
1049868019 8:144951362-144951384 CTGTAATTCCAGCACTTGGGAGG + Intergenic
1050104719 9:2153408-2153430 CTGTAGTCCCAGCTCTCAGGAGG + Intronic
1050236894 9:3591352-3591374 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1050488053 9:6155891-6155913 CTGTGGTCTCAGTACTCAGGGGG + Intergenic
1051386374 9:16513559-16513581 CTGTGATCCCAGCACTTGGGAGG - Intronic
1051401955 9:16692870-16692892 CTGTAATTCCAGCACTTTGGGGG + Intronic
1051429281 9:16965540-16965562 CTATAATCCCAGCACTCAGGTGG - Intergenic
1051567678 9:18518828-18518850 CTGTAATCCCAGCACTCAGGAGG - Intronic
1051792890 9:20828047-20828069 CTGTTGTCCCAGCACTCAGGAGG + Intronic
1052337002 9:27330393-27330415 CTGGGCTAGCAGCACTCAGAAGG + Exonic
1053080014 9:35167858-35167880 CTGTAATCCCAGCACTCTGGGGG - Intronic
1053262268 9:36678663-36678685 CTGTAATCCCAGCACTCTGGAGG - Intergenic
1053282920 9:36832627-36832649 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1053373047 9:37578692-37578714 CTGTAATTCCAGCTATCAGGAGG + Intronic
1055539649 9:77290037-77290059 CTGTAATCCCAGCACTCTGGGGG - Intronic
1056145406 9:83723969-83723991 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1056213654 9:84388528-84388550 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1056227341 9:84508774-84508796 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1056378732 9:86038302-86038324 TTGTGCTTCCAGCAGTGTGGCGG + Intronic
1056564907 9:87762823-87762845 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1056800510 9:89687516-89687538 CTGTGCTCCCAGGACACAAGTGG - Intergenic
1057336417 9:94159102-94159124 CTGTAATTCCAGCACTTTGGAGG - Intergenic
1058288070 9:103205099-103205121 CTGTAGTCCCAGCACTCAGGAGG - Intergenic
1058713771 9:107704379-107704401 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1058933257 9:109743235-109743257 GTGTAGTTCCAGCACTTAGGTGG + Intronic
1059008356 9:110428945-110428967 CTGTAGTCCCTGCACTCAGGAGG + Intronic
1059129343 9:111729362-111729384 CTGTAATTCCAGCACTTGGGAGG - Intronic
1059296118 9:113272294-113272316 CTGTGGTCCCAGCACGCGGGAGG + Intronic
1059301056 9:113313910-113313932 CTGTAATCCCAGCACTTAGGCGG + Exonic
1059325640 9:113502543-113502565 CTGTGTTTCCTGCCCTCATGGGG + Intronic
1060120787 9:120987514-120987536 CTGTAATCCCAGCTCTCAGGAGG + Intronic
1060177441 9:121507478-121507500 CTGTAATCCCAGCACTTAGGCGG - Intergenic
1060427335 9:123517361-123517383 CTGTAATCCCAGCACTCGGGAGG + Intronic
1060648247 9:125301189-125301211 CTGTAGGCCCAGCACTCAGGAGG - Intronic
1061029421 9:128070826-128070848 CTGTAATTCCAGTACTCGGGAGG + Intronic
1061078636 9:128356683-128356705 CTGTAATCCCAGCACTTAGGAGG + Intronic
1061082259 9:128378695-128378717 CTGTGATCCCAGCACTTTGGGGG + Intronic
1061102330 9:128501655-128501677 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1061126012 9:128676231-128676253 CTGTAATTCCAGCACTTGGGAGG + Intergenic
1061172426 9:128967531-128967553 CTGTAATCCCAGCACTCGGGAGG + Intronic
1061797383 9:133094830-133094852 CTGTGGTCCCAGCTCTCAAGAGG - Intergenic
1062227179 9:135459261-135459283 CTGTAATCCCAGCACTGAGGCGG - Intergenic
1062412444 9:136431911-136431933 CTGTGCGCCCGCCACTCAGGCGG + Exonic
1062460642 9:136661292-136661314 CTGTCCCTCCAGCTGTCAGGAGG - Intronic
1062555328 9:137111220-137111242 CTGTGATCCCAGCACTCTGAGGG + Intronic
1062555346 9:137111277-137111299 CTGTGATCCCAGCACTCTGGGGG + Intronic
1062555364 9:137111334-137111356 CTGTGATCCCAGCACTCTGGGGG + Intronic
1203653387 Un_KI270752v1:228-250 CTTTAATCCCAGCACTCAGGGGG - Intergenic
1185533016 X:836765-836787 CTGTAATCCCAGCACTCTGGAGG - Intergenic
1186069486 X:5802938-5802960 AGGTTCTTCCTGCACTCAGGCGG - Intergenic
1186274069 X:7921010-7921032 CTGTAATTCCAGCACTTTGGGGG + Intronic
1186282922 X:8013567-8013589 CTGTACTCCCAGCACTTGGGAGG - Intergenic
1186970780 X:14840112-14840134 CTGTAATCCCAGCACTCTGGGGG - Intergenic
1186990460 X:15061617-15061639 CTGTGCTTCCAGCCTACGGGTGG - Intergenic
1187204496 X:17169420-17169442 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1187321589 X:18243328-18243350 CTGTAATTCCAGCACTTTGGGGG - Intronic
1187493141 X:19771604-19771626 CTGTAATTCCAGCACTTTGGGGG + Intronic
1187687453 X:21829842-21829864 CTGTAATCCCAGCACTCTGGAGG + Intergenic
1188080453 X:25832734-25832756 CTGTTTTTCCAGTACTTAGGGGG + Intergenic
1188220371 X:27533949-27533971 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1188273710 X:28175639-28175661 CTGTAATCCCAGCACTGAGGCGG - Intergenic
1188892244 X:35625594-35625616 CTGTAATCCCAGCACTCAGGAGG + Intergenic
1189201056 X:39195896-39195918 CTGTCCAACCAGCACCCAGGAGG + Intergenic
1189345688 X:40239646-40239668 CTGTAATTCCAGCACTTTGGCGG - Intergenic
1189631059 X:42953623-42953645 CTGTAATCCCAGCACTTAGGAGG - Intergenic
1190375544 X:49785147-49785169 CTCGGTTTCCAGCCCTCAGGAGG - Intergenic
1190616766 X:52242215-52242237 CTGTAATCCCAGCACTCTGGGGG + Intergenic
1190822978 X:53991744-53991766 CTGTAATCCCAGCACTCTGGAGG + Intronic
1191831660 X:65421824-65421846 CTGTAGTCCCAGCACTCGGGAGG + Intronic
1192224135 X:69216900-69216922 CTATGCTTCAAGCCCTCAAGGGG - Intergenic
1192834401 X:74783864-74783886 CTGTACTGCCTGAACTCAGGTGG - Intronic
1193118052 X:77794635-77794657 CTGTAGTCCCAGCACTCAGGAGG + Intergenic
1193254995 X:79337543-79337565 CTGAGGTTCCAGCACTCTAGTGG - Intergenic
1193456551 X:81738158-81738180 CTGTAATCCCAGCACTCTGGTGG - Intergenic
1193539281 X:82752035-82752057 CTGTAATTCCAGCACTTGGGAGG + Intergenic
1193539957 X:82759158-82759180 CTGTAATCCCAGTACTCAGGAGG - Intergenic
1194065180 X:89252668-89252690 CTGTGATCCCAGCACTTTGGGGG + Intergenic
1194295541 X:92122237-92122259 CTGTAATTCCAGCACTTTGGAGG - Intronic
1194731916 X:97464968-97464990 CTGTAATTCCAGCACTTGGGAGG - Intronic
1195021729 X:100835141-100835163 CTGTAGTGCCAGCACTCTGGAGG + Intronic
1195253023 X:103066310-103066332 CTGTAATCCCAGCACTCAAGAGG - Intergenic
1195962056 X:110396566-110396588 CTGTAATTCCAGCTCTGAGGAGG - Intronic
1196746996 X:119079973-119079995 CTCTGGTTCCAGCATTAAGGTGG - Exonic
1196807288 X:119599750-119599772 CTGTAATTCCAGCACTTTGGGGG - Intronic
1197926546 X:131652705-131652727 CTGTAATTCCAGCACTTTGGGGG - Intergenic
1198180305 X:134201436-134201458 CTGTAATCCCAGCTCTCAGGAGG - Intergenic
1198263585 X:134988480-134988502 CTGTAATCCCAGCACTCAGGAGG - Intergenic
1198563674 X:137880979-137881001 CTGTACTCCCACTACTCAGGAGG - Intergenic
1198771118 X:140131043-140131065 CTGTAATTCCAGCACTCTGGGGG - Intergenic
1198828117 X:140719963-140719985 CTGTAATCCCAGTACTCAGGAGG + Intergenic
1199134488 X:144234546-144234568 CTGTAATTCCAGCACTCTGGGGG + Intergenic
1199445592 X:147916979-147917001 CTGTAATTCCAGCACTTTGGAGG - Intronic
1199650580 X:149943740-149943762 CTGTAATCCCAGCACTCAGGAGG - Intergenic
1200169015 X:154058512-154058534 CTGTCGTTCCAGGACCCAGGAGG - Intronic
1200360864 X:155604627-155604649 CTCTGCAGCCAGCACTCAAGTGG + Intronic
1200613043 Y:5346751-5346773 CTGTAATTCCAGCACTTTGGAGG - Intronic
1200754660 Y:6979187-6979209 CTGTAATCCCAGCACTCTGGAGG - Intronic
1200853782 Y:7914718-7914740 CTGTAATTCCAGCACTTTGGAGG + Intergenic
1201251548 Y:12063461-12063483 CTGTAATTCCAGCACTTTGGGGG + Intergenic
1201260619 Y:12155591-12155613 CTGTGGTCCCACTACTCAGGAGG + Intergenic
1201360933 Y:13148149-13148171 CTGTAATCTCAGCACTCAGGAGG - Intergenic
1201375559 Y:13315349-13315371 CTGTAATCCCAGCACTCTGGGGG + Intronic
1201474411 Y:14364940-14364962 CTGTAATCCCAGCTCTCAGGAGG + Intergenic
1202304602 Y:23455194-23455216 CTGTAATACCAGCACTCTGGAGG - Intergenic
1202566208 Y:26215397-26215419 CTGTAATACCAGCACTCTGGAGG + Intergenic