ID: 1162500225

View in Genome Browser
Species Human (GRCh38)
Location 19:11049179-11049201
Sequence CAGTGCATGCAGAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 343}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162500221_1162500225 -7 Left 1162500221 19:11049163-11049185 CCAGGCAGAGAGGACACAGTGCA 0: 1
1: 0
2: 9
3: 38
4: 325
Right 1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG 0: 1
1: 0
2: 3
3: 29
4: 343
1162500217_1162500225 19 Left 1162500217 19:11049137-11049159 CCACTGGGAGGAGAGGGACAAGT 0: 1
1: 0
2: 2
3: 27
4: 246
Right 1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG 0: 1
1: 0
2: 3
3: 29
4: 343
1162500220_1162500225 -6 Left 1162500220 19:11049162-11049184 CCCAGGCAGAGAGGACACAGTGC 0: 1
1: 3
2: 7
3: 49
4: 308
Right 1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG 0: 1
1: 0
2: 3
3: 29
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162500225 Original CRISPR CAGTGCATGCAGAGGCTGGA GGG Intronic
900302507 1:1985227-1985249 CGGTGAATGCAGTGGTTGGAAGG - Intronic
900484898 1:2917853-2917875 CAGAGCCTGCAGAAGCTGGAAGG - Intergenic
900594268 1:3473350-3473372 CTGGCCATGCAGAGCCTGGAAGG + Intronic
901053684 1:6438587-6438609 CTGTGCATGCAGGGCCTGGCCGG - Intronic
901817631 1:11803836-11803858 CAGTTCGTGCACAGGATGGAAGG + Intronic
902417204 1:16247208-16247230 CAGTTCATGGAGAGGCTACATGG + Exonic
902480620 1:16709744-16709766 CTGTGCATGCAGGGCCTGGCTGG + Intergenic
902538974 1:17138925-17138947 GAGTGGATGGAGAGGGTGGAAGG + Intergenic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
903377566 1:22876378-22876400 CAGGGCATGCAGGGGTTGTACGG - Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
904167523 1:28567485-28567507 CAGGGCATCCATACGCTGGATGG + Intronic
904812258 1:33171042-33171064 CAGAGCAGGAAGAGGCTGCAGGG + Intronic
905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG + Intergenic
907414457 1:54304595-54304617 CAGTTCCTGCAAAGGCTGCATGG + Intronic
910628892 1:89337074-89337096 CTGTGGATTCAGAGGGTGGAAGG + Intergenic
912504916 1:110149979-110150001 CAGGGGCTGCAGAGGCTGAAAGG - Intergenic
913163578 1:116166444-116166466 CTGTGCCTGCCTAGGCTGGAGGG - Intergenic
917494505 1:175527937-175527959 CAGTGCAGGCACAGGCAGGCTGG + Intronic
921555809 1:216597417-216597439 CTGTGCATGAAGAAGATGGAAGG + Intronic
922372493 1:224925305-224925327 CACTGCCTGCAGAGGCTCCAAGG - Intronic
924037498 1:239952557-239952579 CAGAGCCTGCAGTGGCTGCATGG + Intergenic
924669619 1:246110354-246110376 CAGCCCATGCTGAGGCCGGAAGG + Intronic
1062796489 10:348425-348447 GTGTGGAGGCAGAGGCTGGATGG - Intronic
1062848699 10:727070-727092 CAGTGCTGGGGGAGGCTGGAGGG + Intergenic
1062970392 10:1643709-1643731 AGCTGCATGCGGAGGCTGGAAGG - Intronic
1063549094 10:7012103-7012125 CAGTTGAAGCAGAGGCTGTATGG - Intergenic
1064478549 10:15718224-15718246 TAGTGCAGGCAGAGTGTGGATGG - Intronic
1064694128 10:17948872-17948894 AAGTGCCTGCAAATGCTGGATGG + Intergenic
1065297818 10:24293414-24293436 CAGTGCCTGCAGAGGCAGCAAGG - Intronic
1065637270 10:27744660-27744682 CAGCCCATGCCGCGGCTGGACGG - Intronic
1065972346 10:30815619-30815641 CTGTGAAAGCAGAGGCTCGAGGG - Intergenic
1066320322 10:34296696-34296718 CAGTACATGCTGATGGTGGATGG + Intronic
1066526412 10:36284037-36284059 CAGGGCATGCAGGGGCGGGCGGG + Intergenic
1067459416 10:46446388-46446410 CATTCCATGGAGAGGTTGGAGGG + Intergenic
1067627778 10:47938242-47938264 CATTCCATGGAGAGGTTGGAGGG - Intergenic
1067708546 10:48629109-48629131 CAGTGGAGGCAAAGGCTGAAAGG - Intronic
1069565531 10:69461082-69461104 CCGTTCATGCAGATGCTGGGAGG + Intronic
1069777052 10:70933348-70933370 CAGTTCATGCTGAGCCTGGAGGG - Intergenic
1069915019 10:71782065-71782087 CACTGCAGCCTGAGGCTGGAAGG + Intronic
1070240497 10:74675403-74675425 CGATGCTTGTAGAGGCTGGAGGG - Intronic
1070377807 10:75850882-75850904 CAGAGTATGCAGAGGTTTGAAGG + Intronic
1071497463 10:86178915-86178937 CAGGCATTGCAGAGGCTGGAGGG + Intronic
1072475502 10:95756175-95756197 CACAGCAAGCAGAGGCTGGGGGG + Intronic
1073009759 10:100349944-100349966 CAGGGGGTGCTGAGGCTGGAAGG - Intronic
1073559808 10:104487104-104487126 CAGACCATGCAGAGCCTGAATGG + Intergenic
1075341226 10:121648236-121648258 CAGTGACTGCAGAGGAGGGATGG - Intergenic
1075923334 10:126231550-126231572 CAGGGCAAGGAGAGGATGGAAGG - Intronic
1076141289 10:128080398-128080420 CTGTGCATAGAGAGGCAGGAAGG + Intronic
1076365556 10:129919322-129919344 CAGTGGAGGCGGAGGCTGGGAGG + Intronic
1076436960 10:130453127-130453149 CAAAGCTTGCAGAGGCTGGCTGG - Intergenic
1077532494 11:3103768-3103790 AAGGGACTGCAGAGGCTGGAAGG - Intronic
1077532508 11:3103827-3103849 AAGGGGCTGCAGAGGCTGGAAGG - Intronic
1078039652 11:7848084-7848106 CAATGAATGCACAGGCTGGTAGG - Intergenic
1078149491 11:8746574-8746596 GAGTGAATGCAGAGGAGGGAGGG + Intronic
1078246481 11:9576583-9576605 AAGTGTGTGAAGAGGCTGGATGG + Exonic
1079094789 11:17503204-17503226 CAGTGAATGCACAGGCAAGAAGG + Intronic
1079116277 11:17642349-17642371 CAGTGCAGGCACAGGCTCCAGGG - Intronic
1079359192 11:19756415-19756437 CAGTTCATGAAGAGTCTAGAAGG + Intronic
1081027190 11:38030523-38030545 CAGCGCATGCAAAGGCATGAAGG - Intergenic
1081615642 11:44589503-44589525 CAGTGCTTGCAGAAGCAGCAAGG - Intronic
1081623007 11:44630230-44630252 CAGTTCTTGCCCAGGCTGGAGGG + Intergenic
1082899322 11:58228424-58228446 CTGTGCACGCAGATGCTGGGTGG - Exonic
1082904596 11:58292325-58292347 CTGTGCGTGCAGATGCTGGGCGG - Intergenic
1083683329 11:64361288-64361310 CAGAGCAGGAAGAGGCAGGAAGG - Intronic
1083764386 11:64835104-64835126 GAGAGCAAGCAGCGGCTGGAGGG - Exonic
1084551456 11:69845566-69845588 CAGTCCATGCAGAGGGAAGAAGG + Intergenic
1084942061 11:72618213-72618235 CAGAGCAGGCAGTGCCTGGATGG - Intronic
1084957411 11:72698652-72698674 GCGAGCAAGCAGAGGCTGGAGGG - Intronic
1085757418 11:79213188-79213210 CAGTGTATGTGGAGGCTGGATGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089969258 11:122679226-122679248 CAGTGCGTGCATAGGCACGATGG + Intronic
1090405798 11:126475270-126475292 CCATGCAGGCTGAGGCTGGAAGG - Intronic
1090473074 11:126997110-126997132 CTGTGCATGTGCAGGCTGGATGG + Intronic
1091301992 11:134513847-134513869 CAGAGCCTGCAGAGACTGGCTGG + Intergenic
1091346330 11:134856753-134856775 CAGTGCAGGCAGAGCGTGGCTGG + Intergenic
1095230584 12:39734221-39734243 CAGTGCATGCAGCCCATGGAGGG - Intronic
1096627919 12:52906581-52906603 CAGGGCATGCTGTGGGTGGAAGG + Intronic
1096668253 12:53181129-53181151 CAGCGGGTGCAGAGGCTGGCTGG + Intronic
1096867116 12:54571176-54571198 AAGTGGAGGCAGAGGATGGATGG - Intronic
1096968336 12:55646519-55646541 CAGCGCAGGCAGAGGCTGCCAGG + Intergenic
1097042439 12:56163851-56163873 CATGGCATGCAGTGGCTGGGTGG + Intronic
1097793668 12:63841284-63841306 AAGAGAAAGCAGAGGCTGGAAGG - Intergenic
1098608755 12:72427779-72427801 GTGTTCATGCACAGGCTGGATGG + Intronic
1100675997 12:96868774-96868796 CAGTGAATGCAAAGGATGAATGG - Intronic
1101888052 12:108686322-108686344 AAATGAATGCAGAGGCTGAAAGG + Intronic
1102200068 12:111051209-111051231 CAGTCCATGCTGAGCATGGAAGG - Intronic
1102946878 12:116997624-116997646 CAGTCCAAGCAGAGGCAGCAGGG + Intronic
1104808883 12:131608031-131608053 CTTTGCATGCAGTGGCTGGTCGG + Intergenic
1105957803 13:25300913-25300935 CCGTGCATCCTGATGCTGGAGGG - Intergenic
1106842506 13:33699472-33699494 CCGTGATTGCAGGGGCTGGATGG - Intergenic
1107001918 13:35557482-35557504 CAGAGCATGCAGACTCTGGTGGG + Intronic
1107106637 13:36650152-36650174 GAGGGCAGGTAGAGGCTGGAGGG + Intergenic
1109158416 13:58940839-58940861 CAGTGAATGCAGAGGCCTAAGGG - Intergenic
1111192661 13:84830774-84830796 CAGGGCTGTCAGAGGCTGGAGGG + Intergenic
1111608765 13:90576425-90576447 CAGTGCATGGAGCGGCTGGCTGG + Intergenic
1111984939 13:95056379-95056401 CAGTTCATTCAGAGGCTACAGGG - Intronic
1113680202 13:112238605-112238627 CAGTGCAGCCACAGGCTGAAGGG - Intergenic
1113711203 13:112466664-112466686 CTGTGCATGGAGAAGCTGGGAGG - Intergenic
1113738806 13:112696971-112696993 CAGTGCGTGCGCAGGCTGGCGGG + Intronic
1114620000 14:24089993-24090015 CAGATCATGCAGAGCCTGGGAGG + Intronic
1118690376 14:68333089-68333111 CAGTATATGCAGAGGCAGAAAGG - Intronic
1120376458 14:83713942-83713964 CAGTGAAGGCAGAGGATGGTGGG - Intergenic
1120826795 14:88963353-88963375 CAGTGCTTTCAGAGGCCAGAGGG + Intergenic
1121322381 14:92999522-92999544 CAGTGGGTGGGGAGGCTGGAAGG + Intronic
1121682316 14:95803934-95803956 CAGCACATGCTGAGGCTTGAAGG - Intergenic
1122060121 14:99131716-99131738 GTGTGCAGGCAGAGGCTGGAGGG + Intergenic
1122290881 14:100679836-100679858 CAGTGCATCCAGAGGCCTGGGGG + Intergenic
1122405110 14:101496272-101496294 AACAGCATGCAGAGGCTGCAGGG + Intergenic
1122407941 14:101511499-101511521 GAGTGCAAGCTGAGGCTGAAGGG + Intergenic
1122460290 14:101888915-101888937 AGATGCATGGAGAGGCTGGAAGG - Intronic
1122703680 14:103607079-103607101 AGGTGGAGGCAGAGGCTGGAGGG + Intronic
1122922871 14:104887163-104887185 CTGTGCCCGCAGAGGCTGGGGGG - Exonic
1123047635 14:105526593-105526615 CAGTGGCGGCAGAGGCTGGGCGG + Exonic
1124376974 15:29134566-29134588 CAGCGCATTCAGACGCTGTAAGG - Intronic
1125722736 15:41852972-41852994 GAGTGCCTGCAGGAGCTGGAAGG - Exonic
1126785056 15:52171525-52171547 CAGTGAATGCAGAGAAAGGAAGG + Intronic
1127293603 15:57591610-57591632 GAGGGCGTGCAGAGGCTGTAGGG + Intergenic
1127784955 15:62347696-62347718 AACTGCATGAGGAGGCTGGAAGG + Intergenic
1127983153 15:64048729-64048751 ATGTGCATGCAGAGGAGGGAAGG - Intronic
1128792538 15:70443678-70443700 GAGTGCAGGCAGAGACTGGCAGG - Intergenic
1129172867 15:73818440-73818462 CAGTGAATGCAGAGTGTGGTTGG - Intergenic
1130649485 15:85754106-85754128 CAGTGCATGCTGAGCCCGGAGGG - Intergenic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131854872 15:96582870-96582892 CAGTGCAGGCAGGAGCTGGTGGG - Intergenic
1131946539 15:97628511-97628533 TGGTGCTTGCAGTGGCTGGATGG - Intergenic
1132080566 15:98861402-98861424 CGCTGCATGCAGAGGGTGTAAGG - Intronic
1132396623 15:101479579-101479601 CGGTGCATGCAGAGGCTGGTGGG + Intronic
1132860767 16:2070694-2070716 CAGTGGGTGCAGAGGAGGGACGG - Intronic
1134607187 16:15580482-15580504 AAGTTCATCCAGAGGGTGGAAGG + Intronic
1135495197 16:22945401-22945423 GAGTGCAAGCAGAGGCTGTCTGG - Intergenic
1136068068 16:27771847-27771869 TAGTTCCTGCTGAGGCTGGAGGG + Intronic
1138519867 16:57564856-57564878 CAGCACATGCAAAGGCTGGGAGG + Intronic
1139344066 16:66290658-66290680 CAGTGCAGGGAGTGGCTGGCTGG - Intergenic
1139367830 16:66444470-66444492 CAGTGCAGGGGGAGGATGGAGGG + Intronic
1141263572 16:82475571-82475593 CTGAGGATGCAGAGGCTGGCAGG - Intergenic
1141337063 16:83165926-83165948 CAGTGGTGGGAGAGGCTGGAGGG + Intronic
1142158524 16:88545081-88545103 CAATGTCTGCAGTGGCTGGAGGG + Intergenic
1142399357 16:89851276-89851298 CAGGGCCTGGAGAGGCTGGTGGG - Intronic
1144522922 17:15966368-15966390 CAGTCCAGCCACAGGCTGGATGG - Intronic
1144825060 17:18101116-18101138 GTGTGCAAGCAGAGGCAGGATGG + Intronic
1148767615 17:50048336-50048358 CGGCGCATGCAGAGGTTGGGTGG + Intergenic
1150266923 17:63837930-63837952 CACAGCATGCTGGGGCTGGAAGG - Intronic
1151025502 17:70671834-70671856 CGGTCCATCCAGAGGCTCGAGGG - Intergenic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1151930383 17:77228282-77228304 CAGTGTGGGAAGAGGCTGGACGG + Intergenic
1152241868 17:79165154-79165176 CTGTGCAGGAAGATGCTGGAGGG - Intronic
1152275692 17:79355470-79355492 CAGGACCTGGAGAGGCTGGAGGG - Intronic
1156493161 18:37508332-37508354 GAGAGCGTGCAGAGGCAGGAGGG + Intronic
1157489073 18:48109690-48109712 CAGGGCCTGCAGAGGAGGGAGGG + Intronic
1157521844 18:48350892-48350914 TAGTGCATCCACAGACTGGAAGG - Intronic
1158996436 18:62925233-62925255 ATGTGCATGCAGATGCTAGATGG - Intronic
1161054310 19:2182292-2182314 CAGTGCTTTGAGAGGCTGGGAGG + Intronic
1161228474 19:3159825-3159847 CAGTCCATCCAGAGGGTGAAAGG + Intronic
1161275304 19:3412984-3413006 CAGTGGACACAGGGGCTGGAAGG + Intronic
1161673016 19:5624577-5624599 CACTGCCTGCAGGGGCTGGGGGG - Intronic
1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG + Intronic
1162999214 19:14355704-14355726 CAGCGCATGCAAAGGCTGTGAGG + Intergenic
1165898968 19:39159775-39159797 CAGTCCATGCAGAGGCCTGGTGG + Intronic
1167711234 19:51112479-51112501 CAAGGCATTCTGAGGCTGGAAGG - Intergenic
1202714659 1_KI270714v1_random:35652-35674 CTGTGCATGCAGGGCCTGGCTGG + Intergenic
924960931 2:33849-33871 CCGTGCAGGCAGAGGCAGGAAGG - Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
926081190 2:9987723-9987745 CAATGCAGGGAGAGTCTGGAAGG + Intronic
926575899 2:14580961-14580983 CGGTGGTTACAGAGGCTGGAGGG - Intergenic
926638727 2:15212253-15212275 CTGTTCATGCAGAGGCCAGAGGG + Intronic
927198020 2:20561267-20561289 CACTGCATGCAGAGCCCTGAGGG + Intronic
927720377 2:25378373-25378395 CAGCGCAGGCCGAGGCTGCAGGG + Intronic
928121935 2:28590095-28590117 CAGTGCAGCCGGAGCCTGGAAGG - Intronic
928395937 2:30943373-30943395 CAGTGGATCCAGAGGGTGAAGGG + Intronic
930233373 2:48865307-48865329 CAGTCAAAGGAGAGGCTGGAGGG + Intergenic
930680829 2:54255489-54255511 CCGTGAATGCAGAGGCTGACAGG - Exonic
934053530 2:88231711-88231733 CAGTGGAGGCAGAGGCTGGTGGG + Intergenic
938104411 2:128520348-128520370 CACGCCAAGCAGAGGCTGGAAGG + Intergenic
938138630 2:128779350-128779372 ACATGCATGCGGAGGCTGGATGG - Intergenic
939928303 2:148201223-148201245 CAGTGAATGCAGGGTCTGGCTGG + Intronic
941643956 2:168019631-168019653 CAGTGCCTGCAGTGGGAGGATGG + Intronic
942111349 2:172685391-172685413 CAGAACATGCAGAGCCTTGAAGG - Intergenic
943626824 2:190210620-190210642 CAGAGCATACAGAGCCTTGAAGG - Intronic
944358707 2:198825261-198825283 CAGTGCTTGCATAGGCAGGTGGG - Intergenic
944692222 2:202168687-202168709 CACTGAATGCAGAGGCTGGAAGG - Intronic
944863874 2:203841449-203841471 CAGGGCTTCCAGAGGGTGGAGGG + Intergenic
944948710 2:204721391-204721413 CAGTCGTTTCAGAGGCTGGAGGG + Intronic
945137061 2:206640872-206640894 CAGTACAAGCAAAGGCAGGAAGG - Intergenic
946159903 2:217829764-217829786 CAGGGCTTGAAGAGGCTGGCTGG - Intronic
946608140 2:221428982-221429004 CAGGGCCTGCAAAGACTGGAAGG + Intronic
948180968 2:235979938-235979960 TACTGCATGCAGAGGCAGCAAGG - Intronic
948628173 2:239283493-239283515 CACTGCCGGCAGAGGCTAGAAGG + Intronic
1170292188 20:14782929-14782951 CAGTGCATACACAGGCTGAGGGG + Intronic
1171273596 20:23835583-23835605 CAGTGGATGCAGTGCATGGAGGG + Intergenic
1172101506 20:32486415-32486437 CAATGTCTTCAGAGGCTGGAGGG - Intronic
1173019983 20:39259048-39259070 AAGTGCATGCAGAGGGTGTGGGG - Intergenic
1173576562 20:44116022-44116044 CGGTGCCTGCAGAGCCTCGATGG + Exonic
1173585710 20:44181667-44181689 CAGAGCATGCAAAAGCTGGGAGG - Intronic
1174501107 20:50985376-50985398 CAGTGCATGCAGACAGTGGGAGG - Intergenic
1175451461 20:59072344-59072366 CAATGGAGGCAGAGGCTGGAGGG + Intergenic
1175563522 20:59953859-59953881 CATGGCAGGCAGAAGCTGGAAGG - Intergenic
1175739625 20:61411707-61411729 CAGTGCCTGCTGGGCCTGGATGG + Intronic
1175882711 20:62270127-62270149 CACTGCATGCGCAGGGTGGACGG - Intronic
1175885541 20:62288384-62288406 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885547 20:62288407-62288429 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885565 20:62288475-62288497 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885577 20:62288520-62288542 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885589 20:62288565-62288587 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1176119857 20:63449519-63449541 CAGTGCCTGGAGGGTCTGGAGGG + Intronic
1177762803 21:25420938-25420960 AAATGCATGCACAGGCTGGGAGG + Intergenic
1177844993 21:26279005-26279027 CAGTGAGGGCAGATGCTGGAGGG - Intergenic
1178637078 21:34313412-34313434 GAGAGCCTGGAGAGGCTGGAAGG + Intergenic
1179885727 21:44313532-44313554 CAGTGGATGGAGAGGCAGGCAGG - Intronic
1179993059 21:44958603-44958625 CAGCCCATCCAGAGGCTAGAAGG + Intronic
1180226758 21:46398056-46398078 CAGGAGATTCAGAGGCTGGAGGG + Exonic
1181392429 22:22593464-22593486 CAGGGCAGGGAGGGGCTGGAAGG + Intergenic
1181411050 22:22719983-22720005 CGGTGCAGGAAGGGGCTGGAAGG + Intergenic
1183351249 22:37335991-37336013 CAGTGCAGGGAGGGGCTGCAGGG - Intergenic
1184307563 22:43616769-43616791 CAGTAAAGGCTGAGGCTGGAGGG + Intronic
1184332975 22:43837623-43837645 CAGTGGAAGCAGAGGCTCAAGGG + Intronic
1184702670 22:46187116-46187138 CAGTGCCTAGAGAGGCTGCAAGG - Intronic
1184750196 22:46481417-46481439 CAGTTGAAGCAGAAGCTGGAAGG - Intronic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
949236853 3:1819268-1819290 GAGTACATACAGAGGCTAGATGG - Intergenic
950479505 3:13235776-13235798 CAGTGCCTGCAGAGAGGGGAGGG + Intergenic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
950980123 3:17294642-17294664 CATTGCATGCAGTGACTGGATGG - Intronic
951145012 3:19216271-19216293 CAGTGCTAGCAGAGGCAGGCTGG + Intronic
951183231 3:19682794-19682816 CAGTGGATGCAGCCCCTGGAGGG - Intergenic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
951813073 3:26722791-26722813 CACTGCATTCGGAGCCTGGAGGG + Intergenic
952893272 3:38058808-38058830 CTGTGCATGCAGGGGCTGTATGG + Intronic
953582896 3:44173180-44173202 CAGTGAATGGTGAAGCTGGATGG - Intergenic
953903857 3:46858490-46858512 CCGTGCGTGCAGAGGCATGATGG + Intronic
954278720 3:49560437-49560459 CAGGGCCTGCAGAAGCTGAATGG - Intronic
954873572 3:53785877-53785899 CACAACTTGCAGAGGCTGGAAGG - Intronic
955596916 3:60601031-60601053 CCCTGCCAGCAGAGGCTGGAAGG + Intronic
955777312 3:62447708-62447730 GACTGCCTGCAGAGGCTGGTGGG + Intronic
956319170 3:67976373-67976395 AATTTCATGGAGAGGCTGGAAGG - Intergenic
956728695 3:72177450-72177472 AAGTGGTTGCAGAGCCTGGAGGG + Intergenic
960953338 3:123013725-123013747 GTGTGCTTCCAGAGGCTGGATGG - Intronic
961458981 3:127038339-127038361 GAGTTCATGGAGAGGCTGGTGGG - Intergenic
961633426 3:128317986-128318008 CACTCCAGGCAGAGGCAGGATGG + Intronic
962360133 3:134733643-134733665 CAGTGGAGGCAGAGACTGAAGGG + Intronic
962458020 3:135583108-135583130 CAGTGACAGCAGAGGCTGGGTGG - Intergenic
963716254 3:148807680-148807702 CGGAGGAGGCAGAGGCTGGAAGG + Intronic
964122172 3:153196329-153196351 CAGAGCACACAGAGGCTGGCAGG + Intergenic
964982569 3:162703369-162703391 CAGTGCAGGGGCAGGCTGGAGGG + Intergenic
965105761 3:164350368-164350390 CAGCGCATGAAGAGGCTAGGCGG - Intergenic
966592828 3:181700555-181700577 CAGAGCATGGCGAAGCTGGAAGG + Intergenic
968076853 3:195820693-195820715 CGATGGAGGCAGAGGCTGGAGGG - Intergenic
968607747 4:1543471-1543493 AGGTGCTTGCAGGGGCTGGAGGG + Intergenic
969112212 4:4851191-4851213 CACCTCATGCAGAGGCTAGAAGG + Intergenic
969724234 4:8910051-8910073 GAGTGCAGACAGAGGCTGGTGGG - Intergenic
975395541 4:73869698-73869720 CAGTGCTTGCAGACCCTGCAGGG + Exonic
975401449 4:73944084-73944106 CAGTGCTTGCAGACCCTGCAGGG - Intergenic
975409948 4:74038362-74038384 CAGTGCTTGCAGACACTGCAGGG - Exonic
975415333 4:74098871-74098893 CAGTGCTTGCAGACCCTGCAGGG - Exonic
976362977 4:84202453-84202475 CAGTGCATGCAGCCCATGGAGGG + Intergenic
976475946 4:85483100-85483122 CAATGCATGAAAAGACTGGAGGG + Intronic
978679566 4:111363199-111363221 CAGTCCCTGCAAAGGCAGGAAGG - Intergenic
979724312 4:123942379-123942401 CAGTGCTGGCAGAGGGTGGGAGG - Intergenic
981233210 4:142383767-142383789 CAGTGGTTGCACAGGCAGGAGGG + Intronic
982217125 4:153092075-153092097 CCGTGGAGGCAGAGACTGGAGGG - Intergenic
982594059 4:157354966-157354988 CTGTGCATGCAGTGGCTCCAGGG + Intronic
984545457 4:181096189-181096211 CAGTGTCTACAGTGGCTGGAGGG + Intergenic
984833763 4:184000159-184000181 CAGTAGAAGCAGAGGCTGGGAGG - Intronic
985679365 5:1247912-1247934 AAGTGATTGCAGAGCCTGGAGGG + Intergenic
985836130 5:2273184-2273206 CACCGCATGCAGAGGGTGGAGGG - Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
986197302 5:5549752-5549774 CAGGGCCTGCAGGGGCTGCAGGG + Intergenic
986253326 5:6081275-6081297 CAGAGAATGGAGAGGCTGGGAGG - Intergenic
986269318 5:6217492-6217514 CAGTGCATACAGCGGGTGCATGG - Intergenic
986269494 5:6218488-6218510 CCATGCATCCAGAGGCTGGGAGG - Intergenic
987071142 5:14338146-14338168 AAGAGCTAGCAGAGGCTGGAGGG - Intronic
988149228 5:27354280-27354302 CAGTGGCTGCTGAGGCTAGAAGG + Intergenic
988535897 5:32068089-32068111 CAGTGCATTCAGAGGCACTAAGG - Intronic
994926555 5:106123145-106123167 CAGTGCATGCAGGGCCTTTAGGG + Intergenic
996090555 5:119347196-119347218 AAGTCCATGCAGAGACTAGAGGG + Intronic
996676964 5:126187331-126187353 TAGTGGTTCCAGAGGCTGGAGGG + Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997977654 5:138449735-138449757 GAGAGCTGGCAGAGGCTGGATGG - Intergenic
998846020 5:146310791-146310813 CAGTGAATCCAAGGGCTGGATGG + Intronic
999806009 5:155081945-155081967 CAGAGCAGCCAGAGGCTGCATGG + Intergenic
1001934226 5:175693235-175693257 CAGAGCATTCAGAGGGTGGAAGG + Intergenic
1002099328 5:176849654-176849676 CAGTGCCTTCAGGGGCTGGGTGG - Intronic
1002470580 5:179432890-179432912 CAGTCCCAGCAGAGGCTGGAGGG - Intergenic
1003922448 6:10846086-10846108 CAGGGCAGGTAGATGCTGGACGG - Intronic
1004902140 6:20204675-20204697 GTGTGTGTGCAGAGGCTGGAGGG + Intronic
1006409600 6:33864960-33864982 CATTGCATGGTGTGGCTGGAGGG - Intergenic
1006498240 6:34439810-34439832 CAGGGCTGGCAGAGGCTGGGGGG - Intergenic
1007074280 6:39056908-39056930 CAGTCCATGCACAGGCTGGGAGG - Intronic
1007384840 6:41513502-41513524 TAGGGCAGGCTGAGGCTGGAGGG - Intergenic
1007731713 6:43951491-43951513 CAGTGCAGCCAGAGACAGGAGGG + Intergenic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1010294811 6:74183224-74183246 CAGTGCCTGGAGTGGCTGGCCGG + Intergenic
1015530786 6:134219383-134219405 CAATGCCTGCAGAGCCAGGAGGG - Intronic
1015925980 6:138311081-138311103 CAGTACTTTCAGTGGCTGGATGG - Intronic
1016708474 6:147141875-147141897 CAGAGCATGCAGAGGAAAGATGG - Intergenic
1016792553 6:148080540-148080562 CAGTGCATGCTGAGGATTGGGGG + Intergenic
1017747743 6:157461794-157461816 CAGTGCACCCAGCGGCTGGATGG - Intronic
1018346021 6:162899962-162899984 CTGTGCATGCAGAGGATGAGGGG + Intronic
1018926027 6:168207614-168207636 CAGAGCATCAGGAGGCTGGAAGG + Intergenic
1018971999 6:168536387-168536409 CAGTGCCTTCAGAGGCTGACAGG + Intronic
1019100821 6:169627824-169627846 CAGCCCATGCAGAGGGAGGAGGG + Intronic
1019144953 6:169970559-169970581 CTGTGCCTGCAGAGGCAGGAGGG + Intergenic
1019293126 7:260061-260083 CAGTGAATTCAGAGGCAGGACGG + Exonic
1019980711 7:4619941-4619963 CAGAGAATGCAGAGGATGGCGGG + Intergenic
1020111549 7:5450840-5450862 CAGAGCCTGCAGAATCTGGAAGG - Intronic
1022953960 7:35364410-35364432 GAGTCCAGGCAGAGGGTGGAAGG - Intergenic
1023868325 7:44249426-44249448 CAGTGCATGAAGGAGCTGGCTGG - Intronic
1024117473 7:46207531-46207553 CATCGCATGCTGAGGGTGGAAGG - Intergenic
1024317586 7:48035714-48035736 CAGTGCGCGCCGGGGCTGGAGGG + Intronic
1025029647 7:55546827-55546849 CAGGCCATGCAGAGCCTGGGAGG + Intronic
1026279879 7:68912730-68912752 CAGCGCATGCAAAGGCCTGATGG + Intergenic
1026501840 7:70949200-70949222 CATTGCAAGCAGGGGGTGGAGGG - Intergenic
1026979680 7:74519087-74519109 CAGGCAATGCAGAGGCAGGAAGG + Intronic
1027994944 7:85413931-85413953 CAGGGCAGGCAGAATCTGGAGGG - Intergenic
1028144215 7:87304187-87304209 CAGTGGTTGCAGAGCATGGAGGG + Intergenic
1028577024 7:92363475-92363497 CAGGGCATGCAGAGGCTAGAGGG + Intronic
1029372026 7:100156381-100156403 CAGAGCATGCACAGGCTGGTAGG - Exonic
1030749210 7:113209731-113209753 CAATGCATCCTGTGGCTGGAGGG - Intergenic
1033478915 7:141719168-141719190 AAGTGCATTAAGAGGCTGGATGG + Exonic
1033573438 7:142656717-142656739 CATGGCATGAAGAGGCAGGATGG - Intergenic
1033607952 7:142941256-142941278 CAGAGCTGGCAGCGGCTGGAGGG + Exonic
1034325066 7:150222256-150222278 CTGTGGATGCAGATGCTGGTTGG + Intergenic
1034449095 7:151127959-151127981 CGCTGAACGCAGAGGCTGGATGG - Intronic
1034449741 7:151130886-151130908 AAGAGCATGCTCAGGCTGGAAGG - Intronic
1035277168 7:157754528-157754550 CAGTGGGTGCAGAGAATGGAAGG - Intronic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1035777015 8:2196084-2196106 CCGGCCATGCAGAGGCTGGCGGG - Intergenic
1036213833 8:6863366-6863388 CAGGGAGTGGAGAGGCTGGAGGG + Intergenic
1036289416 8:7474107-7474129 CAGTGGAGGCACAGCCTGGAAGG + Intronic
1037521782 8:19686794-19686816 CAGGGCAGTCAGAGGATGGATGG - Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038309857 8:26438025-26438047 AAGTGAAAGCAGGGGCTGGAAGG + Intronic
1041190546 8:55349473-55349495 CAGAGGATGCAGAAGCTGGAGGG - Intronic
1041765139 8:61411407-61411429 CAGTGGAGACAGAGGCTGGGTGG + Intronic
1042892170 8:73624682-73624704 CAGTTCATTCAGAGGCAGCATGG - Intronic
1043006247 8:74822417-74822439 AAGTGCAGGAAGTGGCTGGATGG - Intronic
1043737830 8:83769190-83769212 CAGAGCCTGCAGGGGCTAGAGGG + Intergenic
1043855735 8:85262772-85262794 GAGTGCAGGTAGAGGCTGGCTGG + Intronic
1044214519 8:89593229-89593251 TAGTGCATGCAAGGGCTGTATGG - Intergenic
1044302115 8:90596740-90596762 CACTGCAGGCTGAGGATGGAAGG + Intergenic
1045331394 8:101158643-101158665 CTGTGTATGCAGATGATGGATGG + Intergenic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048164787 8:132053038-132053060 CAGTACAAGCAAAGGCAGGATGG - Intronic
1048517547 8:135124494-135124516 CAGTGTATGCAAAAGCTGGAAGG + Intergenic
1048926140 8:139273365-139273387 CAGTGTTTGCATGGGCTGGAAGG - Intergenic
1049225061 8:141446477-141446499 CAGAGCCTGCAGAGACAGGATGG + Intergenic
1049808505 8:144552345-144552367 CTGTCCCTGCAGAGCCTGGACGG + Intronic
1056183363 9:84107308-84107330 CAGTGCATGCAGTGCCATGACGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1058677172 9:107410200-107410222 CAGTCCAGGGAGAGGCTGGCTGG + Intergenic
1060233126 9:121840342-121840364 CGATGGATGCACAGGCTGGAGGG + Intronic
1060349485 9:122845816-122845838 TAGTGAATGAAGAGGCTTGATGG - Exonic
1060804321 9:126564989-126565011 CAGTGCAGGTAGAGGTGGGAGGG - Intergenic
1060876640 9:127088830-127088852 CAGTTCATCCTGAGGCTGGGAGG - Exonic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1062093435 9:134690476-134690498 CAGCCCAGGCAGATGCTGGAAGG - Intronic
1062185127 9:135214156-135214178 CAGGGCATGCTGAGGCTGCTGGG + Intergenic
1062260283 9:135658912-135658934 CAGCGCAGGCATAGGCTGGGCGG + Intergenic
1062345030 9:136110624-136110646 GAGGGCAGGCAGTGGCTGGAAGG - Intergenic
1062384251 9:136302812-136302834 CTGAGCATTCAGGGGCTGGAGGG + Exonic
1062447275 9:136600225-136600247 CAGAGCAGACAGAGGCTGGGAGG - Intergenic
1062697038 9:137880794-137880816 CAGAGCAGGCCGAGGCTGGGTGG + Intronic
1203759685 EBV:5700-5722 CAGTGTATGCATAGTCTGGAAGG - Intergenic
1185462335 X:339210-339232 CCGTGCAGGCAGAGGCCAGAGGG + Intronic
1186475977 X:9857982-9858004 CAGCGCTCGCAGAGGCTGGGAGG - Intronic
1187267237 X:17746797-17746819 CAGTGCATGGGGAGGCAGGCTGG - Intronic
1188861298 X:35259725-35259747 CAGTGCAGGAAGAGGCTGGTAGG - Intergenic
1191695485 X:63985708-63985730 CAGTGCACTCAGAGCCTTGATGG + Intergenic
1193029246 X:76880127-76880149 CAGTGGATGCAGACCATGGAGGG + Intergenic
1193593545 X:83419394-83419416 CATTGCAGGCAGAGCCTTGACGG + Intergenic
1193736197 X:85159715-85159737 AACTGCATGCAGTTGCTGGAGGG + Intergenic
1196873468 X:120135565-120135587 CACACCATGCAGGGGCTGGAAGG - Intergenic
1198646447 X:138812080-138812102 TAGTGCTTGCAGGGGCTGGGAGG - Intronic
1199594168 X:149493568-149493590 GAGTGGATGGAGAGGCTGCAGGG + Intronic
1200098256 X:153674103-153674125 CGGTGAAGGCAGAGACTGGAAGG - Exonic
1201928564 Y:19316727-19316749 CAGTCCATCCAGAAGCTGCACGG + Intergenic