ID: 1162500834

View in Genome Browser
Species Human (GRCh38)
Location 19:11052734-11052756
Sequence CTGTCTGCAGGGCTGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1257
Summary {0: 1, 1: 0, 2: 7, 3: 106, 4: 1143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162500834_1162500846 3 Left 1162500834 19:11052734-11052756 CCCTCCCCCAGCCCTGCAGACAG 0: 1
1: 0
2: 7
3: 106
4: 1143
Right 1162500846 19:11052760-11052782 CCATGGGCCTCCCTGCACTCAGG 0: 1
1: 0
2: 1
3: 39
4: 263
1162500834_1162500850 24 Left 1162500834 19:11052734-11052756 CCCTCCCCCAGCCCTGCAGACAG 0: 1
1: 0
2: 7
3: 106
4: 1143
Right 1162500850 19:11052781-11052803 GGACCGACTGCACCTGCCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 179
1162500834_1162500852 30 Left 1162500834 19:11052734-11052756 CCCTCCCCCAGCCCTGCAGACAG 0: 1
1: 0
2: 7
3: 106
4: 1143
Right 1162500852 19:11052787-11052809 ACTGCACCTGCCTGCGGCGTAGG 0: 1
1: 0
2: 0
3: 3
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162500834 Original CRISPR CTGTCTGCAGGGCTGGGGGA GGG (reversed) Intronic
900105568 1:979439-979461 CTGTCTGGGGGGCTGAGGGCCGG + Exonic
900279540 1:1857493-1857515 CTGTCTGCAGGCCAGGTGGCTGG + Intronic
900477132 1:2881361-2881383 CTGTCTAGAGGGGTGGGGGCAGG + Intergenic
900569404 1:3351006-3351028 CTGTCTGCAGAGCTGCTGGTTGG + Intronic
900593837 1:3471572-3471594 CTGGGGGCAGAGCTGGGGGAGGG - Intronic
900871496 1:5307266-5307288 CTGCCTGCAGGGCTGGGACGAGG - Intergenic
901121718 1:6900201-6900223 CAGTCTGCAGTGCTGGTGGCAGG - Intronic
901330831 1:8407069-8407091 CTGTCTGCAGTGTTTGGGGCAGG + Intronic
901424074 1:9170004-9170026 CTGTCTGCTGGGCTAGGTGCTGG - Intergenic
901451242 1:9338144-9338166 ATGTCTCCAGGTCTGGGGGGAGG - Intronic
901473175 1:9471857-9471879 GTGGTTGCAGGGCAGGGGGACGG + Intergenic
902373265 1:16018163-16018185 CTGTCAGCAGGGCCGGCGCACGG - Exonic
902388811 1:16091029-16091051 CTGCCTGCTGGGCTGGCAGATGG + Intergenic
902481736 1:16715665-16715687 CTGGCTGCAGGGCGTGGGGGCGG - Intergenic
902725708 1:18334755-18334777 CTGTGTGCTGGGCTGGGAGGAGG - Intronic
902780006 1:18698926-18698948 GTGTCTGCTGAGATGGGGGAGGG - Intronic
902837798 1:19058140-19058162 CTGTCTGGAGACCTGAGGGAAGG + Intergenic
902968631 1:20030597-20030619 ATGGGTGCCGGGCTGGGGGATGG + Intronic
903179383 1:21597716-21597738 CTGTCTGCAGGGCTGTTAGCCGG - Exonic
903213411 1:21830764-21830786 TGGTCAGCAGGGCTGGAGGAGGG + Intronic
903262102 1:22136909-22136931 CTGTCTCCAGCCCTTGGGGAAGG + Intronic
903661014 1:24978688-24978710 CGGTCTGGAGGGCTGGGGCTGGG - Intergenic
903953554 1:27010423-27010445 ATGTGTGCAGGGATGGGGGCGGG - Intronic
903968876 1:27106328-27106350 GTGGCTGGAGGGCTGGGGGCAGG + Intronic
903974666 1:27141679-27141701 CTGCCTGCCTGGCTGGTGGAAGG - Intronic
904043738 1:27598511-27598533 CTGTCAGCTGGGCTGGAGGGGGG + Intronic
904318133 1:29679363-29679385 ATGAGTGTAGGGCTGGGGGAAGG + Intergenic
904355269 1:29934501-29934523 CTGTGGGCAGGGCTGGGAGGAGG + Intergenic
904615325 1:31746428-31746450 AAGGCTCCAGGGCTGGGGGAGGG - Intronic
904720251 1:32502135-32502157 CTGATTCCAGGGCTGGGGCAGGG - Intronic
904746878 1:32716791-32716813 CTCTCTCCAGAGCTGGGGGAGGG - Intergenic
904973372 1:34436346-34436368 CTTCCTCCAGGGCTGTGGGAGGG - Intergenic
905647037 1:39632271-39632293 CAGTGTGCCGGGGTGGGGGAGGG - Intronic
905693748 1:39960435-39960457 CAGTCTTCAGGGCCGGGGGCAGG + Intronic
906103028 1:43275200-43275222 GTGTGTGCATGGCAGGGGGAAGG - Intergenic
906324972 1:44839820-44839842 GAGTCTGCAGGGCTGGGGGTAGG + Intronic
906376326 1:45299629-45299651 CTGTGATCAGGGCTTGGGGAAGG - Intronic
906753651 1:48288779-48288801 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
907003985 1:50892065-50892087 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
907314487 1:53559703-53559725 CTGGCTGCAGGGCTGAGGCCAGG - Intronic
907335214 1:53695125-53695147 CTGTCAGCTGGGGTGGGGGTGGG + Intronic
907353699 1:53854532-53854554 TTGGCTGCAGGGCTGAGGCAAGG - Intronic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
907780744 1:57563723-57563745 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
908020759 1:59896089-59896111 CTGATTCCAGGGCTGGGGAAGGG - Intronic
908097246 1:60751927-60751949 GTGTCTGCAGGGGGAGGGGATGG - Intergenic
908913730 1:69102237-69102259 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
909700856 1:78521077-78521099 GTGTCTATAGAGCTGGGGGATGG - Intronic
909812175 1:79943980-79944002 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
910849013 1:91632814-91632836 CTCTCTGCAAGGCTGGGTGATGG + Intergenic
911560435 1:99399504-99399526 CTGATTGCAGGGCTGAGGCAAGG + Intergenic
911676910 1:100668686-100668708 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
912153886 1:106892066-106892088 CTGTCAGCAGGGTAGGGGAAGGG + Intergenic
912625739 1:111203824-111203846 CTATCTGCTGGGCAGGGGCAGGG + Intronic
912673074 1:111649363-111649385 CTGGCTGCAGGGATGGCCGAGGG - Intronic
913040686 1:115019751-115019773 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
913094167 1:115500607-115500629 TTGTTGTCAGGGCTGGGGGAAGG + Intergenic
913219918 1:116651039-116651061 CTGTCTGAAGGGTTGTGGGCTGG - Intronic
913656597 1:120966336-120966358 CTGCCTGCAGGGCAGGAGGCAGG - Intergenic
914007734 1:143747592-143747614 CTGCCTGCAGGGCAGGAGGCAGG - Intergenic
914646560 1:149658073-149658095 CTGCCTGCAGGGCAGGAGGCAGG - Intergenic
914651959 1:149704270-149704292 CTATCTCCAGTGCTTGGGGAGGG - Exonic
915243643 1:154541475-154541497 CTGGATGCAGGGCAGTGGGAAGG + Intronic
915556803 1:156665244-156665266 CTGATTGGAGGGGTGGGGGAGGG + Intergenic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
915886802 1:159730859-159730881 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
915945093 1:160143958-160143980 CTATCTGATGGGATGGGGGAAGG + Intergenic
916084546 1:161259006-161259028 CTGTCGGCAGGGCTGCGGCGGGG + Intronic
916351440 1:163854104-163854126 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
916580251 1:166100626-166100648 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
916905574 1:169279400-169279422 TTGGCAGCAAGGCTGGGGGAGGG - Intronic
917018753 1:170563192-170563214 CTAGCTGCCGGGATGGGGGAGGG + Intergenic
917301780 1:173582414-173582436 ATGTCTCCTGGGCTGGGGGCAGG - Intronic
917391800 1:174545312-174545334 GTGTCAGCAAGGCTGAGGGAGGG - Intronic
917465005 1:175268279-175268301 CTGTGTGTAGGGGTGGGGGGAGG + Intergenic
917591295 1:176479783-176479805 CTGACTGCAGTGCTTGGAGAAGG - Intronic
917854198 1:179088108-179088130 TAGTCAGGAGGGCTGGGGGAGGG + Intronic
917930460 1:179819045-179819067 CTGTGTGCTGGGCTGGAGGATGG - Intergenic
918026635 1:180755932-180755954 CTGATTCCAGGGCTGGGAGAGGG + Intronic
918038757 1:180899415-180899437 CTGTCTGCAGTGTCGGGGGTGGG - Intergenic
918043200 1:180925746-180925768 GTGGCTGGAGGGGTGGGGGAAGG + Intronic
918133180 1:181646645-181646667 CTGTCTCTGGGGCTGGGGGCTGG + Intronic
918224725 1:182471208-182471230 CAGTGTGCAAGGCTGGGAGAGGG + Intronic
918408543 1:184234962-184234984 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
919332863 1:196193290-196193312 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
919754138 1:201056229-201056251 CTGTCTGATGTGCTAGGGGAGGG - Intronic
919927160 1:202197986-202198008 CTGCCACCAGGGCTGAGGGAGGG + Intronic
919975391 1:202607570-202607592 CAGTCTCCAGGGCTGGGGAGGGG - Intronic
920270779 1:204762148-204762170 CTGTCTGCTGTCCTGGGTGAAGG - Intergenic
920366323 1:205450080-205450102 CCGTCCTCAGGGCTGGGGGAGGG - Intronic
920415516 1:205796879-205796901 CAGAGGGCAGGGCTGGGGGAAGG - Intronic
920534963 1:206731428-206731450 CTGTGTGGAGGGCTGGAGGCAGG + Intronic
920995627 1:210987990-210988012 GTGTCAGCGAGGCTGGGGGAGGG - Intronic
921187583 1:212683550-212683572 CTGCCTGCTGGGCTGAAGGAAGG - Intergenic
921258146 1:213361264-213361286 GCGTCAGCAAGGCTGGGGGAGGG - Intergenic
921986184 1:221315521-221315543 CTGTGTCCATAGCTGGGGGAAGG + Intergenic
922561250 1:226571192-226571214 CTGTCTCCCAGGCTGGAGGACGG - Intronic
922601155 1:226854905-226854927 GGGTTTGGAGGGCTGGGGGAGGG + Intergenic
922606156 1:226891209-226891231 CTGCCTGCAGGGCCTGGGGGAGG - Intronic
922798233 1:228352014-228352036 GTGTCTGCAGGGCCGGGGCAAGG + Intronic
922815156 1:228443522-228443544 GTGTCAGCAGGGCTGGGGTCTGG - Intergenic
922976615 1:229789845-229789867 CTGTTTGCAGGGCAGGAGGAGGG + Intergenic
923047491 1:230366297-230366319 CTGTCTGTAGGGATGAGAGATGG + Intronic
923548164 1:234939990-234940012 CTGCCGCCAGGGCTGGTGGATGG - Intergenic
923903074 1:238350550-238350572 CTGACTGAAGGGATTGGGGAAGG - Intergenic
924197610 1:241624327-241624349 CAGTCTGCATGGCTGGAGCATGG - Intronic
924667337 1:246086875-246086897 CTGTCGGAAGGGCGAGGGGAGGG - Intronic
924935163 1:248762054-248762076 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
924948411 1:248861428-248861450 CTGGGTGGTGGGCTGGGGGATGG - Intergenic
1062830771 10:604018-604040 CTGAGGGCAGGGCTGGGGGGTGG - Intronic
1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG + Intergenic
1063325282 10:5094345-5094367 CAGTTTGCAGGGGTGGGGGGAGG + Exonic
1063382451 10:5594344-5594366 CTGTCTGCAAGGCAGAGGGAGGG - Intergenic
1064525383 10:16250386-16250408 ATGTGTGTCGGGCTGGGGGAAGG - Intergenic
1064541083 10:16405923-16405945 CTGTTCCCAGGGCAGGGGGAGGG + Intergenic
1064694889 10:17955187-17955209 CCATTTTCAGGGCTGGGGGAAGG + Intronic
1065617331 10:27541829-27541851 TTGTTTGCAGGGGTGGGGGTGGG - Exonic
1065624335 10:27615069-27615091 CTGAATGCAGCCCTGGGGGATGG - Intergenic
1065923192 10:30411475-30411497 CTGCAGTCAGGGCTGGGGGAAGG - Intergenic
1066182637 10:32978433-32978455 TTGGGTGGAGGGCTGGGGGAGGG - Intronic
1067343016 10:45419504-45419526 TGGCCTGCGGGGCTGGGGGAGGG - Intronic
1067441397 10:46310953-46310975 AGGACTGCAGGGCTGAGGGATGG + Intronic
1067497856 10:46775200-46775222 CCGGCCGCAGGGCTGGGGGGAGG + Intergenic
1067509254 10:46881740-46881762 CTCTGGGCAGGGCTGGGGGGAGG + Intergenic
1067596794 10:47565214-47565236 CCGGCCGCAGGGCTGGGGGGAGG - Intergenic
1067652998 10:48170115-48170137 CTCTGGGCAGGGCTGGGGGGAGG - Intronic
1067686746 10:48470391-48470413 CCATCAGCAGGGGTGGGGGAGGG + Intronic
1067698435 10:48551963-48551985 CTGGCTGAAAGGCTGGGGGTGGG + Intronic
1069184079 10:65400478-65400500 GTGTCTGGAGTGGTGGGGGAAGG - Intergenic
1069275504 10:66586669-66586691 CTCTCTGCAGTGTTGGGTGAGGG + Intronic
1069349565 10:67509332-67509354 GTGGGTGGAGGGCTGGGGGAGGG - Intronic
1069361164 10:67643309-67643331 CTGTCAGCAGGGGTGGGAGGAGG + Intronic
1069851703 10:71409541-71409563 CTGACTGCTGGCCTGGGGGTGGG + Intronic
1069994508 10:72334303-72334325 CAGTGGGAAGGGCTGGGGGAGGG - Exonic
1070720371 10:78752843-78752865 GTGTCTGCAGGACTGGGGGGAGG - Intergenic
1071051694 10:81458461-81458483 CTGTCTACAGAGCTAAGGGAAGG + Intergenic
1071323756 10:84491447-84491469 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1072288852 10:93943642-93943664 CTGCCAGCAGGCCTGGGTGAGGG + Intronic
1072373834 10:94794067-94794089 GTGGCAGCAAGGCTGGGGGATGG - Intronic
1072377248 10:94830242-94830264 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1072399197 10:95079634-95079656 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1072486830 10:95863852-95863874 CTATCTGAAGGGCTGAGGAATGG + Intronic
1072635561 10:97175715-97175737 CTGGCTGCAGGGCTGTGGTTTGG - Intronic
1072715235 10:97747730-97747752 CTGATTCCAGGGCTGGGGCAGGG - Intronic
1072759252 10:98042327-98042349 CAGTGAGCAGGACTGGGGGATGG - Intergenic
1073152405 10:101321092-101321114 CTGACTGAGGGGCTGGGAGAAGG + Intergenic
1073215548 10:101834167-101834189 CTGTCTTCATGACTGGGGCAGGG - Intronic
1073347663 10:102796442-102796464 CTGTCTACAGGGCTAGAGGCTGG - Intronic
1073403720 10:103278472-103278494 TTGTTTGAAGGGCTGGGGCAGGG - Intronic
1073460306 10:103662009-103662031 CTGGAAGCAGGGCTGGGGGCAGG - Intronic
1073588659 10:104735176-104735198 CTGTCGGCTGGGCAGGGGGCCGG + Intronic
1073661460 10:105480738-105480760 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1074473085 10:113744814-113744836 CTGTCTGCAGAGGTGGAGGCAGG - Intergenic
1074528798 10:114282674-114282696 CTGGCTCCAGGGCAGAGGGATGG + Intronic
1074611391 10:115025442-115025464 CTGGCTGCAGGGGTGGGGGTTGG - Intergenic
1074820736 10:117176302-117176324 CTGTCTTGAGGGCAGGGGAAAGG - Intergenic
1075184133 10:120239890-120239912 CCGGCAGCAAGGCTGGGGGAGGG - Intergenic
1075205646 10:120445488-120445510 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1075407722 10:122205673-122205695 CCTTCTGCAGGGCTGGGGTGGGG - Intronic
1075541308 10:123316791-123316813 CTGTCTTCTGGGCTGTTGGAGGG - Intergenic
1075656597 10:124165816-124165838 CTGTCTGCAAGCCGGGAGGAGGG + Intergenic
1075664440 10:124220700-124220722 CTGGGTGCAGGGCTGGCAGAGGG - Intergenic
1075689671 10:124386714-124386736 ATGTCTGGAGGCCTGGGGTAAGG - Intergenic
1076112742 10:127873339-127873361 CTGTTTGCAGGGTTTGGGGCAGG + Intergenic
1076156187 10:128207417-128207439 CTATCTGCAGGGCAGAGGGTAGG - Intergenic
1076310005 10:129498734-129498756 CTGAATCCAGGGCTGGGGCAGGG - Intronic
1076597688 10:131635915-131635937 CTTTCTGGAGGGCTGGGGCATGG + Intergenic
1076616556 10:131759052-131759074 GAGTCTCCAGGGCTGGGGGAGGG - Intergenic
1076870348 10:133189832-133189854 CTGGGGGCAGGGCTGGGGCAGGG - Intronic
1076896658 10:133316571-133316593 CTGTGTCCAGGTCGGGGGGAGGG - Intronic
1077020990 11:417119-417141 CCCTTTCCAGGGCTGGGGGAAGG - Intronic
1077046683 11:549812-549834 CTGTCTTCAGGGGTAGGGGCAGG - Intronic
1077155293 11:1088397-1088419 CAGGCTGCAGGGCTCGGGGTTGG - Intergenic
1077194031 11:1270452-1270474 CTGCATCCAGGGCTGGGGCATGG - Intergenic
1077236945 11:1486417-1486439 CTGCCAGCCTGGCTGGGGGAGGG - Intronic
1077284400 11:1759313-1759335 CTCTCAGCAGGGCTGGGGCTGGG - Intronic
1077358083 11:2127790-2127812 GGGACTGCAGGGCTGGGGGAGGG + Intergenic
1077384330 11:2261885-2261907 CAGGCTGCAGGGCTGTCGGAGGG - Intergenic
1077423059 11:2461937-2461959 CTGTCTGCTGTCCTGGGGGAAGG + Intronic
1077478239 11:2801048-2801070 GTGGGTGCAGGGCTGGGGCAGGG + Intronic
1077591848 11:3498610-3498632 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1077880577 11:6346492-6346514 CTGTGGGCGGGGTTGGGGGATGG - Intergenic
1077915897 11:6611474-6611496 CTGTCAGCAGAGCGGGAGGAGGG + Intronic
1078016198 11:7617245-7617267 CTGGCTGCAGGGCTGGGGCTCGG - Intronic
1078121662 11:8516766-8516788 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
1078430088 11:11281769-11281791 CTGCCTGAAGGGATGTGGGAAGG + Intronic
1078559901 11:12362375-12362397 CTGTTTTCAAGGCTGGGGAAGGG + Intergenic
1078826785 11:14937546-14937568 CTGACTGTAGAGATGGGGGAGGG - Intronic
1079138593 11:17792410-17792432 CCGTCAGCAGGGATGGGGGTGGG + Intronic
1079408902 11:20168245-20168267 CTGTTTGTGGGGCTTGGGGATGG - Intergenic
1079410521 11:20183122-20183144 CCCTCTGCAGGGCTGGCTGATGG + Intergenic
1080437215 11:32256140-32256162 CTGTCTGCAGAGCTGGCAGATGG + Intergenic
1080443184 11:32313865-32313887 CTTACTGCAGGGATGGGTGATGG - Intergenic
1080639195 11:34148929-34148951 CATTCTGCAGGCCTGGAGGAGGG + Intergenic
1080695673 11:34601085-34601107 TTGTCTTCAGGGCTGAGGCATGG - Intergenic
1080818181 11:35779149-35779171 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1081454400 11:43206940-43206962 CTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1081609978 11:44556069-44556091 CTGGCTGCAGGGCCAGGTGAGGG - Intergenic
1082175247 11:49050260-49050282 GTTTCCGCCGGGCTGGGGGAGGG - Intergenic
1082221765 11:49647293-49647315 CTGACTCCAGGGCTGAGGCAGGG - Intergenic
1082602321 11:55173250-55173272 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1082771427 11:57210796-57210818 CTGTCTGCACCGTTGGAGGATGG - Intergenic
1082785259 11:57313177-57313199 CTGGCTTCAGTGATGGGGGAGGG + Exonic
1082785858 11:57316219-57316241 CAGCCTCCAGGACTGGGGGAGGG - Intronic
1083203799 11:61135362-61135384 TTGTCTGGAGGGCTCAGGGAGGG - Intronic
1083513718 11:63236350-63236372 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1083524542 11:63349998-63350020 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1083583229 11:63838750-63838772 CCCTCGGCAGGGCTGTGGGAGGG + Intergenic
1083593912 11:63910063-63910085 CTGACCCCAGGGCTGGGAGAGGG + Exonic
1083618295 11:64036816-64036838 TTGTCTTGAGAGCTGGGGGATGG - Intronic
1083659425 11:64245388-64245410 CTGTCTGCTGGGCAGAGGGCTGG - Intronic
1083738432 11:64694850-64694872 CTGGCTCCTGGGCTGGGGGTGGG - Intronic
1083886726 11:65576674-65576696 CTGCGGTCAGGGCTGGGGGAGGG + Intronic
1083894043 11:65611403-65611425 CTGTCTGCAGGATTGGGGTGGGG - Intronic
1084067936 11:66716043-66716065 CAGTTGGCAGGGGTGGGGGATGG + Intronic
1084153921 11:67303561-67303583 CTGTCCGCGGGGTTGAGGGAAGG + Exonic
1084208543 11:67610330-67610352 CTGACTCCTGGGCTGGGGGTGGG + Intronic
1084461447 11:69298787-69298809 CTGGCTGTAGGGCTGCGGGCCGG - Intronic
1084610989 11:70203016-70203038 CTGTGTGCAGGGCCGGGGCGGGG - Intergenic
1084796782 11:71511459-71511481 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
1084825135 11:71724147-71724169 GTGACAGCAAGGCTGGGGGAGGG + Intergenic
1084971176 11:72772887-72772909 CTGGCAGCATGGTTGGGGGACGG - Intronic
1085064724 11:73483691-73483713 CTGTATGCAGGGCTTGAAGAGGG + Intronic
1085120459 11:73964323-73964345 CTGTCAGCTGAGATGGGGGAGGG - Intronic
1085281690 11:75335159-75335181 CTGTCTGTTGGGCTGGAGGCAGG - Intronic
1085283329 11:75344820-75344842 CTCCCTGCAAGGCTGAGGGAAGG + Intronic
1085404725 11:76255007-76255029 GTGTGTGCAGGGGTGGGGGTGGG + Intergenic
1085728653 11:78977349-78977371 CTTTCTGCAGGGCTGGGTGGTGG + Intronic
1086142844 11:83518228-83518250 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1086420810 11:86635337-86635359 CTGTCTGCAAGCCAGGGAGAGGG + Intronic
1086627267 11:88971866-88971888 CTGACTCCAGGGCTGAGGCAGGG + Intronic
1087938945 11:104070143-104070165 CTGATTCCAGGGCTGGGGCAAGG - Intronic
1089078731 11:115759619-115759641 CTGTGTGGAGGGCTGGGGTTTGG + Intergenic
1089133639 11:116232108-116232130 CTGCTTGAAGGGCTGGGGGAAGG - Intergenic
1089214901 11:116829518-116829540 CTGTGTTCAGGGCTTGGGGCTGG + Intergenic
1089248851 11:117143287-117143309 GGGACTGCGGGGCTGGGGGAGGG + Intergenic
1089254487 11:117187070-117187092 CTGTCTGGAGGGCTCGTGGGCGG + Intronic
1089283724 11:117392384-117392406 CTCTCTCCAGCCCTGGGGGATGG + Intronic
1089319286 11:117613950-117613972 CTGGCTGCTGGGGTGGGGCAGGG + Intronic
1089452927 11:118609838-118609860 CGGTCCGCAGGGCCGAGGGAGGG - Intronic
1089456014 11:118626211-118626233 AAGCCTGCAGGGCTGGGTGAGGG - Intronic
1089666762 11:120025604-120025626 CACTCTACAGGGATGGGGGAAGG + Intergenic
1090225658 11:125070772-125070794 CTGTCACGAGGGGTGGGGGATGG - Intronic
1090265459 11:125350667-125350689 CTGCCTGGAGGCCTTGGGGAAGG - Intronic
1090289281 11:125527899-125527921 GTGTCCCCAGGGCTGGGGCAAGG - Intergenic
1090579106 11:128140470-128140492 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1090752520 11:129759996-129760018 CAGTCTTCAGGGCTGGGAGATGG - Intergenic
1090809305 11:130222628-130222650 CTGGCTGGAGGGGTGAGGGAAGG - Intergenic
1090836159 11:130455612-130455634 CAGGCTGCAGGGTTGGGAGAGGG + Intronic
1091279629 11:134374592-134374614 CTGTTTCAAGGGCTGGGAGAAGG + Exonic
1091386306 12:97968-97990 ATATCTCCATGGCTGGGGGAAGG - Intronic
1091388389 12:109706-109728 AGGTTGGCAGGGCTGGGGGAAGG - Intronic
1091658934 12:2367119-2367141 CTGACTGAAGGGATGGGGGCAGG + Intronic
1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG + Intronic
1091773521 12:3169246-3169268 TTGACCTCAGGGCTGGGGGAAGG + Intronic
1091820248 12:3470681-3470703 CGGTGTCCAGGGCGGGGGGATGG + Intronic
1091826853 12:3519373-3519395 AGGTTGGCAGGGCTGGGGGAAGG + Intronic
1092016913 12:5167231-5167253 CTGTGGGCAAGGGTGGGGGATGG + Intergenic
1092079001 12:5697889-5697911 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
1092760384 12:11805083-11805105 CAGGTTGCTGGGCTGGGGGAGGG + Intronic
1093027461 12:14258053-14258075 CTGTCTGCAATGTTGGGGGAGGG + Intergenic
1093717509 12:22400515-22400537 GTGGCAGCAAGGCTGGGGGATGG + Intronic
1094017090 12:25876594-25876616 CTATCTGGAAGGGTGGGGGAGGG + Intergenic
1095805316 12:46312766-46312788 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1095913935 12:47457506-47457528 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1096033496 12:48442514-48442536 CTGTGTTCAGGGCTGGTGGGGGG - Intergenic
1096148412 12:49294532-49294554 CCGTCTTCAGGGGAGGGGGAGGG + Exonic
1096412024 12:51383910-51383932 CTTTCTCCAAGGCTGGTGGAGGG - Intronic
1096653684 12:53075242-53075264 CAGTCAGCAGGGCTGGGAAATGG + Intronic
1096671524 12:53201400-53201422 CTCTCTGCAGGTCTGGGATAAGG + Intronic
1096847776 12:54417554-54417576 TTGTCTGGAGGACTTGGGGATGG - Intronic
1096962916 12:55598498-55598520 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1097039084 12:56143634-56143656 GTGTCTGCGTGGGTGGGGGATGG + Intronic
1097054328 12:56240774-56240796 CTGTCAGCAGTGCTGGGAGGTGG - Exonic
1097166477 12:57088997-57089019 CTGGCTGCCGGGCTGGCGGGCGG - Exonic
1097185441 12:57194112-57194134 CTGTCAGCGGGGATGAGGGAAGG - Intronic
1097569652 12:61317152-61317174 GTGGCAGCATGGCTGGGGGAGGG + Intergenic
1098586114 12:72156102-72156124 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1098620635 12:72593663-72593685 CTGTCAGCAGGGTGGGAGGAGGG - Intronic
1098844888 12:75523141-75523163 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1099538162 12:83871384-83871406 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1099640069 12:85275459-85275481 ATGTCTGCAGAGCTGTGGGAAGG + Intergenic
1099978358 12:89570199-89570221 CTGTCAGCGGGGCAGGGGGAGGG - Intergenic
1100113386 12:91272627-91272649 CTGCCAACAGGGCTGGGAGATGG + Intergenic
1100238345 12:92683914-92683936 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1100407789 12:94286025-94286047 CTGTCTGCAAGGCAAGGTGAAGG + Intronic
1100652963 12:96610821-96610843 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
1101240408 12:102832769-102832791 CTGGCAGCGAGGCTGGGGGAGGG - Intergenic
1101330949 12:103757558-103757580 CTGTCTGAAGTGATGGGGGAAGG + Intronic
1101337056 12:103806007-103806029 CAGTCTGGAGGACTGGAGGAAGG - Intronic
1101520654 12:105479109-105479131 ATGGGTGCCGGGCTGGGGGACGG + Intergenic
1101581972 12:106049737-106049759 CTGTGTGCCAGGCTGGAGGATGG - Intergenic
1101857731 12:108457875-108457897 CTGCCTTCTGGGCTGGGGGTGGG - Intergenic
1101922880 12:108947175-108947197 CAGACTCCAGGGCTGGGGCAAGG - Intronic
1101970102 12:109307059-109307081 CTGTGTGCAGAGCTGGGGCCAGG - Intronic
1102099828 12:110269838-110269860 CAATCTGCATGGATGGGGGATGG - Intergenic
1102781010 12:115564447-115564469 CTGCCTCCAGGGCTGGGAAACGG + Intergenic
1102852815 12:116266255-116266277 TTGTCTCCAGGGCTGAGTGAAGG + Intronic
1102952958 12:117042282-117042304 CTCCCTGGGGGGCTGGGGGAGGG - Intronic
1103032003 12:117623372-117623394 CGGGGTGCGGGGCTGGGGGAGGG - Intronic
1103070698 12:117939072-117939094 CTGTCAGCAGAGCTAGGGCAAGG + Intronic
1103518857 12:121524577-121524599 ATGTGAGCAGAGCTGGGGGAGGG - Intronic
1103856223 12:123972826-123972848 GTGTCTGCCGGGCTGGGCGGGGG + Intronic
1103884806 12:124192322-124192344 CTGTAGGCTGGGCTGGGGGTGGG + Intronic
1103978634 12:124721044-124721066 CTGACTGCAGAGCAGGGTGATGG - Intergenic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1104748034 12:131221985-131222007 GGTTCAGCAGGGCTGGGGGAAGG + Intergenic
1104884672 12:132099850-132099872 CTGCCTGCATGGCCCGGGGAGGG + Intronic
1104933153 12:132351028-132351050 GGGACTGCAGGGCTTGGGGAGGG + Intergenic
1104963695 12:132499708-132499730 GGGGCTGCAGGGCTGGGGGGTGG + Intronic
1104978443 12:132562324-132562346 GTGGCCGCAAGGCTGGGGGAGGG + Intronic
1105810802 13:23993598-23993620 CTGTGGGAAGGGCTGGGGCATGG - Intronic
1106844656 13:33725578-33725600 CTGAGTGCAGGGTTGGGGAACGG - Intergenic
1107011238 13:35673447-35673469 CTGGCAGGAGGGCTGGGTGAGGG - Intergenic
1107058509 13:36131209-36131231 GGGGCTGCAGGGCTGGGGGGCGG + Exonic
1107096658 13:36544874-36544896 CTGTATGCAGGGTTGGGGAGGGG + Intergenic
1107558565 13:41540453-41540475 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1107797226 13:44065111-44065133 CAGTCTGCAGGCTTGGGGGTTGG + Intergenic
1107834865 13:44404951-44404973 CTGGCTGGGGGGCTGGGGGGAGG + Intergenic
1109299045 13:60571726-60571748 GTGTGTGGAGGGTTGGGGGAAGG - Intronic
1110711699 13:78657838-78657860 CTGCCTGCACGGCTAGGGGGAGG - Intronic
1111507194 13:89207681-89207703 CTGATTCCAGGGCTGGGGCAGGG + Intergenic
1111747515 13:92289285-92289307 CTGTTGGCAGGGGTGGGGGTTGG - Intronic
1111846953 13:93522722-93522744 CTATCTGCAGAGCAGCGGGAAGG - Intronic
1112075349 13:95907187-95907209 CTGGCAGCCTGGCTGGGGGAGGG + Intronic
1112348998 13:98617259-98617281 CTGGCTCTAGGGCTGGGGCAGGG + Intergenic
1113174460 13:107546200-107546222 CTGTCTGCAGAGCAGCAGGATGG - Intronic
1113478201 13:110600395-110600417 CAGTCTGCAGGGCAGGGGCCAGG + Intergenic
1113541992 13:111115865-111115887 TTGTGTGCGGGGCAGGGGGAGGG + Intronic
1113574414 13:111383865-111383887 CTGGCTGTGGGGCTGGGAGAAGG + Intergenic
1113592763 13:111512647-111512669 CTATCGGCTGGGCAGGGGGAGGG - Intergenic
1113608283 13:111625752-111625774 CAGTCTGCAGGGCAGGGGGCAGG - Intronic
1113613636 13:111665557-111665579 CCCTCTGCGGGGCTGGGGAAGGG + Intronic
1113618445 13:111697165-111697187 CCTTCTGCAGGGCTGGGAGGTGG - Intergenic
1114029778 14:18567698-18567720 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1114498105 14:23147914-23147936 CTTTCTGCAGGACTGGCAGAGGG + Intronic
1114600447 14:23951966-23951988 CTGTGTGTGCGGCTGGGGGAGGG - Intergenic
1114669599 14:24402017-24402039 CAGGTTGCAGGACTGGGGGAGGG + Intronic
1115077954 14:29414165-29414187 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1115123127 14:29961078-29961100 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1115415373 14:33126477-33126499 GTGTGTGCAGGGCTGGGGATGGG + Intronic
1115545683 14:34462879-34462901 GTGTGTGCATGGGTGGGGGAAGG - Intergenic
1115746383 14:36442099-36442121 TTGCCTCCAGGGCTGGGGGAGGG + Intergenic
1116618702 14:47172075-47172097 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
1116671836 14:47851961-47851983 CTGTCGGGGGGGTTGGGGGAGGG + Intergenic
1116727231 14:48575966-48575988 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1116984427 14:51204098-51204120 CTGACTGCTGGGCTGGGAGAAGG - Intergenic
1117261009 14:54033409-54033431 GTGGCAGAAGGGCTGGGGGAGGG - Intergenic
1117472992 14:56065360-56065382 CTGTCAGCGGGGCAGGGGGAAGG + Intergenic
1117546572 14:56798323-56798345 CTGACTGCAGGGCTCGGGCGGGG + Intergenic
1117779597 14:59218871-59218893 ATGTGTGGAGGGCCGGGGGAAGG - Intronic
1117797581 14:59409869-59409891 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1117995604 14:61474873-61474895 CTGTCTGCAGTGCTGATGCACGG - Intronic
1118805408 14:69232199-69232221 CTGTCTTTTGGGCTAGGGGAGGG + Intronic
1119482120 14:74964468-74964490 CTGTGTGCAGGGGAGGGGAAGGG + Intergenic
1119985407 14:79131765-79131787 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1120084322 14:80252352-80252374 CTGGCTGCAGGTCCAGGGGAAGG + Intronic
1120140791 14:80927371-80927393 GTGTCTGCAGTGCTGAGTGAGGG - Intronic
1120950413 14:90035835-90035857 CAGGGTGCAGGGCTGGGGGTGGG - Intronic
1121298880 14:92853243-92853265 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1121369485 14:93344015-93344037 CTGTCTCCTGGGGTGGGGGTGGG + Intronic
1121698418 14:95932076-95932098 CTGTCTTCAGTATTGGGGGAGGG - Intergenic
1122016616 14:98802143-98802165 CTCCCTGCAGGGCTCTGGGAGGG - Intergenic
1122153498 14:99737217-99737239 CTGTCTCCAAGGCTGCAGGAAGG - Intergenic
1122202261 14:100129737-100129759 CTCTGTGCAGCGCTGGGGGCGGG - Intronic
1122278115 14:100605539-100605561 GGGTCTGCAGGGCAGGGGGCGGG + Intergenic
1122791276 14:104185177-104185199 CTGTCTGCAGCCCTGGCGGGAGG + Intergenic
1122795881 14:104205980-104206002 GTGTGTGCAGGGCTGGGAGCTGG + Intergenic
1122796935 14:104210710-104210732 CGGGGGGCAGGGCTGGGGGAGGG + Intergenic
1122937641 14:104967341-104967363 AGGTCTGCTGGGCTGGGGGTGGG + Intronic
1123028119 14:105438193-105438215 CTGTGGGCAGGGCTGGTGGCTGG + Intronic
1202834231 14_GL000009v2_random:65833-65855 CTGGCTGTAGGGCCGTGGGAGGG + Intergenic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1123704583 15:22941724-22941746 CTGTGTGCAAAGCTGGGGGAAGG - Intronic
1124001546 15:25764559-25764581 CTGTCTGCAGGCCGGGAAGAGGG + Intronic
1124216890 15:27815059-27815081 CTTCCTGGAGGGCTGTGGGAAGG + Intronic
1124491048 15:30155912-30155934 CAGTCTCCAGGGCTGGGGAGGGG - Intergenic
1124580890 15:30954018-30954040 CTGGCAGCAGGGGTGGGGCAGGG - Intronic
1124692052 15:31831952-31831974 CTGGCGGAAGGGCTGGGGCAGGG + Intronic
1124752489 15:32382419-32382441 CAGTCTCCAGGGCTGGGGAGGGG + Intergenic
1125058578 15:35391549-35391571 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1125183336 15:36902402-36902424 CTGCCTGCAGGGGTGGGAGGTGG + Intronic
1125519546 15:40340277-40340299 CTCCCTGGAGAGCTGGGGGAGGG - Intronic
1125719856 15:41840139-41840161 CTGCCTGCAGAGGTGGGAGAGGG - Exonic
1125727079 15:41873653-41873675 ATGTCTCCAGGGCTGACGGAGGG - Intronic
1125878278 15:43168665-43168687 CTGCCTGGAGAGTTGGGGGATGG + Intronic
1126456602 15:48869246-48869268 CTGTTTTCAGGGCTGACGGATGG + Intronic
1126779079 15:52123321-52123343 CTGGATGCAGGGGTGGGGGAGGG - Intronic
1127279772 15:57479061-57479083 CTTCCTGGAGAGCTGGGGGAAGG - Intronic
1127321826 15:57854459-57854481 CTGATTGCAGGTTTGGGGGAAGG - Intergenic
1127359226 15:58230352-58230374 CTGGCTGGTGGGCTGGGAGAGGG + Intronic
1127632865 15:60842692-60842714 CTGTGTGGAGGGTCGGGGGAGGG - Intronic
1127666694 15:61154673-61154695 CAGAATGCAGGGCTGGGAGAGGG - Intronic
1127739863 15:61892364-61892386 CTGTCTCCAGTGGTGGGGAAGGG - Intronic
1128471927 15:67961730-67961752 CTGTCTTCCATGCTGGGGGATGG + Intergenic
1128542230 15:68544088-68544110 CTGTCTACAGAGCTTGGGGAAGG - Intergenic
1128568259 15:68715283-68715305 CTTTCTGCGGGGCTGGGGAGCGG - Exonic
1128804029 15:70517488-70517510 CCCTGGGCAGGGCTGGGGGAAGG - Intergenic
1128866274 15:71117037-71117059 ATCTCTGCAGGGCTGGAGCAGGG + Intronic
1129162404 15:73753751-73753773 GGGTCGGCAGGGCTGGGGGTTGG + Intergenic
1129191289 15:73939161-73939183 CCCTCTGCAGGGCTTGGGGCTGG - Intronic
1129364701 15:75047177-75047199 CTGTGTGCAGGGCAGGAGCAAGG - Intronic
1129654117 15:77511433-77511455 CTGATTCCAGGGCTGGGGCAGGG + Intergenic
1129685998 15:77686416-77686438 CAGCATGCAGGCCTGGGGGAAGG + Intronic
1130143712 15:81255431-81255453 CTGGCTGCATGGCAGTGGGAAGG + Intronic
1130832603 15:87616744-87616766 CTGTCTGGAGGGCTGATGGGTGG + Intergenic
1131048627 15:89332506-89332528 CTGCTTGGAAGGCTGGGGGAAGG + Intronic
1131063189 15:89416951-89416973 CTAGCCGCAGGGATGGGGGAAGG - Intergenic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1131139168 15:89963331-89963353 CTGTCTGCAAGGCCTGGGTAAGG - Intergenic
1131157073 15:90081830-90081852 CTGACGGCGGGGCTGGGGGAGGG - Exonic
1131366634 15:91847033-91847055 GTGTGTGAACGGCTGGGGGAGGG + Intergenic
1131403711 15:92146459-92146481 GCGTCTGCAAGGCTGGGCGAGGG - Intronic
1131405871 15:92163898-92163920 CACTCTGTGGGGCTGGGGGAAGG - Exonic
1131461336 15:92619667-92619689 CTGTGTGGGGAGCTGGGGGAGGG - Intronic
1131600838 15:93847162-93847184 CTGTTTGTGGGGTTGGGGGAGGG + Intergenic
1131889599 15:96958248-96958270 CCCTCTGCAGGGATGGGTGATGG - Intergenic
1132035649 15:98481607-98481629 CTGTCTGAAGGGCTGCGTTAAGG - Intronic
1132101407 15:99025923-99025945 TGGTCTGCATGGCTGGGGCAAGG + Intergenic
1132184642 15:99792494-99792516 ATCTCTGCAGGGGTGGGGGTGGG + Intergenic
1132432341 15:101772162-101772184 ATCTCTGCAGGGGTGGGGGTGGG - Intergenic
1132559825 16:588575-588597 ATGTCTTCAGCTCTGGGGGACGG + Intergenic
1132586246 16:706754-706776 CTGGGAGCAGGGCCGGGGGAGGG + Intronic
1132595255 16:746212-746234 GGGTCTGCAGGGCTGCAGGAGGG + Intronic
1132595300 16:746387-746409 GGGTCTGCAGGGCTGCAGGAGGG + Intronic
1132652207 16:1026624-1026646 CTGTCTGCAAGGCAGTGGTAAGG + Intergenic
1132699113 16:1214794-1214816 CTGTATGCTGGGCTGGAGGAGGG + Intronic
1132868367 16:2104728-2104750 CCAGCTGCAGGGCTGGGGGTGGG - Intronic
1132874439 16:2130028-2130050 TTGCCGGCAGGGGTGGGGGAAGG - Intronic
1132959075 16:2612286-2612308 GAGTCTGGAGGGCTGGGGAAAGG + Intergenic
1132972135 16:2694261-2694283 GAGTCTGGAGGGCTGGGGAAAGG + Intronic
1133320888 16:4913204-4913226 CTGTCTGTGGTTCTGGGGGACGG - Intronic
1133326151 16:4943534-4943556 CAGCCTGCCGGGGTGGGGGAGGG + Intronic
1133775690 16:8893614-8893636 CTAGCTGCAGGGCTGGTGCACGG + Exonic
1133895175 16:9920376-9920398 CTGAATGCAGGACTGGGAGAGGG - Intronic
1134003860 16:10804297-10804319 CTGTTTTCAGGGCTGGGGTTGGG + Intronic
1134071839 16:11265115-11265137 CTGTCTGCAGGGAAGGGAAATGG - Intronic
1134174214 16:11992870-11992892 ATATCTGCAGGGCTGGGCGTGGG + Intronic
1134427441 16:14164447-14164469 GTGTGTGCGGGGGTGGGGGATGG + Intronic
1134523004 16:14927158-14927180 CTGTCAGCAGGGCAGGAGGCCGG - Intronic
1134553384 16:15148861-15148883 TTGCCGGCAGGGGTGGGGGAAGG - Intergenic
1134687531 16:16169346-16169368 CTGTCTGGAGGTTTGGGGGCAGG + Intronic
1134710671 16:16325809-16325831 CTGTCAGCAGGGCAGGAGGCCGG - Intergenic
1134710956 16:16326757-16326779 CCAGCTGCAGGGCTGGGGGTGGG + Intergenic
1134718842 16:16370097-16370119 CTGTCAGCAGGGCAGGAGGCCGG - Intergenic
1134767067 16:16769150-16769172 CTGTCAGTGGGGCTAGGGGAGGG - Intergenic
1134948627 16:18341852-18341874 CCAGCTGCAGGGCTGGGGGTGGG - Intergenic
1134948930 16:18342836-18342858 CTGTCAGCAGGGCAGGAGGCCGG + Intergenic
1134955914 16:18382062-18382084 CTGTCAGCAGGGCAGGAGGCCGG + Intergenic
1135132154 16:19861962-19861984 CTGTTCGGAGAGCTGGGGGAGGG + Exonic
1135281837 16:21159184-21159206 CTCTCTGCAGCGATGGGGAAGGG - Intronic
1135925170 16:26687634-26687656 CTGGCTGCATGGCTTGGGGATGG + Intergenic
1136114834 16:28087971-28087993 GTGTCTGTGGGGTTGGGGGAGGG - Intergenic
1136412661 16:30086159-30086181 GGGGCTCCAGGGCTGGGGGAAGG + Exonic
1136581388 16:31153274-31153296 ATGTCTGCTGGGTTGGGGAAAGG - Intergenic
1136675967 16:31906484-31906506 GTGGCAGCAAGGCTGGGGGAAGG - Intronic
1137513062 16:49118126-49118148 CTGTCAGCAAGCTTGGGGGAGGG - Intergenic
1137731526 16:50693761-50693783 CTGGCCGCAGGGCTTGGGCAAGG + Intronic
1137804266 16:51288629-51288651 CTGGCTGGAAGGCTGGTGGAAGG - Intergenic
1138084263 16:54119438-54119460 CTGTCTGCAGAGTTGGGGGCAGG - Exonic
1138258953 16:55599200-55599222 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1138456020 16:57121223-57121245 ACCTCAGCAGGGCTGGGGGAAGG + Intronic
1138705879 16:58914524-58914546 CTGTCAGCAGGGTTGGGGATAGG - Intergenic
1138734051 16:59230070-59230092 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1138813479 16:60177853-60177875 GTGACTGCAGGGCTAGAGGAAGG + Intergenic
1139290721 16:65855664-65855686 CAGCATGCAGGGCTGGGAGATGG - Intergenic
1139481304 16:67232191-67232213 CTTTCTGCATGGTTGGGGGAAGG + Exonic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140872672 16:79121494-79121516 CTGTTTACGGGGCTGTGGGATGG + Intronic
1141089933 16:81123316-81123338 CTGTCTGCTGGGGTTGGGGGTGG - Intergenic
1141127489 16:81411116-81411138 CTGCCTGCCGGGGTGGGGGTGGG - Intergenic
1141376849 16:83539176-83539198 CTGTGGGCAAGGGTGGGGGATGG + Intronic
1141555956 16:84836882-84836904 CTGTCTGGAGGGTTGGGTGGTGG - Intronic
1141609957 16:85175634-85175656 CTTTCTGCTGGGATGGGGAACGG + Intronic
1141717575 16:85735622-85735644 CTGCCAGCAGGGCTCGGGGGTGG + Intronic
1141731386 16:85825302-85825324 CTGTCTGCAGGGATGTGCGGTGG - Intergenic
1141886952 16:86898833-86898855 CTCACTGCAGGGCTGGAGGGTGG - Intergenic
1141919495 16:87126561-87126583 CCCTCTGTATGGCTGGGGGATGG - Intronic
1141981978 16:87556509-87556531 CTGTTTCCAGGGCAGAGGGAGGG + Intergenic
1142032324 16:87844708-87844730 GTGTTTCCAGGGCTGGGGCAGGG - Intronic
1142129274 16:88425379-88425401 CAGGCTGCAGGGTTGGGGGTAGG - Intergenic
1142157412 16:88538948-88538970 CTGACTGCTGGGCATGGGGAGGG - Intergenic
1142203100 16:88770401-88770423 CTGTCTGTGGGGTGGGGGGACGG + Intronic
1142228358 16:88888317-88888339 CTGTGGCCTGGGCTGGGGGAGGG - Intronic
1142275465 16:89116440-89116462 CTGGCTGCTGGGCTGGGAGGAGG + Intronic
1142364554 16:89643187-89643209 CTGCTTCCAGGGCTGGGGCAGGG + Intergenic
1203080095 16_KI270728v1_random:1142557-1142579 CTGGCGGCGGGGCTGGGGGTAGG + Intergenic
1142477892 17:200495-200517 CTGCCTGCAGGCTTGGCGGAGGG + Intergenic
1142827889 17:2525579-2525601 CTCCCTGCAGGGCTTGGGGTGGG + Intergenic
1143095782 17:4477615-4477637 CTGGGAGCAGGGCTGGGGGTGGG + Intronic
1143179975 17:4978618-4978640 CTGTCTGCAGGGTGGGGTCAAGG - Exonic
1143499856 17:7332293-7332315 CTGAATTCAGGGCTGAGGGAAGG - Intergenic
1143846518 17:9776306-9776328 CTGTCTGCAAGCCAGGGAGAAGG + Intronic
1143870474 17:9954452-9954474 CAGTCTGCAGTGATGGGGGATGG + Intronic
1144492487 17:15725801-15725823 CTGATTGCAGGTCTGAGGGAAGG + Intergenic
1144745504 17:17611473-17611495 CTTGCTGTCGGGCTGGGGGACGG + Intergenic
1144907987 17:18653386-18653408 CTGATTGCAGGTCTGAGGGAAGG - Intronic
1145013684 17:19383700-19383722 ATCTCTGCAGGGCTGGGAGTGGG - Exonic
1145239399 17:21231264-21231286 CTGTCTCCCAGGCTGGAGGATGG - Intergenic
1145396758 17:22502641-22502663 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1145779118 17:27550413-27550435 CTGTTTGCAGGGGAGGGGAAAGG - Intronic
1146065498 17:29631773-29631795 CTGTCTCCAGGGCTGTGGACAGG + Exonic
1146273569 17:31500033-31500055 CTGTTTGCAGGGCAGAGGGTAGG + Intronic
1146277222 17:31523493-31523515 CTGCCTGCAGGGGTGGGAGGAGG - Exonic
1146663315 17:34679756-34679778 ATGTCTGCATGGCAGGAGGATGG + Intergenic
1147322819 17:39656431-39656453 ATGTCTGGTGGGCTGGGGTAGGG + Intronic
1147387847 17:40092229-40092251 GGGTCTGCAGGGCTGGGAGAGGG + Intronic
1147459086 17:40557175-40557197 CCGTCTGCAGGGTCGGGTGAAGG + Intronic
1147577279 17:41610075-41610097 CTGACTCCAGGGCAGGGAGAAGG + Intronic
1147917666 17:43898369-43898391 CTTGCTGCATGGCTGGGGGAAGG + Exonic
1148483296 17:47974619-47974641 CTGAGTGGAGTGCTGGGGGAAGG + Intronic
1148740374 17:49889549-49889571 CTCTCGGCACGGGTGGGGGATGG + Intergenic
1148778964 17:50111065-50111087 CTGGCTGCATCCCTGGGGGAGGG + Exonic
1148852015 17:50560154-50560176 TTGGCTGCGGGACTGGGGGAGGG - Intergenic
1148864924 17:50623537-50623559 CCACCTGCAGGGCTGGGGGCTGG + Intronic
1148885602 17:50770096-50770118 CTGATCGCAGGGCTGGGGCAGGG - Intergenic
1149272184 17:54991941-54991963 GTGTTTGCAGTGGTGGGGGAGGG - Intronic
1149408316 17:56377753-56377775 CTCCTTGCAGGGTTGGGGGATGG + Intronic
1149429771 17:56588463-56588485 CTGTCTCCAGGGCTGGAGAGAGG + Intergenic
1149518453 17:57299501-57299523 GTGTCTACAGGCCTGCGGGAAGG + Intronic
1150003465 17:61455931-61455953 CTGTCTGAGGGGTTGGGTGAGGG + Intronic
1150229971 17:63544421-63544443 CTGTGGTCAGGGCTGGGGGCTGG + Intronic
1150915511 17:69432647-69432669 CTATCGGGAGGGGTGGGGGAGGG + Intronic
1151280747 17:73072366-73072388 CTGTTTGCAGGGCTCTGGGCAGG + Intronic
1151354921 17:73552702-73552724 CTGACTGCAGAGCTTGAGGACGG + Intronic
1151418664 17:73983505-73983527 TTGTGGGCAGGGCTGGGCGAGGG - Intergenic
1151530731 17:74703197-74703219 CTGTGTGCAGGGCTGCGGGTGGG - Intronic
1151841228 17:76619197-76619219 CTGATTCCAGGGCTGGGGTAGGG - Intergenic
1151882707 17:76904627-76904649 CTGTTTGCAGGGCAGGTGGGGGG + Intronic
1152016447 17:77754011-77754033 ATGGCTTCAGGGCTGGGGGTGGG - Intergenic
1152183771 17:78841224-78841246 CTGTCTCCCGGGCAGGGAGAAGG + Intronic
1152283146 17:79397111-79397133 CTGTCCGCGGGGCTGTGGGGAGG - Intronic
1152315089 17:79575443-79575465 CAGCCAGCAGGGCTGGGGGACGG + Intergenic
1152566326 17:81102002-81102024 CTGCCTGCAGGGATGGAGGGCGG + Intronic
1152570308 17:81118788-81118810 GTGGCTGCAGCCCTGGGGGAAGG - Intronic
1152587848 17:81197043-81197065 GTGTCTGCAGGGGTGGGTGCCGG - Exonic
1152594786 17:81232823-81232845 GTGTGTCCAGGGCTCGGGGAGGG + Intronic
1152705628 17:81842082-81842104 CTGTGTGCAGGGCTGGGCGATGG - Intergenic
1152820603 17:82435875-82435897 CGGCCAACAGGGCTGGGGGAGGG + Intronic
1152821752 17:82441117-82441139 CTGTCTCCACGGGCGGGGGAAGG - Exonic
1152927357 17:83093384-83093406 CTGTCCCCAGGGCTGGTGGAGGG - Intronic
1152943014 17:83182259-83182281 CTGTTTGCTGGGATGGGTGAGGG + Intergenic
1153051368 18:905767-905789 CTGTGGGCCGGGTTGGGGGAGGG - Intronic
1153254609 18:3157900-3157922 CTATTTGGAGGGCTGGGAGAGGG - Intronic
1153837009 18:8972342-8972364 CTGTCCTCAGGGCTGGAGGCTGG + Intergenic
1153981532 18:10314756-10314778 CTGTCGCCAGGACTGGAGGAAGG + Intergenic
1154284497 18:13039533-13039555 CTGTGTGCAGGCCTGGAGGTAGG + Intronic
1154968648 18:21384788-21384810 TTGTTTGCAGGGCCGGGGGCGGG - Intronic
1155400882 18:25437816-25437838 CTGTATCCAGGGCTGGAGAATGG - Intergenic
1155530464 18:26761305-26761327 CTCTCTACAGGGCTCGGAGAAGG - Intergenic
1155553619 18:26993944-26993966 CTCTCTCCTCGGCTGGGGGATGG + Intronic
1155612528 18:27682901-27682923 TGGTCTGCAGGCCTGGGGGTTGG + Intergenic
1156036229 18:32770623-32770645 CTGTCTGCCAGGTTGGAGGAGGG - Exonic
1156841811 18:41617867-41617889 CTGTCTGTGGAGGTGGGGGAAGG - Intergenic
1157097233 18:44696991-44697013 CTGCCTGCAGGACTTGGGCAGGG - Intronic
1157469673 18:47979587-47979609 CTGTCTCAAGGGCTGGCAGAGGG - Intergenic
1158144085 18:54290827-54290849 CTGGATGGAGGGCTGAGGGAGGG + Intronic
1159017842 18:63116250-63116272 CTGCCTGCAGGGCTCTGAGATGG + Intergenic
1159915480 18:74183723-74183745 CTGTCTGGAGGGGTGGAGAATGG + Intergenic
1160035363 18:75296716-75296738 GTGTGTGCAGAGCAGGGGGACGG + Intergenic
1160093221 18:75846456-75846478 CTGTCTGGAGGTCTGGGCTATGG - Intergenic
1160318415 18:77868689-77868711 CTGACTACAAGGCTGGGGGAAGG + Intergenic
1160486259 18:79295818-79295840 GTGTCCTCAGGGCTGGGAGAGGG - Intronic
1160578217 18:79869086-79869108 GTGTCTGCAGGGCTGTGTGTAGG - Intronic
1160989304 19:1854057-1854079 CAATCTGCAGGGATGGGGCAGGG + Exonic
1161260837 19:3337009-3337031 CTGCCAACAGGGCTGGGGGTGGG + Intergenic
1161390012 19:4015883-4015905 CGGAATGCTGGGCTGGGGGAGGG + Intronic
1161407268 19:4097653-4097675 CTCTCTGGAGGGCAGGGGGAGGG + Intronic
1161437586 19:4273034-4273056 CTGTCGGCAGGGATAGGGGAAGG - Intergenic
1161531796 19:4793991-4794013 CTGTCTGCAGGTAGAGGGGATGG - Exonic
1161580286 19:5077185-5077207 GTGCCTGCAGGTCGGGGGGAAGG - Intronic
1161640748 19:5421179-5421201 CTGGCTGGAGGGGTGGGGGACGG + Intergenic
1161801909 19:6421076-6421098 TTGTCTGAAGGGCTGTGGGAGGG - Intronic
1161853854 19:6752924-6752946 CTCTCTGCAGGAATGGGGGTGGG + Intronic
1162453709 19:10769739-10769761 CTGATAGCAGGGCTGGGGGTGGG + Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162797779 19:13095550-13095572 CTGCATGCAGGGCTGGGGGCGGG - Exonic
1162828626 19:13270093-13270115 CCGTATTCAGGGCTGGGAGATGG + Intronic
1163021420 19:14482808-14482830 GGGGCCGCAGGGCTGGGGGAGGG + Exonic
1163287562 19:16358002-16358024 CTGTCCTCAAGGCTGGTGGAGGG - Intronic
1163423096 19:17226195-17226217 CGCTCAGCAGGGCTGGGGGCGGG - Exonic
1163452603 19:17387394-17387416 GTGTGTGTAGGGCTTGGGGAGGG - Intergenic
1164051050 19:21586315-21586337 CTCTCGGGCGGGCTGGGGGAAGG - Intergenic
1164333641 19:24285486-24285508 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1164606005 19:29598614-29598636 CTGTCTGAAGTGCTGGGACATGG - Intergenic
1164721877 19:30438498-30438520 CTGGCAGCAGGGTTGGGGGTGGG + Intronic
1165897264 19:39150216-39150238 CTTGCTGCAGCGCTGGGAGAGGG + Intronic
1165954425 19:39493222-39493244 AAGTCTGCAGGACTGAGGGAGGG + Intronic
1166258785 19:41623942-41623964 GGGGCTGCAGGGCTGTGGGAAGG - Intronic
1166738227 19:45098563-45098585 GTGTCTGCAGGGCAGGGTGAGGG + Intronic
1166866262 19:45839329-45839351 CTGATTCCAGGGCTGGGGCAAGG + Intronic
1166976266 19:46606896-46606918 CTGACAGCAGAGCTGGGGGCTGG - Intronic
1167341848 19:48921135-48921157 CTGTCTGCAGGGCAGGCACAGGG - Exonic
1167597005 19:50433042-50433064 CTGTTTGTAGGGTTGGGAGAAGG + Intronic
1168180471 19:54659251-54659273 CGGGCTGGGGGGCTGGGGGAGGG + Intronic
1168330090 19:55563147-55563169 CTGACTGAAGGGCTGGGAGCGGG + Intergenic
1168586013 19:57592669-57592691 CTCTCTTCAGGCCTGGGGAAGGG - Exonic
1202638448 1_KI270706v1_random:61859-61881 CTGGCTGTAGGGCGGTGGGAGGG - Intergenic
1202715775 1_KI270714v1_random:41577-41599 CTGGCTGCAGGGCGTGGGGGCGG - Intergenic
925041898 2:738706-738728 CTGGCCTCAGGGCTGGGGCAGGG + Intergenic
925172392 2:1758265-1758287 TTGTCTGCAGGGCTGTCGTATGG + Intergenic
925870663 2:8267134-8267156 CTGTCTTCAAGTCTGAGGGAGGG + Intergenic
926062024 2:9810415-9810437 CTCTCTCCTGGGCTAGGGGATGG + Intergenic
926113182 2:10195477-10195499 CTGACTGCAGGGCTGGGCCAAGG - Intronic
926157157 2:10462666-10462688 CTGTGTGCAGAGCTGGGGCTGGG - Intergenic
926224884 2:10960769-10960791 CTGCAGGCAGGGCTGGGTGAGGG + Intergenic
926990640 2:18676458-18676480 CTGTCTGCAGTGGTGGGTGAGGG + Intergenic
927236014 2:20875551-20875573 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
928436371 2:31257173-31257195 CTGTTTGCAGAGGTGGGGGTTGG + Intronic
928759154 2:34561018-34561040 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
928795360 2:35012866-35012888 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
929547369 2:42864371-42864393 GTGCTTGCAGGGCTGGGGGAAGG - Intergenic
929850363 2:45582771-45582793 CTGATTCCAGGGCTGGGGCAGGG - Intronic
929994796 2:46818514-46818536 CTCCCTGTAGGGCTGTGGGAGGG + Intronic
930862902 2:56092967-56092989 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
931254191 2:60555619-60555641 TTGCCGGCAGGGCTGCGGGATGG - Intergenic
931477630 2:62605656-62605678 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
931542972 2:63350290-63350312 GAGGGTGCAGGGCTGGGGGAGGG + Intronic
931709327 2:64974642-64974664 CTGTGTGCAGGGTTAGGGGCTGG - Intergenic
931766741 2:65463564-65463586 CCTTCTGCTGGGCTTGGGGATGG + Intergenic
931950503 2:67356485-67356507 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
932338551 2:70944588-70944610 AGGTCTGAAGGGCTGGAGGATGG - Intronic
932614900 2:73225777-73225799 CTCCCTGCAGCGGTGGGGGATGG - Exonic
932623897 2:73283774-73283796 GTTTCTGAGGGGCTGGGGGAGGG - Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933202435 2:79466312-79466334 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
933991919 2:87639979-87640001 CCTGCTGCAGGGCTGGTGGAGGG + Intergenic
934474605 2:94586130-94586152 CTTTCTGCAGGGGTGAGGCAGGG - Intergenic
934516513 2:94991404-94991426 GGGTTAGCAGGGCTGGGGGATGG + Intergenic
934573877 2:95388549-95388571 CTGTCCTCAGGGCAGGGTGAGGG - Intergenic
934588219 2:95525216-95525238 GTTTCTGCCGGGCTGGGGGCGGG + Intergenic
934617622 2:95784457-95784479 GTGGGTGGAGGGCTGGGGGAGGG + Intergenic
934643271 2:96040102-96040124 GTGGGTGGAGGGCTGGGGGAGGG - Intergenic
934661693 2:96146484-96146506 CCGGCAGCAGGGCTGGGGGAGGG - Intergenic
934768071 2:96891755-96891777 TTATTTGCAGGGCTGGAGGAGGG + Intronic
934851972 2:97707318-97707340 CTGCGTGGAGAGCTGGGGGAGGG + Intergenic
934997441 2:98978240-98978262 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
935593638 2:104863401-104863423 CTTTCTGCAGGGCTTGTGGAAGG + Intergenic
935918080 2:107979467-107979489 GTGGCTGGGGGGCTGGGGGAGGG + Intergenic
935961092 2:108426191-108426213 CTGTCAGTGGGGCAGGGGGAGGG + Intergenic
936018429 2:108976880-108976902 CTGACTCCAGAGCTGGGGCAGGG - Intronic
936301925 2:111310839-111310861 CCTGCTGCAGGGCTGGTGGAGGG - Intergenic
937376253 2:121337730-121337752 CTGTCTGCAGGGCATGGTGGTGG + Intergenic
937905407 2:127050559-127050581 CTCTGTGCAGGGCTGGAGGTGGG - Intronic
937908083 2:127062061-127062083 CTGTGTGCACGGCAGGGGCAGGG - Intronic
937977513 2:127590651-127590673 CTGTCTGCAGGGCTGGTGAAAGG - Intronic
938249460 2:129802800-129802822 TTGCCTGGAGGCCTGGGGGAGGG + Intergenic
939830294 2:147063448-147063470 AGTTCTGCAGGGCTGGGGGAGGG - Intergenic
940257222 2:151743754-151743776 GTGGCAGCAGGGCTGGGGGATGG + Intergenic
940414790 2:153407192-153407214 GTTTCTGGAGGGCTGGGGTAGGG - Intergenic
940676692 2:156732256-156732278 CAGTTTTCAGGGCTGGGGCAAGG + Intergenic
941015883 2:160355688-160355710 CTGTCTTCAGTGCTGGGGTGGGG + Intronic
942060585 2:172225317-172225339 CTGTCATAAGGACTGGGGGATGG - Intergenic
942859417 2:180591316-180591338 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
943303415 2:186230743-186230765 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
944196797 2:197062752-197062774 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
945539818 2:211071485-211071507 CTGTATGCTGGGCTGGGAGATGG - Intergenic
945948146 2:216013688-216013710 CTGGCAGCCGGGCTGGGGGAGGG + Intronic
946196167 2:218034030-218034052 CTGTCGCAAGGGCTGGGGGCGGG - Intergenic
946411734 2:219518587-219518609 CTGTCTACAAGGCTGGGGGTGGG - Intronic
946495259 2:220190161-220190183 GGGGCTGCAGGGCTAGGGGAGGG + Intergenic
946684729 2:222256303-222256325 CTGTCTGCCGGGCTGGCTGGAGG - Intronic
948202985 2:236143100-236143122 CTGTCTGTGGGTTTGGGGGAGGG + Intergenic
948398717 2:237667175-237667197 CTGTCAGGAGGTCAGGGGGAAGG - Intronic
948408523 2:237741080-237741102 CTGACTGCTGGGCTCTGGGATGG - Intronic
948462815 2:238138595-238138617 CTGTCTGCAGGGCGAGGGGAGGG - Intergenic
948611073 2:239167373-239167395 CTCTATGCAGGGCTGGGTGCTGG + Intronic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
948921612 2:241068592-241068614 CACTGTGCAGGGATGGGGGACGG - Intronic
1168831641 20:848352-848374 AAGGCTGCAGGGTTGGGGGAGGG - Intronic
1168887136 20:1267368-1267390 CAGTCTGCAGGGTTGGGGAAGGG - Intronic
1168971157 20:1931723-1931745 CAGGTTGCAGGGCTGGTGGAGGG + Intronic
1169027214 20:2381197-2381219 CTGTCTCCTGGGCTGGGGCCAGG + Intronic
1169046336 20:2537044-2537066 CTCTGTGCAGGGCAGGGGGTGGG + Intronic
1169189009 20:3645468-3645490 CTGTTTGCTGGGCTGGGCGGTGG - Intronic
1169207742 20:3749622-3749644 CTGTCTGCAGGGTCGGGGGAGGG - Intronic
1170319313 20:15077917-15077939 CTTTGAGCTGGGCTGGGGGAGGG + Intronic
1170707774 20:18760942-18760964 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1171004462 20:21450699-21450721 CTGATTCCAGGGCTGGGGCAGGG + Intergenic
1171225124 20:23436341-23436363 GTGGCTGCAGGGCAGGGGTAGGG - Intergenic
1171262854 20:23748516-23748538 CTGTGTGCTGGGCAGGGAGAAGG - Intronic
1171271981 20:23824720-23824742 CTGTGTGCTGGGCAGGGAGAAGG - Intronic
1171317824 20:24211097-24211119 CTGTCGGGAGGTCGGGGGGAAGG - Intergenic
1171569419 20:26234096-26234118 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1171885029 20:30645921-30645943 CTGTCTGTAGGGTGGTGGGAGGG - Intergenic
1172110195 20:32540097-32540119 CTGTCTGCTGGGCTGGGCAGGGG + Intronic
1172224732 20:33297732-33297754 CTGTCTGCGCGTCTGGGGCAGGG - Intronic
1172390107 20:34560100-34560122 CTGGCTGGTGGGATGGGGGAGGG + Exonic
1172662040 20:36574426-36574448 CTGGGCGCAGGGCTGGGGGGGGG + Intronic
1172771583 20:37385398-37385420 CTGTCTGCACCGCTGGGGCCCGG - Intronic
1172940430 20:38650174-38650196 CTCTCTGGAGGGCTGGAGGGTGG - Exonic
1173182226 20:40814107-40814129 CAGGCTGAAGGGCTGGGGGAAGG - Intergenic
1173226092 20:41163193-41163215 CTCCCTGCAGGGCTGGGGAGCGG + Exonic
1173279671 20:41617815-41617837 CTGTTTGCAGGGGTGGAGGAGGG - Intronic
1173386619 20:42594209-42594231 CTTTCTGCAGGGCTGTTGGTTGG + Intronic
1173543847 20:43876844-43876866 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1174364727 20:50049746-50049768 GAGTCTCCAGGGCTGGGGCAGGG - Intergenic
1174899048 20:54479370-54479392 CTATTTGAGGGGCTGGGGGAAGG + Intronic
1175026258 20:55905959-55905981 GTGGCAGCCGGGCTGGGGGAGGG - Intergenic
1175525614 20:59631415-59631437 CTTTCTGCAGGGACAGGGGAGGG + Intronic
1175571337 20:60025011-60025033 CTATCTGCAGAGCTTGGGAAGGG + Intronic
1175774228 20:61642820-61642842 CTGGCTTCAGAGATGGGGGAAGG - Intronic
1175903961 20:62370885-62370907 CGGGCTCCAGGCCTGGGGGAGGG - Intergenic
1175917837 20:62435269-62435291 GTGTCGCCAGGGCTGAGGGAGGG - Intergenic
1175924711 20:62466059-62466081 CTGCCAGCTGGGCTGGGTGAGGG + Intronic
1175943883 20:62550041-62550063 CAGGCTGCAGGGCCGGGGGTGGG - Intergenic
1176110109 20:63407236-63407258 CTGTCTTCCGGGCTGTGGTACGG + Exonic
1176178139 20:63738172-63738194 CAGGCCGCAGGGCTGGGGGTGGG - Exonic
1176292996 21:5056076-5056098 CTCCCTCCAGGGCTGGGGGCAGG - Intergenic
1177836850 21:26193990-26194012 ATTTGTGCAGGGATGGGGGACGG + Intergenic
1178061670 21:28859790-28859812 CTATATGGAGAGCTGGGGGAGGG - Intergenic
1178615195 21:34126940-34126962 CTGTGTGCAGTGGTGGGGGTTGG + Intronic
1179242097 21:39601706-39601728 CTGTCAGCACGGCTGGTGGGAGG + Intronic
1179635947 21:42709296-42709318 CTGTTGGGAGGGTTGGGGGAGGG + Intronic
1179718779 21:43303792-43303814 CATGCTGCGGGGCTGGGGGAGGG - Intergenic
1179797737 21:43795034-43795056 CTGTCAGCAGCTCTGGGGGCCGG + Intronic
1179808304 21:43854119-43854141 CCTTCTGCAGTGCTGGGGGTTGG - Intergenic
1179826277 21:43968213-43968235 GTCCCTGCAGGGCTGGGGGTGGG + Intronic
1179864264 21:44207574-44207596 CTCCCTCCAGGGCTGGGGGCAGG + Intergenic
1180049163 21:45323581-45323603 CTGCCTGCAGGCCTGGGGCCAGG + Intergenic
1180212383 21:46302481-46302503 CTACCTGCAGGGCTGGGGGCAGG + Exonic
1180252858 21:46601119-46601141 GTGTTTTCAGGGCAGGGGGAGGG - Intronic
1180363518 22:11920029-11920051 CTGGCTGTAGGGCGGTGGGAGGG + Intergenic
1180453894 22:15494748-15494770 GTGACAGCAAGGCTGGGGGAGGG + Intergenic
1180728603 22:17964347-17964369 CTGTGTACATGGCTGGGAGACGG - Intronic
1180821212 22:18829070-18829092 CTGTCTGAAGGGTTGTGGGCTGG - Intergenic
1180842529 22:18965982-18966004 CTCCCTGCAGGGGTGGGGGAGGG + Intergenic
1181026303 22:20129704-20129726 CTGTCTGCCGGGCTGCAGGCTGG + Intronic
1181033253 22:20158161-20158183 CTGTCTCCAGGCCCCGGGGAGGG - Intergenic
1181058952 22:20272874-20272896 CTCCCTGCAGGGGCGGGGGAGGG - Intronic
1181191766 22:21146975-21146997 CTGTCTGAAGGGTTGTGGGCTGG + Intergenic
1181592115 22:23891932-23891954 CTGGCTCCAGGGTTGGGGGTTGG - Intronic
1181604328 22:23971191-23971213 CCATCTGCAGGCCTGTGGGAAGG - Intronic
1182280125 22:29213681-29213703 CTTTTTGCAGGGGTTGGGGAAGG + Intronic
1182557954 22:31139235-31139257 TTGTGTGCAGGGTTGGGGGAGGG - Intronic
1182585124 22:31340534-31340556 GTGGCTGTAGGGCTGGAGGAGGG + Intronic
1182664495 22:31947185-31947207 CTTTCTTCAGGGCTGGGGAAGGG + Intronic
1182758364 22:32699524-32699546 GTGTGTGCAGGGATGGGGGTAGG + Intronic
1182806345 22:33073868-33073890 CTGTCTGCAGGGCTGTTGTCTGG - Intergenic
1183389774 22:37538934-37538956 CTGTCAGCAGGGCAGGGGCTGGG + Intergenic
1183406887 22:37634595-37634617 CTGTCTGGAGGGCTGTGCCAGGG - Intergenic
1183620137 22:38967292-38967314 ATTTCTGCAGGGCTGGAGGTGGG + Intronic
1183699047 22:39439559-39439581 CAGAAAGCAGGGCTGGGGGAAGG + Intergenic
1183733466 22:39630899-39630921 GTGTGTGCAGGGCTGGGGAGTGG + Intronic
1183745784 22:39690995-39691017 CTGTCGGGAGGGGTGGGGGTAGG + Intergenic
1184032341 22:41902525-41902547 CTGTCGATGGGGCTGGGGGAAGG - Intronic
1184120139 22:42444671-42444693 CTGTCAGGAAGGCTGGGGGAGGG - Intergenic
1184337449 22:43862161-43862183 CGCGCTGCAGGGCTGGGGCATGG + Intronic
1184431639 22:44444578-44444600 CTGTCATCAGTGCTGCGGGAGGG - Intergenic
1184564939 22:45286142-45286164 CTGTCTGCAGGGAGGAGGGAAGG + Intronic
1184690555 22:46115432-46115454 CTGACTGCAGGGCTGGGTCCAGG - Intergenic
1184737744 22:46409219-46409241 TTGGCTGCAGGGGCGGGGGATGG + Intronic
1184769671 22:46589865-46589887 CTCTCTGAGGGGCTGAGGGAGGG - Intronic
1184799615 22:46751693-46751715 CTGGCAACAGAGCTGGGGGAAGG + Intergenic
1184945662 22:47802076-47802098 GTGTCTGCAGGCCAGAGGGAGGG - Intergenic
1185052935 22:48563197-48563219 TTGTCTGCAGGGCTCTTGGAGGG - Intronic
1185129963 22:49033281-49033303 CTGTCTCCAGGGCTGGAGCCAGG - Intergenic
1185181422 22:49365642-49365664 CAGCCTGGAGGGCTGGTGGACGG + Intergenic
1185294554 22:50046781-50046803 CTTTGTGCAGGGCTGGAGGCCGG + Intronic
1185323976 22:50216630-50216652 CTGCCTGCAGGGCAGGGACACGG + Intronic
1185380367 22:50505028-50505050 AGCGCTGCAGGGCTGGGGGATGG - Intronic
1203219488 22_KI270731v1_random:31881-31903 CTGTCTGAAGGGTTGTGGGCTGG + Intergenic
1203271337 22_KI270734v1_random:54946-54968 CTGTCTGAAGGGTTGTGGGCTGG - Intergenic
949288038 3:2429790-2429812 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
949532096 3:4966156-4966178 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
949804558 3:7940209-7940231 GGGGCTGGAGGGCTGGGGGAGGG + Intergenic
949912077 3:8919761-8919783 CTGATTTCAGGGCTGGGGCATGG + Intronic
950087996 3:10274595-10274617 CTGTGTGTAGGGGTCGGGGAGGG + Intronic
950196380 3:11011966-11011988 CTAGCTGCAGGGATGGGGCAGGG - Intronic
950441700 3:13014470-13014492 CTGTCTGCAGCGTGGGGGCAGGG + Intronic
950469805 3:13177566-13177588 CTGTCCACAGGGATGGGGAATGG - Intergenic
950614918 3:14150713-14150735 CTGTCCTCAGGGCTGGGCAATGG - Intronic
950621347 3:14207919-14207941 CTGATTCCAGGGCTGGGGCAGGG + Intergenic
950634778 3:14307219-14307241 CTCTGTGCAGGGCTGGGGTGGGG + Intergenic
950654574 3:14428636-14428658 CTGTGTGCAGGTGTGTGGGAGGG + Intronic
950714372 3:14837258-14837280 CTGTCTCCATGGCTGGAGAAGGG + Intronic
951330749 3:21365273-21365295 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
951368309 3:21812629-21812651 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
951584769 3:24203940-24203962 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
952000285 3:28777370-28777392 GTGACTGGAGGGCTGGTGGAGGG + Intergenic
952547218 3:34433444-34433466 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
953146184 3:40277346-40277368 TGGGCTGCGGGGCTGGGGGAGGG + Intergenic
953407592 3:42667157-42667179 CACTTTCCAGGGCTGGGGGAAGG + Intergenic
953465007 3:43112031-43112053 CTGGTTGCTTGGCTGGGGGAAGG - Intergenic
953557694 3:43959888-43959910 GTGTCTACAGGGCAGAGGGAGGG - Intergenic
953674864 3:44993078-44993100 CTGGCTGAGGGGCTGGGGGTGGG + Intronic
953751327 3:45610630-45610652 CTGTTGGCAGAGCTGGGGGGTGG - Intronic
953975460 3:47378893-47378915 GTGTCTGTTGGGCTAGGGGAGGG - Intergenic
954082680 3:48221795-48221817 CAGTGTGCAGGGCTGGGGTGAGG + Intergenic
954249896 3:49359096-49359118 CTCTCTCCAGGGCTGGGGGTAGG - Intergenic
954328003 3:49874036-49874058 CTGTCTGCATGGCTGGGACATGG + Intergenic
954361491 3:50124983-50125005 CTGGCTGCAGGGGATGGGGATGG + Intergenic
954576975 3:51681723-51681745 GTGTCTGCATGGCAGAGGGAGGG - Intronic
954628780 3:52037114-52037136 GAGACTGCTGGGCTGGGGGAAGG + Intergenic
955887821 3:63619280-63619302 CTGTCCCCAGGAATGGGGGAGGG - Intergenic
956158891 3:66326709-66326731 CTGTCTGCAGGGTGTGGGGGTGG - Intronic
956268795 3:67427897-67427919 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
956724504 3:72145940-72145962 CAGTGGGCAGGGCTGAGGGATGG + Intergenic
957020930 3:75125442-75125464 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
957250189 3:77762531-77762553 CTGGGTGCGGGGCTAGGGGAGGG + Intergenic
957639428 3:82832331-82832353 CTGTCAGCAGGGATCGGGGAGGG + Intergenic
957667626 3:83254054-83254076 CTGTCTCCCAGGCTGGAGGAGGG - Intergenic
957914086 3:86663527-86663549 CTGTCAGTGGGGGTGGGGGAAGG + Intergenic
957948821 3:87097951-87097973 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
958654622 3:96984760-96984782 AAGGCAGCAGGGCTGGGGGAGGG - Intronic
958677360 3:97282830-97282852 CTATCAGCAGGGCAGGGGAAGGG + Intronic
959812680 3:110637611-110637633 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
960095553 3:113686333-113686355 CTCTCTGCATGGCTGGGGAAGGG + Intronic
960448573 3:117778400-117778422 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
960492614 3:118334944-118334966 GTGTCTGCAGGGGTGGGGTTGGG - Intergenic
960846394 3:122007872-122007894 CTGTCTGCAAATCTGGGAGAGGG + Intronic
960994778 3:123333581-123333603 CTTCCTCCTGGGCTGGGGGAGGG - Intronic
960999006 3:123359748-123359770 CTGTCTTTAGGGCTGGGGCCAGG - Intronic
961058646 3:123810232-123810254 CTGTCCTGAGGTCTGGGGGAGGG - Intronic
961197410 3:125014516-125014538 GTGTGTGGAGGGCTGGGGGTGGG + Intronic
961845372 3:129758540-129758562 CTGATTGTAGGGCTGGGGCAGGG + Intronic
961895672 3:130166119-130166141 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
963767984 3:149357689-149357711 GTGGCTGCAGGGTTGGGGGTGGG - Intergenic
964175634 3:153823765-153823787 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
964532731 3:157685625-157685647 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
964860476 3:161196022-161196044 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
965599067 3:170437506-170437528 GTGGCTCCATGGCTGGGGGAGGG + Intronic
965623902 3:170668088-170668110 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
966537021 3:181046484-181046506 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
967187136 3:186953978-186954000 CTGTCAGGGGGCCTGGGGGAGGG - Intronic
967493319 3:190117737-190117759 CTTTCTTGGGGGCTGGGGGAGGG + Intronic
967824833 3:193869759-193869781 GTGTCTGCAGGGCTGGGGGCGGG - Intergenic
967873860 3:194253053-194253075 TTGTTTGCAGGGCTGGGACAGGG + Intergenic
968274373 3:197428795-197428817 TTGTCTGGAGGGCAGGGGAATGG + Intergenic
968337843 3:197928979-197929001 CTGGCCACAGGGCTGGGGAAGGG - Intronic
968551533 4:1226066-1226088 CCGACTGCAGGGGTGGGGCATGG - Intronic
968634682 4:1671906-1671928 CTGATTTCAGGGCTGGGGCAGGG + Intronic
968709468 4:2102395-2102417 CTGCCTGCTGGCCTGGGGGCTGG + Intronic
968934149 4:3601247-3601269 CTGACCGCTGGGCTGTGGGAGGG - Intergenic
968957819 4:3728118-3728140 CCGTCTGCAGGCCTGGAGGAGGG + Intergenic
969088136 4:4671689-4671711 CTGTCAACTGGGCTGGGAGAGGG + Intergenic
969277192 4:6143925-6143947 CAGTCTCCAGGGCTGGAGCAGGG + Intronic
969304362 4:6317350-6317372 CCTTCTGCAGGGCTGGGAGAGGG + Intergenic
969320508 4:6409688-6409710 GTGTCTCCAGGGCTGGGATATGG - Intronic
969441557 4:7220137-7220159 CTGTGTGCTGGGCTGGTGGCAGG + Intronic
969605782 4:8201615-8201637 GGGCCTGCAGGGCTGAGGGAGGG + Intronic
970402571 4:15731867-15731889 GAGGCTGCAGGGCTGGAGGAGGG - Exonic
971041671 4:22760187-22760209 CTATGTGCAGAGATGGGGGAGGG + Intergenic
971217861 4:24678120-24678142 ATGTCTACAGGGCTGGGGTGGGG - Intergenic
971328588 4:25664183-25664205 CTCTCTGCAGGGGGGTGGGATGG - Exonic
972129646 4:35816163-35816185 ATGTCTCTGGGGCTGGGGGAGGG - Intergenic
972452310 4:39214365-39214387 CTGTGTGCAGAGATGGGGGGCGG - Intronic
973347079 4:49068259-49068281 GTGGCTGCGAGGCTGGGGGAGGG + Intergenic
973564535 4:52170902-52170924 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
973592788 4:52459386-52459408 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
973667534 4:53177936-53177958 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
973693528 4:53466763-53466785 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
974127533 4:57714519-57714541 CTGCATCCTGGGCTGGGGGAGGG + Intergenic
974182468 4:58401481-58401503 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
974798465 4:66783187-66783209 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
975256081 4:72236577-72236599 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
975332910 4:73139614-73139636 CAGTTGGCAGGGCTGGGGCAAGG - Exonic
976433207 4:84987612-84987634 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
976483646 4:85574374-85574396 CTGTCTAGAGGGCTTGGGAAGGG + Intronic
976682184 4:87769504-87769526 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
976924951 4:90485082-90485104 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
976974896 4:91154218-91154240 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
977110305 4:92944281-92944303 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
977516210 4:98023741-98023763 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
977757346 4:100689038-100689060 CTGACTGCAGGATTGGGAGAAGG - Intronic
977786602 4:101042345-101042367 CTGTTTTCAGGGCAGAGGGAAGG - Intronic
978084023 4:104627692-104627714 CTGTCAGCATGACTGGGGTAAGG - Intergenic
978259744 4:106741164-106741186 GGGACTGCAGGGCTAGGGGAGGG - Intergenic
978537282 4:109775432-109775454 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
978859335 4:113430263-113430285 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
981149852 4:141368417-141368439 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
981165220 4:141549719-141549741 GTGTCAGCGAGGCTGGGGGAGGG + Intergenic
981742768 4:148020443-148020465 CTGTCAGCGGGGCAGGGGGAGGG - Intronic
982094501 4:151909683-151909705 CTGCCTGGAGGGGTGAGGGAAGG - Intergenic
982617586 4:157659679-157659701 CTGTCTGGGGGTGTGGGGGAAGG + Intergenic
983446393 4:167858304-167858326 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
983938829 4:173521704-173521726 CTCCCTGGAGGGCTGGGGGAAGG + Intergenic
984251692 4:177343506-177343528 ATGTCTGTAGAGCTGGGGGCAGG + Intronic
984767143 4:183408327-183408349 CTGTCTGGGGGAGTGGGGGACGG - Intergenic
984824284 4:183910506-183910528 CCATCCCCAGGGCTGGGGGAGGG - Intronic
984885680 4:184447144-184447166 CTGACTCCAGAGCTGGGGCAGGG + Intronic
984888803 4:184473687-184473709 CTGCCTGCCGGGCTCGGGGTCGG - Intronic
985266881 4:188159189-188159211 CTGTCGGTGGGGCAGGGGGAGGG - Intergenic
1202765785 4_GL000008v2_random:147717-147739 CTGGCTGTAGGGCCGTGGGAGGG - Intergenic
985482357 5:122454-122476 CTGTCTCCTGGGCTGGAGTACGG + Intergenic
985482907 5:128570-128592 CTGCCTGCGGGGCTGGAGGTGGG + Intergenic
985697128 5:1346924-1346946 CTCTCAACAGGGCAGGGGGACGG - Intergenic
985814619 5:2117392-2117414 CTGTCTGCAAACCTGGGGGAAGG - Intergenic
985861106 5:2471336-2471358 CTGGCTGGGGGGTTGGGGGAAGG + Intergenic
985999558 5:3619894-3619916 GTCCCTGCAGGGCTGGGGGAGGG - Intergenic
986301493 5:6481673-6481695 ATGTGGGCAAGGCTGGGGGAAGG - Intronic
986539559 5:8829260-8829282 CTGTCTGCAGTGGTGGGCAAGGG - Intergenic
986653877 5:9991153-9991175 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
987307222 5:16648899-16648921 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
988370778 5:30364950-30364972 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
988829239 5:34971381-34971403 CTGTCTGCAGAGCTGGCTCAGGG - Intergenic
989149247 5:38282483-38282505 CTGTGGGGAGGGCTGTGGGAAGG + Intronic
989544759 5:42660037-42660059 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
989649637 5:43672991-43673013 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
989768761 5:45117505-45117527 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
990038255 5:51349085-51349107 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
990252656 5:53932368-53932390 CTGTTGGCAGGGCTAGGGGCTGG - Intronic
990635427 5:57720883-57720905 CTGACTCCAGGGCGGGGGCAGGG - Intergenic
991293029 5:65051059-65051081 GTTTCTGCAGGGCTGATGGATGG + Intergenic
992223586 5:74596928-74596950 CTGTGTTCAGGGCTTTGGGAAGG - Intergenic
992288043 5:75255700-75255722 GTGGCAGCAAGGCTGGGGGAAGG - Intergenic
992348160 5:75901800-75901822 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
993519080 5:88876649-88876671 CTGTCTTCGGGGTTTGGGGAAGG + Intronic
993834593 5:92802262-92802284 CTATCTGAAGGGCTGGTGCAAGG + Intergenic
993868230 5:93219855-93219877 CTGTGTGGAGGGGTGGGGGTGGG - Intergenic
994087286 5:95773238-95773260 CTTTATGCAGGGCTGGGGTCAGG + Intronic
994120614 5:96108811-96108833 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
994151186 5:96449453-96449475 TGGTGTGCAGGGTTGGGGGATGG - Intergenic
994729007 5:103470202-103470224 CTGTCTTCAGGACTGCGTGACGG + Intergenic
994908201 5:105868017-105868039 ATGTCTGCAGTGCTAGGTGAGGG + Intergenic
996055689 5:118979842-118979864 CTGTCAGGAGGGCAGGGGGTGGG + Intronic
996420427 5:123256625-123256647 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
997735324 5:136208770-136208792 CTGTCTGCTGGGTTGGGTGGGGG + Intergenic
997874394 5:137535536-137535558 GTGACAGCAAGGCTGGGGGAGGG + Intronic
998042506 5:138961030-138961052 CTATATGGAGGGATGGGGGAGGG + Intronic
998128763 5:139640689-139640711 CAGTGGACAGGGCTGGGGGATGG + Intergenic
998399734 5:141842452-141842474 CTGACTGCAGGACTGGGGCTGGG + Intergenic
998460653 5:142307676-142307698 CTGTCTGGAGAGCTGTAGGAGGG + Intergenic
998596051 5:143531620-143531642 CTGTCTTGGGGGCAGGGGGATGG - Intergenic
998656923 5:144191594-144191616 CTGTCTTCAGGGCTTAGGGAGGG - Intronic
998760226 5:145424323-145424345 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
999128488 5:149264659-149264681 CTGTCTCCATGGCTTGTGGATGG - Intergenic
999148401 5:149410860-149410882 CATACTGCTGGGCTGGGGGAGGG - Intergenic
999343747 5:150796437-150796459 CTGGCTGCAGAGCTGGTGGGAGG - Exonic
999555837 5:152741353-152741375 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
999867763 5:155719645-155719667 CCGGCAGCAAGGCTGGGGGAGGG - Intergenic
999907214 5:156154962-156154984 ATGTCTGCAGGGATGAGGCAGGG + Intronic
1000033618 5:157424755-157424777 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
1000158659 5:158577579-158577601 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1000747013 5:165046149-165046171 GTGGCAGCAGGGCTGGGGGAGGG - Intergenic
1000858658 5:166430601-166430623 GTGTCTGCCGGGTTGGGGGGAGG - Intergenic
1001269739 5:170302305-170302327 CTGTGTGTGGGGCTGGGGGAAGG + Intergenic
1001269896 5:170303103-170303125 CTGTGTCCAGGCCTGGGGGCAGG - Intergenic
1001597753 5:172908878-172908900 CTGGCTTCCCGGCTGGGGGAAGG + Intronic
1001629005 5:173160644-173160666 GTGTCGGCAGGGCTGGGTGAGGG + Intronic
1002213580 5:177612333-177612355 CTGTGTGGAGTGCTTGGGGAAGG + Intergenic
1002502917 5:179658725-179658747 CTGCCAGCAAGGCTGGGGGAGGG - Intergenic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1003024541 6:2542533-2542555 CTCTCTCCTGGGCTGGTGGAGGG - Intergenic
1003569129 6:7244845-7244867 CGGTCAGGAGGGCTGGGGTAAGG - Intronic
1004509918 6:16277117-16277139 CTGGTTGCAGGGCGGGGGGAAGG + Intronic
1004717187 6:18228807-18228829 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
1005166615 6:22929394-22929416 GTGTTTGCCAGGCTGGGGGAAGG - Intergenic
1005193891 6:23259987-23260009 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1005209417 6:23443367-23443389 GTCTCCTCAGGGCTGGGGGAAGG - Intergenic
1005924464 6:30430701-30430723 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1005997132 6:30938389-30938411 CAGTCTGCATGGCTGGCGGCAGG - Intergenic
1006323267 6:33333585-33333607 CTGTCTGGGGGAGTGGGGGAAGG + Intergenic
1006378638 6:33685229-33685251 CTGGCTGCAGGCCTGGGTGCTGG - Intronic
1006442276 6:34060040-34060062 CAGACTCCAGGGCTGGGGGGTGG + Intronic
1006656116 6:35594336-35594358 CTGTCTCGGGGGGTGGGGGAGGG + Intronic
1006856201 6:37134919-37134941 CTCTATGCAGGGATGGGGGTGGG + Intergenic
1006922038 6:37633559-37633581 CTGTCTGGGGGCCTGGGAGAAGG + Exonic
1007079108 6:39086219-39086241 CTGTCTGATGGGTTTGGGGAGGG - Exonic
1007335453 6:41152022-41152044 CTGGCTGCAGGACTTGGGGTTGG + Intronic
1007417500 6:41700630-41700652 GAGACTGCAGGGCTGGGGGCAGG + Intronic
1007708355 6:43805365-43805387 CTGTCTGCAGGGCCCTGGGGAGG - Intergenic
1008058095 6:46966311-46966333 GGGTGTGAAGGGCTGGGGGATGG - Intergenic
1009460293 6:63904637-63904659 CTCTCTGCAGTTCTTGGGGAAGG + Intronic
1009873784 6:69480625-69480647 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1010204926 6:73314415-73314437 CTGTCTGTGGGGTGGGGGGACGG + Intergenic
1010281720 6:74030377-74030399 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1010361819 6:75004114-75004136 GTGGCAGCAAGGCTGGGGGAAGG + Intergenic
1010463802 6:76143432-76143454 GTGGCAGCATGGCTGGGGGAGGG - Intergenic
1010664652 6:78614404-78614426 CTGTCAGTGGGGCAGGGGGAGGG + Intergenic
1010718448 6:79257013-79257035 ATGGCAGCAAGGCTGGGGGAGGG - Intergenic
1010944516 6:81958737-81958759 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1010983405 6:82395004-82395026 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1011187968 6:84699754-84699776 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
1011358521 6:86497814-86497836 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1012595198 6:101031024-101031046 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1012905145 6:105055771-105055793 CTGTCTGAAGGGTGGAGGGAAGG - Intronic
1012977195 6:105793268-105793290 CTGTCAGAATGCCTGGGGGAGGG - Intergenic
1013046787 6:106493797-106493819 CTGTCAGCAGGGGAGGGGAAGGG + Intergenic
1013077222 6:106782198-106782220 CTGTCAGCAGGACTGTGGGGTGG - Intergenic
1013298621 6:108781958-108781980 CTCTGTGAAGGGCTGGGGGAGGG + Intergenic
1013310960 6:108893449-108893471 TTATCTGCAGGGATCGGGGAAGG + Intronic
1013896697 6:115097400-115097422 CTGTCTGGGGTGATGGGGGAAGG - Intergenic
1014013841 6:116506862-116506884 CAGGCTGGGGGGCTGGGGGAGGG + Intronic
1014422958 6:121267550-121267572 GTGACAGCAAGGCTGGGGGAGGG + Intronic
1014448962 6:121561589-121561611 GTGGGTGGAGGGCTGGGGGAGGG - Intergenic
1015718226 6:136213809-136213831 GTGTCTGCGGGGTTGGGGCATGG - Intergenic
1015798254 6:137034558-137034580 CTGTGAGGAGTGCTGGGGGAGGG - Intronic
1015935231 6:138402288-138402310 CCTTCTGCAGGGCTGGGGACAGG + Intergenic
1015939157 6:138431508-138431530 CTGTCTGCAGGACAAGGGAATGG + Exonic
1017114831 6:150966940-150966962 GTGTCTGCAGCCCCGGGGGAGGG + Intronic
1017751208 6:157492083-157492105 CTGCCTGGAGGGCTGCTGGATGG - Intronic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018448180 6:163877851-163877873 CTAGCTACAGGGGTGGGGGAAGG - Intergenic
1018772510 6:166984276-166984298 CTGGCTCCAGAGCTGGGAGAGGG + Intergenic
1019014748 6:168871794-168871816 CTGGCTGCATGGCCGTGGGAGGG - Intergenic
1019359297 7:596490-596512 CTCTCAGCAGGGCTGGGGGTGGG - Intronic
1019437379 7:1028933-1028955 CTGCCTGCAGGGCCTGGGCAGGG - Intronic
1019462080 7:1165409-1165431 CTGACTGCAGGGTTGGAGCAGGG - Intergenic
1019564343 7:1672018-1672040 CTGGCTGTAGGACAGGGGGAGGG - Intergenic
1019997763 7:4735627-4735649 CTTTCCGCCGGGCTGGTGGACGG + Intronic
1020011860 7:4809575-4809597 GTGTCTGCAGGGCTGGAAGTGGG - Intronic
1020326350 7:6977567-6977589 GTGACAGCAAGGCTGGGGGAGGG - Intergenic
1021099783 7:16574648-16574670 GGGGCTGGAGGGCTGGGGGAGGG + Intronic
1021777968 7:24072469-24072491 CTGGCAGATGGGCTGGGGGAAGG + Intergenic
1022079740 7:27008155-27008177 GTGGCAGCAAGGCTGGGGGAAGG - Intergenic
1022366427 7:29723948-29723970 CTGGCTGCAGGGATGAGAGAGGG - Intergenic
1022472835 7:30692320-30692342 CTGACTGGAGAGCTGGGGAAGGG - Intronic
1022514927 7:30969438-30969460 CTGGCTGCAAGGGTGGAGGAGGG + Intronic
1022654744 7:32308165-32308187 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1023671933 7:42586314-42586336 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1023794253 7:43778866-43778888 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1024243911 7:47455221-47455243 ATGTTTGCAAGGCTGAGGGAAGG + Intronic
1024479057 7:49845123-49845145 CTGTCAGTGGGGGTGGGGGAAGG + Intronic
1024838023 7:53547435-53547457 ATGTCTGCAGGGTTGTGGGGGGG + Intergenic
1025032050 7:55565735-55565757 CTGGCTGCAGGGGTGGAGGTGGG + Intronic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1026338781 7:69417708-69417730 CGATCTTCAGGGCTGGAGGAGGG + Intergenic
1026869618 7:73842328-73842350 GGGGCTGCAGGGCTGGGGGAAGG + Intronic
1027987911 7:85318551-85318573 CAGTGGGTAGGGCTGGGGGAGGG - Intergenic
1028214873 7:88119491-88119513 CTTTTTTCAGGGGTGGGGGATGG + Intronic
1028791808 7:94861967-94861989 CTGTCTGCAAGCCAGGAGGAGGG - Intergenic
1028887078 7:95946146-95946168 CTGTCAGGGGGGCAGGGGGAGGG + Intronic
1029010069 7:97250445-97250467 CTGTCAGAGGGGCAGGGGGAGGG - Intergenic
1029059839 7:97786026-97786048 GTGGCAGCAAGGCTGGGGGATGG + Intergenic
1029124797 7:98288372-98288394 CAGTCGGCAGGGCTGGGCGGAGG + Intronic
1029149518 7:98470254-98470276 CTGCCTGCAGAGTTGAGGGAGGG + Intergenic
1029446685 7:100616970-100616992 CTTTCTGAGGGGCTGGGGGCAGG + Intergenic
1029543400 7:101197978-101198000 CTGTCTCCACGGATGTGGGAGGG + Intronic
1029693345 7:102197011-102197033 CTTTCTGACTGGCTGGGGGATGG - Exonic
1030079220 7:105762890-105762912 CTGTGAGCAGGGCTGTGGGGAGG + Intronic
1030179423 7:106690077-106690099 GTGACAGCAAGGCTGGGGGAGGG - Intergenic
1030467827 7:109924792-109924814 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1030476165 7:110035849-110035871 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1030526477 7:110660825-110660847 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1031009694 7:116513005-116513027 CGGCATACAGGGCTGGGGGAGGG - Intergenic
1031216287 7:118897198-118897220 CTCTCTGCAGGAATGGGGAATGG + Intergenic
1032018325 7:128393388-128393410 GTGCCTGCAGGGCTGGGGCTGGG - Intronic
1032383980 7:131508892-131508914 CTCACAGCAGGGCTGAGGGAGGG - Intronic
1032396244 7:131592076-131592098 CTGTGGCCAGGGCTGAGGGAAGG + Intergenic
1032417450 7:131747323-131747345 GTGTATGGAGGGGTGGGGGATGG + Intergenic
1032806765 7:135362950-135362972 CTGTCTGAAAGCCTGGGGGTGGG + Exonic
1033212126 7:139467801-139467823 CTGGGTGTCGGGCTGGGGGACGG - Intronic
1033422780 7:141218073-141218095 GTGTCTGCGGGGTTGGGGGTAGG - Intronic
1033631815 7:143165914-143165936 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1034369239 7:150580181-150580203 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1034480795 7:151319183-151319205 CTGTCTCCAGGGATGAGGAAGGG - Intergenic
1034499275 7:151439658-151439680 CTGACTGCAGGGCGAGGGGTTGG + Intronic
1035156147 7:156915101-156915123 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1035534245 8:378986-379008 GTGTCTGTAGGGCTGGGACAGGG - Intergenic
1035558826 8:589774-589796 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1035566145 8:642813-642835 ATGTCTACAGGACTGGGGGCTGG + Intronic
1035856016 8:2977257-2977279 CTGTCAGTAGGGTAGGGGGAGGG - Intronic
1036370268 8:8156368-8156390 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1036381596 8:8239453-8239475 GTGTCTGTTTGGCTGGGGGATGG - Intergenic
1036880624 8:12509263-12509285 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1036977607 8:13431747-13431769 CTATCTGTAGGGCTTGGGAAAGG + Intronic
1037656252 8:20886806-20886828 CTCTCTTCAGGGCTGGGACATGG - Intergenic
1037996223 8:23354276-23354298 CTGTCTGCAAGGTTGTGGGCTGG - Intronic
1038213025 8:25537442-25537464 GGGTCTGCAGGGCTGGGCGATGG + Intergenic
1038539936 8:28384003-28384025 CTGTTTACAGGGCAGGGTGAAGG - Intronic
1038598382 8:28911794-28911816 GTATCTGCAGGGTTGGGGGAGGG + Intronic
1039077650 8:33707115-33707137 CTCTCTGTATGGCTGAGGGAGGG - Intergenic
1039429097 8:37511722-37511744 CTGTATGATGGGCTGGGGGTGGG + Intergenic
1039850093 8:41357643-41357665 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1040339173 8:46431556-46431578 ATGGGTGCTGGGCTGGGGGACGG + Intergenic
1040364835 8:46704968-46704990 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1040753399 8:50739569-50739591 CTGGATGTGGGGCTGGGGGAGGG + Intronic
1041200157 8:55446006-55446028 CTGTCTGAAGGGCTGATTGATGG + Intronic
1041752263 8:61273578-61273600 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1042072870 8:64955984-64956006 CAAACTGCAAGGCTGGGGGAGGG + Intergenic
1042332539 8:67595595-67595617 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1042394512 8:68276721-68276743 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1042751454 8:72162388-72162410 CTGTCTGTCGGGGTGGGGGCAGG - Intergenic
1043386062 8:79748912-79748934 CTTTCTCCAGAGCTGGTGGAAGG - Intergenic
1043779568 8:84314020-84314042 AGTTCTGCATGGCTGGGGGAGGG + Intronic
1043791589 8:84475051-84475073 CTGGGTGGGGGGCTGGGGGAGGG - Intronic
1044073759 8:87793543-87793565 ATGGCTGCCTGGCTGGGGGAAGG + Intergenic
1044182995 8:89218601-89218623 GTGGCAGCGGGGCTGGGGGAGGG + Intergenic
1044548295 8:93483661-93483683 GTGGCGGCAAGGCTGGGGGAGGG + Intergenic
1044792867 8:95865529-95865551 CTGGTTCCAGGGCTGGGGAAAGG + Intergenic
1044960758 8:97528747-97528769 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1046542578 8:115605056-115605078 CCCTCTGCAGGGGAGGGGGAGGG + Intronic
1046554040 8:115753580-115753602 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
1046601277 8:116319770-116319792 CTGTCCACAGGGGCGGGGGAAGG + Intergenic
1047077291 8:121418298-121418320 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1047579638 8:126199822-126199844 GTGACAGCAAGGCTGGGGGAGGG + Intergenic
1047740247 8:127800906-127800928 GTGTCTGGAGGGCTGGGGCGTGG + Intergenic
1048254903 8:132898336-132898358 CTGGCTGAAGGGCTGGGCCATGG - Intronic
1048540308 8:135335809-135335831 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1048741361 8:137564172-137564194 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1048976052 8:139673797-139673819 CTCTCTGCAGGGGTGGGGAGGGG - Intronic
1048989107 8:139750980-139751002 CTGTCTGCAGCCCTTGGGGTGGG - Intronic
1049043450 8:140129990-140130012 CTGATTGCAGGGCTGGAGCAGGG + Intronic
1049248007 8:141572960-141572982 CTGTGTGCAGGGCGGGGTGGCGG + Intergenic
1049387910 8:142353608-142353630 CTCTCTGCAGGGCTGGGGGTGGG + Intronic
1049433679 8:142576647-142576669 CTGGCAGGAGGGCTGGGGGCAGG - Intergenic
1049438423 8:142598259-142598281 CTGGGTGCAGGGCTGGGTTAGGG - Intergenic
1049491226 8:142904155-142904177 CAGTCTGGAGGCCTGGGGGTTGG - Intronic
1049526544 8:143129745-143129767 CAGGCTTCAGGGCTGGGGGAAGG + Intergenic
1049624375 8:143613494-143613516 CTGGCTCCAGTGCTGGGGGTTGG - Intronic
1049676371 8:143891085-143891107 CTGGCTGCACAGCTGGGGGTCGG - Intergenic
1049703882 8:144029046-144029068 CTGTCGGAGGGGTTGGGGGAGGG + Intronic
1049875793 8:145019524-145019546 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1050034852 9:1424452-1424474 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1050476323 9:6045095-6045117 GTGTCTGCAGTGGTGGGTGAGGG + Intergenic
1051327498 9:15988862-15988884 GCGGCAGCAGGGCTGGGGGAGGG + Intronic
1051987249 9:23105515-23105537 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1052014320 9:23447312-23447334 CTGTATGCATGTCTGTGGGAGGG - Intergenic
1052117668 9:24668577-24668599 GTGGCAGCAAGGCTGGGGGACGG - Intergenic
1052379569 9:27755517-27755539 CTGTCGGCAGGGTTGGGGGAAGG + Intergenic
1052714498 9:32098942-32098964 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1052855449 9:33403628-33403650 CTTTCTGCAGGGGTGAGGCAGGG + Intergenic
1052894080 9:33731274-33731296 CAATCTTCAGGGCTGGGAGATGG - Intergenic
1052904073 9:33818063-33818085 CTGCCTCCAGGGATGGGGGAGGG - Intronic
1053023981 9:34715482-34715504 CTGGATGCAGAGCTTGGGGAAGG + Intergenic
1053582979 9:39426048-39426070 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1053683463 9:40499971-40499993 CTTTCTGCAGGGGTGAGGCAGGG + Intergenic
1053847160 9:42250909-42250931 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1053933442 9:43128286-43128308 CTTTCTGCAGGGGTGAGGCAGGG + Intergenic
1054104558 9:60984791-60984813 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1054280252 9:63124957-63124979 CTTTCTGCAGGGGTGAGGCAGGG - Intergenic
1054296567 9:63335469-63335491 CTTTCTGCAGGGGTGAGGCAGGG + Intergenic
1054394584 9:64639974-64639996 CTTTCTGCAGGGGTGAGGCAGGG + Intergenic
1054429233 9:65145173-65145195 CTTTCTGCAGGGGTGAGGCAGGG + Intergenic
1054501151 9:65876362-65876384 CTTTCTGCAGGGGTGAGGCAGGG - Intergenic
1054581784 9:66922058-66922080 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1054808930 9:69419477-69419499 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1055456564 9:76477793-76477815 TTGTTTCCAGAGCTGGGGGAGGG - Intronic
1055784920 9:79862319-79862341 GGGGCTGCGGGGCTGGGGGAGGG - Intergenic
1056043749 9:82695369-82695391 CTGCCTGCAGGCCTGGGGTCTGG - Intergenic
1056043758 9:82695405-82695427 CTGCCTGCAGGCCTGGGGTCTGG - Intergenic
1056154079 9:83817627-83817649 GTGTCGGCAGAGCTGGGGGCAGG + Exonic
1056224510 9:84482194-84482216 CAGTCTGCAGGGCAGAGAGAAGG - Intergenic
1056356419 9:85805466-85805488 GTGTCGGCAGAGCTGGGGGCAGG - Intergenic
1056417235 9:86388499-86388521 CTGTGTCCAGGGCTAGGAGAGGG - Intergenic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1056688373 9:88785144-88785166 ATACCTGCAGGGCTGGTGGATGG - Intergenic
1057077371 9:92145441-92145463 CTGCCACCAGGGCTGAGGGAGGG + Intergenic
1057110306 9:92463579-92463601 CAGCCTACAGGGCTGGAGGAGGG - Intronic
1057131063 9:92655050-92655072 CTGTCTCCAGTGCTGGGTGTGGG - Intronic
1057202746 9:93151490-93151512 CTGAGTGCAGGGATGGGTGATGG - Intergenic
1057483050 9:95460813-95460835 CAGGCAGCAGGGCTGGGCGAGGG - Intronic
1057546514 9:96022945-96022967 CTGTTGGCAGGGGTGAGGGACGG - Intergenic
1057879884 9:98785408-98785430 GTGTCTGCAGGTTTGGAGGAGGG - Intronic
1058134410 9:101291217-101291239 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
1058795912 9:108498199-108498221 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059617028 9:115962533-115962555 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1060110378 9:120902492-120902514 CTGTGGGCAGGGCGGGGGGTGGG + Exonic
1060189310 9:121582083-121582105 GGGGCTGCAGGGCTGGGGAAGGG + Intronic
1060258549 9:122053682-122053704 CAGGGAGCAGGGCTGGGGGAAGG + Intronic
1060274670 9:122173283-122173305 CTGCCTGCAAGGCAGGGTGAGGG + Intronic
1060337276 9:122737349-122737371 CCGGGTGGAGGGCTGGGGGAGGG - Intergenic
1060527199 9:124327319-124327341 ATGTCTGCAGGGCGAGGAGAAGG - Exonic
1060814439 9:126627214-126627236 CTGCCTGCAGGGCAGGGACAGGG - Intronic
1060925470 9:127452346-127452368 CTGCCTGCAAGGATGGGGAATGG - Intronic
1060976556 9:127768336-127768358 CTGGCACCAGGGCTGGGGAAGGG + Intronic
1061003632 9:127916452-127916474 CTGTCTCCAGGGCTGGGGCTGGG + Exonic
1061313062 9:129776786-129776808 CTGGCTCCAGGGGTGGGGGTGGG - Intergenic
1061368559 9:130185418-130185440 CTACCTCCTGGGCTGGGGGAGGG + Intronic
1061371013 9:130197604-130197626 CTGGCGGGAGGGCTGGGGGCAGG + Intronic
1061402584 9:130376475-130376497 CTGAGAGCAGAGCTGGGGGATGG - Intronic
1061431848 9:130536309-130536331 CTGCCAGCAGGGCTAGGGGAGGG + Intergenic
1061445388 9:130634499-130634521 CAGCTGGCAGGGCTGGGGGAAGG - Intronic
1061484651 9:130914216-130914238 CCCTCGGGAGGGCTGGGGGAGGG - Intronic
1061584811 9:131558722-131558744 CTGTCTCCTGGGATGGGGAAGGG - Intergenic
1061872749 9:133529397-133529419 CCCTTTGCAGGGCTGTGGGATGG + Intergenic
1062041706 9:134407413-134407435 CTGACTGCAGAGCTGGGTGGAGG + Intronic
1062091791 9:134682271-134682293 CAGGCAGCATGGCTGGGGGAAGG - Intronic
1062130463 9:134889897-134889919 CTGTCGGGAGGGCTGGAAGAAGG + Intergenic
1062243631 9:135552474-135552496 CTGTGTCCAGGGTCGGGGGAGGG - Intergenic
1062244932 9:135561427-135561449 CTGTGTCCAGGGCAGGGGTATGG - Intergenic
1062425345 9:136503673-136503695 CTTCCTGCAGGGCCTGGGGATGG - Intronic
1062474290 9:136719753-136719775 CTGTCTGCCAGGCTGGGGCTGGG - Intronic
1062523322 9:136968597-136968619 CTGTGAGCAGGCCTGAGGGAGGG + Intergenic
1062583132 9:137237019-137237041 TTCTCTGCAGGGCTGGGCCACGG + Intergenic
1062610947 9:137373195-137373217 TGGTCTGCAGGGCTGGGGCACGG + Intronic
1062681259 9:137782720-137782742 CAGTCAACGGGGCTGGGGGAGGG - Intronic
1187769276 X:22677245-22677267 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1188171968 X:26938589-26938611 CTGTTTGGAGGGCTGGGGGTGGG + Intergenic
1188417741 X:29956464-29956486 CTCTGTGCAGGGGTGGGGGCGGG + Exonic
1188450182 X:30300960-30300982 CTGTTTCCAGGGCTGGAGCAAGG + Intergenic
1188644892 X:32553775-32553797 CTGTCTTCAGTGTTGGAGGAAGG + Intronic
1188658618 X:32731316-32731338 GTGGCAGCAAGGCTGGGGGAGGG + Intronic
1189252514 X:39612521-39612543 CTGGCTCCTGGGATGGGGGAAGG - Intergenic
1189257852 X:39654280-39654302 TTGTGCCCAGGGCTGGGGGATGG + Intergenic
1189704776 X:43749003-43749025 CGGTATGCTGGGCTGGGGAAGGG - Intergenic
1190293200 X:49006951-49006973 CTGATTGCAGGGCTGGGGCAAGG + Intergenic
1190593212 X:52026151-52026173 CTGGCAGCGAGGCTGGGGGAGGG - Intergenic
1190907184 X:54738812-54738834 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1190966133 X:55303351-55303373 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1191066919 X:56358335-56358357 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1191087719 X:56587237-56587259 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1191092173 X:56635288-56635310 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1191124021 X:56935037-56935059 CTGGCAGCGAGGCTGGGGGAGGG + Intergenic
1191187017 X:57623988-57624010 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1191232710 X:58108505-58108527 GTGGCAGCAAGGCTGGGGGAAGG + Intergenic
1191266187 X:58396795-58396817 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1191589914 X:62870924-62870946 GGGTCAGCAAGGCTGGGGGATGG - Intergenic
1191683560 X:63866043-63866065 GTGGCAGCTGGGCTGGGGGAGGG - Intergenic
1191726047 X:64282355-64282377 CTGTCAGAAGGGGTGGGGGTAGG + Intronic
1191765641 X:64695548-64695570 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1191932016 X:66383970-66383992 ATGTCTACATGGCTGGGGAAAGG - Intergenic
1192204512 X:69087197-69087219 CTGTCTGCAGGAGTGGGGCAAGG + Intergenic
1192227805 X:69241399-69241421 CTGGCAGTAGGGCTGGGGCAGGG - Intergenic
1192436458 X:71146269-71146291 CTGGCTGAAGGGGTGGGGGAGGG - Intronic
1192547589 X:72026824-72026846 CTTTCTGCTGGGTTGGGTGATGG - Intergenic
1192714888 X:73628650-73628672 CTGTTGTCAGGGTTGGGGGAGGG + Intronic
1193004710 X:76602800-76602822 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1193157453 X:78189269-78189291 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1193522875 X:82552132-82552154 CTGGCAGCGAGGCTGGGGGAGGG - Intergenic
1193613038 X:83655303-83655325 ATGGCAGCAAGGCTGGGGGAGGG - Intergenic
1193620835 X:83750916-83750938 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1194068670 X:89293046-89293068 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1195172501 X:102282403-102282425 CTGTGGCCAGGGGTGGGGGAGGG + Intergenic
1195186365 X:102404692-102404714 CTGTGGCCAGGGGTGGGGGAGGG - Intronic
1195235275 X:102890585-102890607 CTGTGTGCAGAGGTGGGGGTGGG + Intergenic
1195417542 X:104636550-104636572 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1195632781 X:107076543-107076565 TAGTCACCAGGGCTGGGGGAAGG + Intronic
1195723573 X:107890825-107890847 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1195787946 X:108547816-108547838 GTGGCAGCAAGGCTGGGGGAGGG - Intronic
1196421686 X:115528722-115528744 CTGTGTGCAGGGGTGGGGGCGGG + Intergenic
1196641611 X:118068907-118068929 CTGCCTGAGGGGATGGGGGAAGG - Intronic
1196652912 X:118187105-118187127 CTGACTGCAGGTCTGGGGCAGGG + Intergenic
1196814144 X:119651731-119651753 ATGGCTGCAGGCCTGGTGGATGG - Intronic
1197461032 X:126741233-126741255 CAGGCTGCAGGGATGGGGGACGG + Intergenic
1197603056 X:128553570-128553592 CTGGCTGCAGGGGTGGGGTGGGG - Intergenic
1197619606 X:128733156-128733178 GTGGCTGCGAGGCTGGGGGAGGG + Intergenic
1198079597 X:133226826-133226848 CTGTCCGGAAGGTTGGGGGAGGG - Intergenic
1199508638 X:148594820-148594842 TTTTCTGCAAGGCTGGGGAAAGG - Intronic
1199657475 X:150010907-150010929 CTGTCTGCAGATCTGTGAGAGGG - Intergenic
1199991149 X:152988390-152988412 CTGTGTGCAGGACTCGGGGTGGG - Intergenic
1200064893 X:153499636-153499658 CTGCCTGAGGGGCTGGGGGCTGG - Intronic
1200102367 X:153694458-153694480 CTGAGGGCTGGGCTGGGGGATGG + Intronic
1200297729 X:154939449-154939471 GTGGCAGCAAGGCTGGGGGATGG + Intronic
1200722815 Y:6627201-6627223 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1200751977 Y:6954381-6954403 GTGGCTGCAAGGCTGGGGGAGGG - Intronic
1200775522 Y:7167020-7167042 CTCTCTGGATGGCTGGGGAATGG - Intergenic
1200805413 Y:7428402-7428424 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1201476848 Y:14391614-14391636 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1201517905 Y:14837617-14837639 CTGTCTGCAGGGTTTGGTAAGGG + Intronic
1201795251 Y:17889963-17889985 GTGGCAGCATGGCTGGGGGAGGG + Intergenic
1201806304 Y:18016021-18016043 GTGGCAGCATGGCTGGGGGAGGG - Intergenic
1201910009 Y:19124396-19124418 CTTTCTGCATGGCTGAGGAATGG - Intergenic
1201945905 Y:19509786-19509808 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1201957193 Y:19638446-19638468 CTGTCTGCAGTGGCGGGTGACGG + Intergenic
1202255923 Y:22920220-22920242 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1202356688 Y:24059045-24059067 GTGGCAGCATGGCTGGGGGAAGG + Intergenic
1202408914 Y:24553973-24553995 GTGGCAGCAAGGCTGGGGGAGGG + Intergenic
1202461869 Y:25116105-25116127 GTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1202514090 Y:25611065-25611087 GTGGCAGCATGGCTGGGGGAAGG - Intergenic
1202601931 Y:26602201-26602223 GTGGCTGCAAGGCCGGGGGAGGG + Intergenic