ID: 1162502031

View in Genome Browser
Species Human (GRCh38)
Location 19:11059646-11059668
Sequence CAGCTGTCCAGGGGCAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 195}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162502026_1162502031 4 Left 1162502026 19:11059619-11059641 CCGCTGAGGCTCGCATTGGCCAC 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1162502031 19:11059646-11059668 CAGCTGTCCAGGGGCAACACAGG 0: 1
1: 0
2: 2
3: 21
4: 195
1162502023_1162502031 9 Left 1162502023 19:11059614-11059636 CCGACCCGCTGAGGCTCGCATTG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1162502031 19:11059646-11059668 CAGCTGTCCAGGGGCAACACAGG 0: 1
1: 0
2: 2
3: 21
4: 195
1162502021_1162502031 11 Left 1162502021 19:11059612-11059634 CCCCGACCCGCTGAGGCTCGCAT 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1162502031 19:11059646-11059668 CAGCTGTCCAGGGGCAACACAGG 0: 1
1: 0
2: 2
3: 21
4: 195
1162502025_1162502031 5 Left 1162502025 19:11059618-11059640 CCCGCTGAGGCTCGCATTGGCCA 0: 1
1: 0
2: 0
3: 21
4: 109
Right 1162502031 19:11059646-11059668 CAGCTGTCCAGGGGCAACACAGG 0: 1
1: 0
2: 2
3: 21
4: 195
1162502019_1162502031 27 Left 1162502019 19:11059596-11059618 CCTGGGTGGGCTGAAGCCCCGAC 0: 1
1: 0
2: 0
3: 16
4: 214
Right 1162502031 19:11059646-11059668 CAGCTGTCCAGGGGCAACACAGG 0: 1
1: 0
2: 2
3: 21
4: 195
1162502022_1162502031 10 Left 1162502022 19:11059613-11059635 CCCGACCCGCTGAGGCTCGCATT 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1162502031 19:11059646-11059668 CAGCTGTCCAGGGGCAACACAGG 0: 1
1: 0
2: 2
3: 21
4: 195
1162502018_1162502031 28 Left 1162502018 19:11059595-11059617 CCCTGGGTGGGCTGAAGCCCCGA 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1162502031 19:11059646-11059668 CAGCTGTCCAGGGGCAACACAGG 0: 1
1: 0
2: 2
3: 21
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162502031 Original CRISPR CAGCTGTCCAGGGGCAACAC AGG Intronic
900334246 1:2153624-2153646 CTGCTGGCCAGCGGCAGCACAGG + Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901244741 1:7720907-7720929 CACCTGTCCAGGGGCAAGAGAGG - Intronic
901433567 1:9233170-9233192 CAGGTGTCCAGAGGCATGACCGG - Intergenic
902245302 1:15116903-15116925 CAGCAGGCCTGAGGCAACACGGG + Exonic
902411071 1:16211936-16211958 CAGCTGGTCAGTGTCAACACTGG - Intronic
902605903 1:17569250-17569272 CAGCTGTTCTGGGGCACCTCTGG - Intronic
908410641 1:63861140-63861162 CAGCTGTCCAGGAGGAATCCGGG + Intronic
912972517 1:114297360-114297382 CTGGTTTCGAGGGGCAACACGGG + Intergenic
913209706 1:116571970-116571992 CAGCTGGGCAGGGGCAACTCTGG - Intergenic
913318276 1:117571192-117571214 TAGCTGATCAGGGGCCACACAGG - Intergenic
917671893 1:177281035-177281057 CAGCTGCCCAGTGCCAAAACTGG + Exonic
920678696 1:208056718-208056740 CAGGGGTCCAGGGGCTGCACTGG + Intronic
921180169 1:212625779-212625801 CACCTGTCCAGGGGCAGAATTGG - Exonic
924003758 1:239583976-239583998 CAGCTGACAAGGGGCAAAGCAGG - Intronic
1062854173 10:771352-771374 AAGCTGTGCAGGGGCCACAGAGG + Intergenic
1063502302 10:6566380-6566402 CAGCTGTCCAGGTGAAATCCTGG + Intronic
1065666939 10:28072994-28073016 CTGCTGTCCAGGGGCTGCATGGG - Intronic
1066733412 10:38452493-38452515 CAGCTGTGCCGGGGGAAAACTGG - Intergenic
1067385318 10:45813070-45813092 CAGCTGTTCAGAAGCACCACTGG - Intergenic
1069948926 10:72006203-72006225 CAGCTGTAGAGGGCCAACATGGG - Intronic
1070761148 10:79025136-79025158 GAGCTGTCCTTGGGCATCACTGG - Intergenic
1070803659 10:79257725-79257747 CAGGTGTCCAGTGGAAAGACGGG + Intronic
1071713837 10:88075281-88075303 AAGCTGGTCAGCGGCAACACTGG - Intergenic
1072826174 10:98608946-98608968 TTGCTGTCCAGTGGCCACACAGG - Intronic
1076522756 10:131091157-131091179 CAGCAGTCCAGGGGCCACGCAGG + Intergenic
1076690202 10:132219831-132219853 CTTCTGCCCAGGAGCAACACAGG + Intronic
1076869685 10:133187246-133187268 CAGCTGACCAGGGGCAGCACTGG - Intronic
1081573217 11:44304084-44304106 CACCTGTCTAGTGGCACCACAGG + Intronic
1081614702 11:44583842-44583864 CAGGGGTCCAAGAGCAACACAGG - Intronic
1088172727 11:107017448-107017470 GGGCTGTCCAGGGGGAACAGTGG + Intronic
1090644661 11:128758007-128758029 AAGCTGTCCTGGGGCAGCCCTGG + Intronic
1091656056 12:2347784-2347806 AAGCTGGCCAGGGACATCACTGG - Intronic
1095120888 12:38417295-38417317 CAGATGACCAGGGGTGACACAGG - Intergenic
1097178355 12:57156536-57156558 CACCTGGCCATGGGCAACCCTGG + Intronic
1104674860 12:130705502-130705524 CAGCTGTCCCAGGCCCACACAGG + Intronic
1105578171 13:21671979-21672001 GGGCTGTCCACCGGCAACACGGG - Exonic
1107574461 13:41702816-41702838 CAGAAGTTGAGGGGCAACACTGG - Intronic
1113292944 13:108925918-108925940 CTACTGTCCAAGGGAAACACTGG - Intronic
1113450844 13:110408211-110408233 CAGCTGTGCTGGGGCCACAAGGG + Intronic
1113543820 13:111131169-111131191 CAGCTCTCCATGGGCAACCGTGG - Intronic
1113547084 13:111161406-111161428 CAGCTGGCGAGTGGCAACACAGG - Intronic
1113929484 13:113958826-113958848 CAGCTGTGCAGGGGCCAGAGAGG - Intergenic
1115681413 14:35742936-35742958 CAGCAGCTCAGGGGCAAGACAGG + Intronic
1115710608 14:36046772-36046794 CAGCTGGCCAGTGGCAAAATGGG + Intergenic
1118126515 14:62910774-62910796 CTGCTTTCCAGAGGGAACACCGG - Intronic
1118765084 14:68904254-68904276 CAGCTGTCCAGAGACCACCCAGG + Intronic
1118907191 14:70031634-70031656 CAGCTTTCCACAGGCATCACAGG + Intronic
1119172064 14:72543246-72543268 CAGCTGACCAGGCAAAACACAGG + Intronic
1119173847 14:72554924-72554946 CAGCTGTGCAGGGACAAATCCGG - Intronic
1119962533 14:78875982-78876004 CAGCTGGTTAGGGGCAAAACTGG + Intronic
1122206735 14:100151403-100151425 CAGCTGAGCATGGGCAGCACAGG + Intronic
1122828910 14:104386055-104386077 CTGCTGTCCAGAGGCACCGCTGG + Intergenic
1125676186 15:41503723-41503745 CAGGTGTCCATGGGGAGCACTGG - Exonic
1125723911 15:41858548-41858570 CAGCTCTCCAGGCAGAACACAGG - Intronic
1128044875 15:64608934-64608956 CAGATCTGCAGGGGCAACATAGG - Intronic
1128881548 15:71247725-71247747 CAGCAGTGAAGGGGCAACACAGG + Intronic
1131107313 15:89743955-89743977 CAGCAGGCCAGGGGCAGCAGTGG - Intergenic
1131153886 15:90063153-90063175 GAGCTGTCCTGGGTCACCACAGG - Intronic
1132336028 15:101049319-101049341 CATCTGTCCAGCAGCAACCCTGG - Intronic
1132456403 16:26055-26077 CAGCTCTCCAGGGCCCACTCAGG + Intergenic
1132836912 16:1958798-1958820 CTGCTATCCAGGGGGGACACTGG - Intergenic
1134032986 16:11007466-11007488 CAGCTGTTCAGGGGCAGAGCTGG - Intronic
1134912390 16:18039449-18039471 AACCTGTCCAAGGTCAACACAGG - Intergenic
1135980061 16:27140433-27140455 CAGATGCCCAGGGGCCACACTGG + Intergenic
1139167043 16:64578993-64579015 CAGCAGTCCAGGGTTGACACAGG + Intergenic
1139287090 16:65825438-65825460 CAGCTGTCCAGGGAGCACTCAGG + Intergenic
1139961880 16:70722547-70722569 GGGCTGTCCAAGGGCAACCCAGG + Intronic
1141407778 16:83808563-83808585 CAGCTGTCCAGAGGCAGAAATGG + Intronic
1141672318 16:85498773-85498795 CAGCTGGCCAGGGGTGGCACAGG + Intergenic
1142187248 16:88700483-88700505 CAGATGTCCAGGGGCTGCCCTGG - Intronic
1142668340 17:1475118-1475140 CAGCTGCCCAGGTGCACCCCAGG + Intronic
1144077444 17:11732113-11732135 CTACTATCCAGGGGCAACAATGG - Intronic
1144670885 17:17131990-17132012 CAGCTGGGGAGGGGCAGCACGGG + Intronic
1145250243 17:21293455-21293477 CAGCTGCACAGGGGCAACCATGG - Intronic
1149302120 17:55315212-55315234 CAGCTGACCTGGAACAACACAGG - Exonic
1150956062 17:69862012-69862034 CAGCTTTGCAGGGGCAAAATAGG - Intergenic
1151101771 17:71563949-71563971 CAGCTGTCCAGGGGCCCCAAAGG + Intergenic
1152512647 17:80800980-80801002 CTGCTGTCCCTGGGCCACACGGG - Intronic
1153194608 18:2580680-2580702 CAAATGTCCATGGGCATCACCGG - Intronic
1156365298 18:36420558-36420580 CAGCTGTCCCGAGCCAACAAGGG - Intronic
1157659888 18:49431819-49431841 CAGCTGTCCATGTGCATCATCGG - Intronic
1161329533 19:3679646-3679668 CAGCTGTGGAGGGGGAGCACTGG + Intronic
1162502031 19:11059646-11059668 CAGCTGTCCAGGGGCAACACAGG + Intronic
1162522475 19:11189951-11189973 GAGCTGGCCAGGAACAACACGGG + Intronic
1162528545 19:11222074-11222096 CACCTGTCCTGGGGCTAGACAGG + Intronic
1162799878 19:13104515-13104537 CAGCTCTCCAGGGGCCACAGTGG - Intergenic
1164616219 19:29668239-29668261 CAGCAGCCCTGGGGCCACACTGG + Intronic
1166262749 19:41652679-41652701 GTCCTGTCCAGGGGCAGCACCGG - Intronic
1167745779 19:51351105-51351127 CAGCTGCCCAGGGGCCACATAGG - Intronic
925109528 2:1322289-1322311 CTGCTCTCCAGAGGCAACCCTGG + Intronic
925851935 2:8090405-8090427 AAGCTGCCCAGGGGTAACTCAGG - Intergenic
925962403 2:9030015-9030037 CAGCTGTGCCGGGTCAACTCTGG + Intergenic
927640399 2:24841975-24841997 CAGCTGTTGAGGGCCAGCACTGG - Intronic
930107844 2:47654056-47654078 CAGCTGTCCAGTGGGGACACAGG - Intergenic
930219774 2:48734750-48734772 CTGCTGTCCAGGGTCAAAAAAGG + Intronic
931283604 2:60814620-60814642 AGGCTGTGCAGGTGCAACACTGG - Intergenic
931621439 2:64214009-64214031 CAGATCTCTAGGGGCAGCACGGG + Intergenic
932340494 2:70960214-70960236 CAGCTGTCCCTGGGCAGCTCAGG + Intronic
932492411 2:72130842-72130864 CAGCTGTCCGGAGACCACACAGG + Exonic
933864924 2:86507719-86507741 CAGCTGGCCAAAGGAAACACTGG + Intronic
935198002 2:100831788-100831810 AAACTGTCCAGGGGAAGCACGGG + Intronic
937304578 2:120863306-120863328 CCCTTGACCAGGGGCAACACGGG - Intronic
937485204 2:122308434-122308456 CACCTGTCCAAGGGCAACTGTGG - Intergenic
937880751 2:126862821-126862843 CAGCTGGCAAGGGGCAAGCCAGG + Intergenic
938241389 2:129744835-129744857 CGGGTGTCCAGAGGCAGCACTGG + Intergenic
942123441 2:172801132-172801154 CAGCTTTCCCAGGGCCACACAGG + Intronic
942123953 2:172804742-172804764 CAGCAATCCAGGGGCAAAAAAGG - Intronic
944987168 2:205190598-205190620 CAGCTGGCCAGGGGCAAAGCTGG - Intronic
946923766 2:224605392-224605414 CATTTGTCAAGGGGCAACACTGG + Intergenic
948127300 2:235573849-235573871 CAGCTGGCCAGGCTCAGCACTGG - Intronic
948175146 2:235937453-235937475 CTGCTGACCAGGGGAAACAGAGG + Intronic
1170534133 20:17323696-17323718 CAGTTTTCCATGGGCAGCACAGG + Intronic
1171458214 20:25283607-25283629 CAGCTCTCCAGGGGCAAAGAGGG - Intronic
1172602108 20:36190937-36190959 GAGCTGCCCAGGGACAGCACTGG - Intronic
1175389887 20:58620344-58620366 CAGGAGTCCAGGGGCCTCACTGG - Intergenic
1175576087 20:60061751-60061773 CAGCTTGGGAGGGGCAACACTGG - Intronic
1175924936 20:62466967-62466989 CGGGTGTCCAGGGGGACCACAGG - Intronic
1176044718 20:63086613-63086635 CAGCTGACCAGGTGCCACAGGGG - Intergenic
1176178158 20:63738227-63738249 GAGGTGTCCAGGGACATCACCGG + Exonic
1176238684 20:64065965-64065987 CAGCTGTGAAGGGCCAACCCAGG - Intronic
1179110707 21:38442724-38442746 CAGCTACCAAGGGGCATCACAGG + Intronic
1179827318 21:43973476-43973498 TAGCTGTCCAAGGTCAGCACTGG + Intronic
1179907978 21:44434032-44434054 CAGCTGTCCTGGGGCAGCCACGG + Intronic
1179999996 21:44991234-44991256 CAGCTGTGCTGGGGCAAGTCTGG + Intergenic
1181763992 22:25078071-25078093 CAGCTGGCCAGGGGCAGAGCTGG + Intronic
1184676376 22:46045403-46045425 AGGCTGCCCAGGGGCAGCACAGG + Intergenic
1185153547 22:49179944-49179966 CTGCAGCCCAGGGGCAACACAGG - Intergenic
1185208556 22:49553985-49554007 CCGGTGTCCATGGGCCACACTGG - Intronic
1185403265 22:50629502-50629524 CAGGTGACCAGTGGCAAGACCGG - Intergenic
1185404532 22:50640106-50640128 CAGGTGACCAGTGGCAAGACCGG - Intergenic
950044999 3:9943778-9943800 CAGCAGGCCAGGGCAAACACTGG - Intronic
950639037 3:14336068-14336090 CAGCTGTCCAGGGTCAAGTTCGG + Intergenic
952358213 3:32604347-32604369 CAGCAGTTCAGGGGCAAAGCAGG + Intergenic
953347340 3:42187282-42187304 CAGCTCTGCACGGGCAATACAGG - Intronic
954392454 3:50274795-50274817 CAGCTGTCCGGGAGCACCAATGG + Intronic
961214054 3:125146173-125146195 CAGCTATCCACGGTCAACAGTGG - Intronic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
963064613 3:141253322-141253344 CAGCTGCCCAGAGGCCACACAGG - Intronic
965601469 3:170458723-170458745 CACCTGTCCAGGGGCAGTCCAGG + Intronic
967818013 3:193815433-193815455 CCTAGGTCCAGGGGCAACACAGG - Intergenic
968705446 4:2075432-2075454 CAGGTAGCCTGGGGCAACACAGG - Exonic
969291806 4:6244945-6244967 CAGGTGACCAGGGGTAACTCGGG + Intergenic
969429374 4:7145266-7145288 CAGCTGCCCAGGGGCAGCAGGGG - Intergenic
969844700 4:9911236-9911258 CCGCTGCCCAGGGGCTACAGGGG + Intronic
970586533 4:17519748-17519770 CAGCTTTCCTAGGGCAGCACTGG + Intronic
971255143 4:25007777-25007799 CAGCTGTCCATGTGCACCAGGGG - Intronic
971261666 4:25062901-25062923 TAGCTGTCAAGGGGTAAGACTGG - Intergenic
972302680 4:37799718-37799740 GAGCTGCCCAGGGGCCCCACTGG - Intergenic
981239065 4:142452629-142452651 CAGCTGACCAGTGGCCACACGGG + Intronic
981498636 4:145421837-145421859 CACATGCCCAGGGGCATCACAGG - Intergenic
985592287 5:771641-771663 CAGAGGCCCAGGGGAAACACAGG - Intergenic
985641858 5:1067154-1067176 CAGCTGCCCGGGCGCAAGACGGG + Intronic
986332269 5:6726438-6726460 GAGCTGACCAGAGGCAACGCAGG - Intronic
990318180 5:54603676-54603698 CAACTGTCCTGGGGCTACACTGG + Intergenic
990744062 5:58940611-58940633 CAGCTGTGCAGAGAGAACACTGG - Intergenic
993557606 5:89360650-89360672 CAGATGTCCAGTGGCATCCCTGG + Intergenic
996343333 5:122462512-122462534 GAGCTGTCCATGGGCAAGAAAGG - Intronic
996749297 5:126872945-126872967 CAGCTGTTCAGGGCCAACAGCGG + Intronic
997675351 5:135708604-135708626 CAGCTATCCCAGGGCAACCCTGG + Intergenic
998564816 5:143207515-143207537 AAGCTGGCCAGGGACAACAGGGG + Intronic
999314922 5:150577054-150577076 CAGCTGGCCAGGGGGAGCGCTGG - Intergenic
1000397792 5:160794297-160794319 CAGTTGTCCAGAGGAAACAGGGG - Intronic
1002594182 5:180311623-180311645 CAGCTGTCCAGTGGCAGCTCTGG + Intronic
1008507253 6:52243462-52243484 GAGCTGTCCAAAGTCAACACTGG + Intronic
1010352539 6:74891517-74891539 CAGCTTGCCAGGAGAAACACTGG + Intergenic
1012206588 6:96468513-96468535 CAGCTGGCAAGTGGCAGCACTGG - Intergenic
1012475822 6:99613914-99613936 CAGCGCTCGAGGGGCAACCCCGG - Exonic
1012672612 6:102074019-102074041 CAGGTGACCAGGGGTGACACAGG + Intergenic
1015329010 6:131955531-131955553 AAGCTGACTAGAGGCAACACAGG - Intergenic
1017769931 6:157637174-157637196 CAGGTGTCCAGAGGAAAGACAGG - Intronic
1017926522 6:158915597-158915619 CAGCTCTCCAGGGGCAACTCAGG - Intergenic
1018752780 6:166821909-166821931 CAGATGTTCAGGTTCAACACTGG + Intronic
1018891504 6:167986233-167986255 CTGCTGGTCAGGGGCCACACTGG + Intergenic
1018915156 6:168128526-168128548 CAGCAGCCCAGGGGCATCCCCGG + Intergenic
1019667312 7:2258343-2258365 CAGCTGTCCCGCGGGAACGCAGG - Intronic
1019745930 7:2700390-2700412 CTGCTGTCCATGGGCCACCCGGG - Exonic
1023640376 7:42251120-42251142 GTACTGTCCTGGGGCAACACTGG + Intergenic
1023870048 7:44258495-44258517 CAGCTGGACTGGGGCACCACTGG - Intronic
1024038822 7:45533479-45533501 CGGCTGTCCCAGGCCAACACTGG + Intergenic
1024322323 7:48083723-48083745 CAGCTGCCCAGAGGCTTCACAGG - Intergenic
1024757298 7:52549952-52549974 CTGCTGTCCAGGGTCAAAGCTGG - Intergenic
1025120506 7:56297707-56297729 CAGCTTTTCAGGGGCAAGAGTGG - Intergenic
1027269118 7:76510645-76510667 CAGCTGTCATGGGGCTACCCTGG + Exonic
1030979457 7:116169191-116169213 CAGATGTCCAGGGAAAACAAAGG - Intergenic
1032263899 7:130357078-130357100 TAGCTGGCCAGGGGCAAAGCTGG - Intronic
1033438633 7:141357898-141357920 CAGGTGTCCAGGTGCAAAACAGG + Intronic
1034512004 7:151543238-151543260 AAGCTGTCCAAGAGCTACACAGG + Intergenic
1035475214 7:159138743-159138765 CAACTCTCCAGGGGCAACTTGGG + Intronic
1039179730 8:34852688-34852710 CAGCTTTTCAGTGGCAAAACTGG + Intergenic
1039807770 8:41016010-41016032 CAGCTGTCATGAGGCAACAGGGG - Intergenic
1040313896 8:46250896-46250918 CAGCTTGCCTGGGACAACACTGG - Intergenic
1040339496 8:46433293-46433315 CAGCTGGCCAGGGACAGCCCTGG - Intergenic
1040519234 8:48160637-48160659 CAGATCTCCAGGGGCAGGACTGG + Intergenic
1043769849 8:84184452-84184474 CGGGTGTGCAGTGGCAACACTGG + Intronic
1044514963 8:93127150-93127172 CATTTGTTCAGGGGCAAAACTGG + Intergenic
1046082484 8:109388256-109388278 CAGCTCCCCAAGGGCAACAAAGG + Intronic
1046094328 8:109539730-109539752 CAGCTGCGCAGAGGCAACGCAGG + Intronic
1048078393 8:131098177-131098199 GAGCTGGCCAGAAGCAACACTGG + Intergenic
1049137908 8:140922165-140922187 CAACTGTCCTGGGGCATCACTGG - Intronic
1049362361 8:142218332-142218354 CAGCTCTCCAGGGTGGACACTGG - Intronic
1049422630 8:142523714-142523736 CAGGTTTCCATGGGCACCACAGG + Intronic
1049551756 8:143263238-143263260 CAGCTGGGCGGGGGCACCACCGG + Intronic
1056249440 9:84732985-84733007 CTGCAGTCCAGAGGCAGCACAGG - Intronic
1056333040 9:85537590-85537612 CACCTGTCAAGGGGCAATAATGG - Intergenic
1057630005 9:96711926-96711948 CAACTTTCCTGGCGCAACACAGG - Intergenic
1057787100 9:98095580-98095602 GGGCTGTCCAGGTGCAAAACAGG - Intronic
1059643533 9:116240739-116240761 CAGCTATCAAGGGGCAAAGCTGG + Intronic
1060599841 9:124870068-124870090 AAGGTGTCCAGGGGAACCACAGG - Intronic
1060956643 9:127646092-127646114 CGGCTGTCCAGGTGCAAGAAAGG - Intronic
1061199807 9:129131280-129131302 CAGGAGTCTAGGGGCAAAACAGG - Intronic
1062027966 9:134349283-134349305 CGGCTGTCCAGGTGCAGAACAGG - Intronic
1062155643 9:135046734-135046756 CAGTGGTCCAGGGACAACATGGG - Intergenic
1185743025 X:2549144-2549166 CAGCAGTCCTGGGGCTACTCTGG - Intergenic
1185796326 X:2968157-2968179 CAGCTGTGTAAGGGCGACACTGG + Intronic
1189300196 X:39946985-39947007 CAGCTGTCAGGGGCCACCACAGG + Intergenic
1190233941 X:48601884-48601906 CAGCCGGCCAGGGGCATCAAAGG - Exonic
1190246703 X:48695703-48695725 CAGCTGGCCAGGAGCAAAATCGG + Exonic
1200399960 X:156013668-156013690 CAGCTCTCCAGGGCCCACTCAGG - Intergenic