ID: 1162502068

View in Genome Browser
Species Human (GRCh38)
Location 19:11059794-11059816
Sequence CGTGCGGCAGAAAATCGAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162502062_1162502068 23 Left 1162502062 19:11059748-11059770 CCCAGATCTATGAAGACTCCATC 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1162502068 19:11059794-11059816 CGTGCGGCAGAAAATCGAGAAGG 0: 1
1: 0
2: 0
3: 1
4: 37
1162502065_1162502068 5 Left 1162502065 19:11059766-11059788 CCATCGTCTTGCAGTCGGTCTTC 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1162502068 19:11059794-11059816 CGTGCGGCAGAAAATCGAGAAGG 0: 1
1: 0
2: 0
3: 1
4: 37
1162502063_1162502068 22 Left 1162502063 19:11059749-11059771 CCAGATCTATGAAGACTCCATCG 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1162502068 19:11059794-11059816 CGTGCGGCAGAAAATCGAGAAGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162502068 Original CRISPR CGTGCGGCAGAAAATCGAGA AGG Exonic
903837674 1:26216065-26216087 CTGGCCGCAGAAAATCGAGGTGG + Intergenic
905823418 1:41011873-41011895 GTTGCGGCAGAACATCGCGATGG + Exonic
1070670341 10:78373217-78373239 CGTGTGCGAGAAAATGGAGAGGG - Intergenic
1072591501 10:96832290-96832312 CGGGCGGCAGAAGATGGCGAGGG + Intronic
1073425309 10:103452258-103452280 CGTGCAGAAGAAAAGCGGGAGGG - Exonic
1081983515 11:47285043-47285065 CGTCAGGCAGAAATTGGAGAGGG + Exonic
1082886910 11:58095149-58095171 CCTGCTGTAGAAAATCTAGAGGG - Intronic
1099926350 12:89023090-89023112 AGAGAGGCAGAAAATAGAGATGG - Intergenic
1102446246 12:113005032-113005054 CGAGCGGCACAAAATCGTCAAGG + Exonic
1107248304 13:38324534-38324556 CGTGAGACAGAAAAGCTAGAAGG - Intergenic
1109603058 13:64658019-64658041 CATGGGGCAGAAAATCGAAGAGG - Intergenic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1119602235 14:75983956-75983978 GGTGTGGCAGAAAATCAAGCAGG + Intronic
1137756503 16:50906469-50906491 AGGGCGGCAGAAAATGGGGAGGG - Intergenic
1138444982 16:57058104-57058126 CCTGCGGCAGACATTCCAGAAGG - Exonic
1158082057 18:53604319-53604341 AGAGCTGCAGAAAATCTAGAGGG - Intergenic
1160578705 18:79871587-79871609 CTTGCGGCAGCAAGTCGAGTGGG + Intronic
1162502068 19:11059794-11059816 CGTGCGGCAGAAAATCGAGAAGG + Exonic
1166055495 19:40285582-40285604 CGTGGGGCGGAAAGGCGAGATGG + Intergenic
929919141 2:46160275-46160297 AGTGCGGCAGAGAAGGGAGAGGG - Intronic
934846528 2:97664246-97664268 CGGGCGGCAGAAAGTGGAGCTGG + Intergenic
938310720 2:130286724-130286746 CAAGTGGCAGAAAATCCAGAAGG - Intergenic
938387482 2:130877220-130877242 CATGGGGCAGAAAGTGGAGAGGG + Intronic
1172446826 20:34997550-34997572 GGTGCGGCAGAAGCTGGAGAAGG + Exonic
1181662481 22:24362431-24362453 GGTGAGGCTGAAAATGGAGATGG + Intronic
954597211 3:51836555-51836577 AGTGAGGAAGAAAATAGAGAAGG + Intergenic
966842018 3:184097574-184097596 CTTGAAGCAGAAAACCGAGAAGG - Intronic
967358065 3:188595847-188595869 AGTTGTGCAGAAAATCGAGAAGG + Intronic
968481300 4:834293-834315 CGTCCGGCAGAAAATCTGAATGG - Intergenic
982207684 4:153009223-153009245 TGTGCGGCACAAAATCCAAATGG + Intergenic
990149499 5:52800403-52800425 CGTGAGGAAGAACATCGAGAAGG + Exonic
997826449 5:137111058-137111080 CGTGCATCACAAAATCGATAGGG + Intronic
1008372613 6:50751591-50751613 CATGTGGGAGAAAATGGAGACGG - Intronic
1037455047 8:19054549-19054571 TGTGGGGAAGAAAATGGAGATGG - Intronic
1045011439 8:97962228-97962250 TATGAGGCAGAAAATCTAGAAGG + Intronic
1051193695 9:14540274-14540296 CCTGTGTCAGAAAATAGAGAGGG - Intergenic
1053166209 9:35845980-35846002 CGTGCGCCAGGAAAACGTGACGG + Exonic
1054949026 9:70828245-70828267 AATGGGGCAGAAAATAGAGATGG + Intronic
1201222051 Y:11781488-11781510 TGTGGAGCAGAAAAACGAGATGG - Intergenic