ID: 1162502951

View in Genome Browser
Species Human (GRCh38)
Location 19:11064936-11064958
Sequence CTGAGTCAGCACCTCTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162502946_1162502951 -9 Left 1162502946 19:11064922-11064944 CCCGGGCCCAAATGCTGAGTCAG 0: 2
1: 0
2: 0
3: 17
4: 216
Right 1162502951 19:11064936-11064958 CTGAGTCAGCACCTCTGCCCGGG 0: 1
1: 0
2: 3
3: 31
4: 292
1162502942_1162502951 18 Left 1162502942 19:11064895-11064917 CCCAAATATGCTGAGTCAGCGGC No data
Right 1162502951 19:11064936-11064958 CTGAGTCAGCACCTCTGCCCGGG 0: 1
1: 0
2: 3
3: 31
4: 292
1162502947_1162502951 -10 Left 1162502947 19:11064923-11064945 CCGGGCCCAAATGCTGAGTCAGC 0: 1
1: 0
2: 1
3: 14
4: 185
Right 1162502951 19:11064936-11064958 CTGAGTCAGCACCTCTGCCCGGG 0: 1
1: 0
2: 3
3: 31
4: 292
1162502943_1162502951 17 Left 1162502943 19:11064896-11064918 CCAAATATGCTGAGTCAGCGGCT 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1162502951 19:11064936-11064958 CTGAGTCAGCACCTCTGCCCGGG 0: 1
1: 0
2: 3
3: 31
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162502951 Original CRISPR CTGAGTCAGCACCTCTGCCC GGG Intronic
900375225 1:2351173-2351195 CTGCGTGAGCACAGCTGCCCAGG + Intronic
900435575 1:2629162-2629184 CTGAGTCCGCAGCTCGGCCCCGG + Intronic
900919758 1:5662747-5662769 CAGACTCAGCACCACTGCACAGG + Intergenic
901190777 1:7408563-7408585 CCTGGGCAGCACCTCTGCCCTGG + Intronic
901879798 1:12187087-12187109 CTGCGTCTGCTCCTCTGTCCAGG + Intronic
901926773 1:12571081-12571103 CTGACTGAGCCCCTCTGACCTGG - Intronic
902338239 1:15766065-15766087 CTGATTCAGCAGATCTGCCGTGG + Intronic
902521384 1:17019224-17019246 CAGAGAGTGCACCTCTGCCCTGG - Intronic
902871358 1:19315472-19315494 GTGAGTCAGCACCTCCTCTCAGG - Intronic
903345150 1:22679737-22679759 CTGAGTTAGCCATTCTGCCCCGG + Intergenic
903961745 1:27062292-27062314 GTGAGCCACCACCTCTGGCCAGG + Intergenic
904788365 1:32999157-32999179 CTGGCTCAGCCCCTCTGGCCCGG + Intergenic
905285051 1:36873762-36873784 CTGAGTCAATACCTATTCCCAGG - Intronic
907309724 1:53532317-53532339 CTGTCTGAGCAGCTCTGCCCTGG - Intronic
908513387 1:64868319-64868341 CTGAGACAGCACCTGGCCCCGGG + Intronic
910826288 1:91410982-91411004 CTGCTTCAGCGCCTCTACCCTGG - Intergenic
912389965 1:109296233-109296255 CTGTGTCCGCGCCTCTCCCCGGG - Exonic
914751465 1:150537782-150537804 CAGCTTCAGCCCCTCTGCCCAGG - Intergenic
915142889 1:153777902-153777924 CTGTGTCAGCAGCTCTGCCCAGG - Intronic
915308257 1:154993443-154993465 CTGAGTCAGCCCCTCTAGACAGG - Intergenic
915314893 1:155022940-155022962 CTGTGTCAGCACCGTGGCCCAGG - Intronic
916505990 1:165428784-165428806 TCGAGTCATCACCTCTGCCATGG - Exonic
920038760 1:203082709-203082731 CCTAGTCCCCACCTCTGCCCTGG - Intergenic
920232494 1:204479976-204479998 CGGAGGCAGCTCCTCTGCCGTGG - Intronic
920683460 1:208090841-208090863 CTCAGTCTTCACCCCTGCCCAGG + Intronic
922929478 1:229377534-229377556 CTGAGTGGCCACCTCTGCACAGG + Intergenic
923375871 1:233362063-233362085 CCGAGTCAGCTCCTCTTCCCGGG - Exonic
923480124 1:234375937-234375959 GTGAGTCACCACGTCTGGCCAGG + Intronic
923650339 1:235867196-235867218 CTGGGTCCGCACCTCCTCCCAGG + Intronic
1063344631 10:5299503-5299525 CACAGGCAGCACCACTGCCCAGG + Intergenic
1063582392 10:7320420-7320442 GAGAATCAGCATCTCTGCCCTGG - Intronic
1064113716 10:12559957-12559979 GTGAGTTAGCACCTCTGTCATGG + Intronic
1064147928 10:12840136-12840158 TTGATTCAGCAGCTCTGGCCTGG + Intergenic
1067427504 10:46221052-46221074 CTCACTCATCCCCTCTGCCCAGG + Intergenic
1067841264 10:49681183-49681205 CTGATTCAGCACCTCTGTCTAGG - Intronic
1069908923 10:71748243-71748265 ATGTATCAGCCCCTCTGCCCTGG + Exonic
1070550721 10:77488692-77488714 AGGAGACAGCACCTCAGCCCTGG + Intronic
1070553588 10:77511167-77511189 CTGATTCAGCAGCTCTGGGCTGG + Intronic
1070808767 10:79286797-79286819 CTGCCTCATCACCTCAGCCCAGG - Intronic
1072916197 10:99538691-99538713 CTCTGTCAGCACCTCTTCCCTGG + Intergenic
1073032262 10:100536107-100536129 CTCAATAAGCTCCTCTGCCCGGG - Exonic
1073650435 10:105352724-105352746 CTGAGCCATCACCTGTGACCAGG - Intergenic
1074125287 10:110524390-110524412 CTGAGTCAGCAGCTCTAACAGGG - Intergenic
1075446339 10:122516070-122516092 CTGTGGCAGCACCTCAGCTCCGG - Intergenic
1075485994 10:122822407-122822429 CTGCCTCAGGACCTCAGCCCTGG - Intergenic
1075964008 10:126594756-126594778 CTGTCTCAGGACCTCTGCCCTGG - Intronic
1076594857 10:131619105-131619127 CTGAGTCCCGACCTCAGCCCTGG - Intergenic
1076717746 10:132374935-132374957 CAGAGCCAGCCCCGCTGCCCCGG - Intronic
1077178926 11:1203644-1203666 CGGAGGCAGCCCCACTGCCCAGG - Intergenic
1077782630 11:5348258-5348280 CTGAGTCAACACCCATGCTCTGG - Intronic
1077842609 11:5991797-5991819 CACAGTCACCACCACTGCCCTGG - Intergenic
1079468911 11:20759703-20759725 CTAAATCACCACCTCTGTCCAGG + Intronic
1081238459 11:40675393-40675415 CTGAGTTAACACCTGTGACCAGG - Intronic
1081487102 11:43539249-43539271 CTGAGTTAGCAGCTCTGCAAAGG - Intergenic
1081981679 11:47270428-47270450 CTGAGCCCCCTCCTCTGCCCGGG - Intronic
1083822744 11:65182063-65182085 CTGGGGCAGCCCCTCAGCCCAGG - Intronic
1083924089 11:65795484-65795506 CTGAGTGAGCACGTGTGCCCAGG - Exonic
1083941359 11:65897827-65897849 CTGCCTCAGCCCCTCTGCACTGG - Intronic
1084493355 11:69489972-69489994 CTGAGTCAGCTCCTGCACCCTGG + Intergenic
1084692990 11:70737685-70737707 CTGAGGCTGCAGCCCTGCCCCGG - Intronic
1085757914 11:79216923-79216945 CTGCGTAAGGACCTCTGCCCAGG - Intronic
1086190107 11:84069105-84069127 CTGAATCAGCACCTCTGGAGGGG - Intronic
1087329017 11:96755911-96755933 CTGGGGAATCACCTCTGCCCTGG + Intergenic
1088425418 11:109696566-109696588 CTGCACCAGAACCTCTGCCCAGG - Intergenic
1089461542 11:118657025-118657047 CTGTGACAGCTCCTCAGCCCTGG - Exonic
1091218213 11:133916514-133916536 CTGAGTCAGCCCCTCGGTGCTGG - Intronic
1093469250 12:19483022-19483044 CTCTGTCAGCAGCTCTGCGCTGG + Intronic
1094822757 12:34239499-34239521 GTGAGTCACCACGTCTGACCTGG + Intergenic
1095335950 12:41026626-41026648 CTTACTCAGAACCTATGCCCTGG - Intronic
1096840010 12:54374381-54374403 CTGAGTCAGCAGCCAGGCCCTGG - Intronic
1097247943 12:57616905-57616927 CTGAGTCAGCACCACCCCCATGG - Exonic
1099095968 12:78374801-78374823 CTGAGGCAGCCCCAGTGCCCTGG - Intergenic
1103024192 12:117560173-117560195 CTGATTCAGCAGATCTGCCAGGG - Intronic
1103064990 12:117890037-117890059 CTGAGTCAGCAGCTGTGGCAGGG - Intronic
1104081353 12:125433122-125433144 CTGAGTCAGCCCCACAGCCAGGG + Intronic
1104108975 12:125688325-125688347 CCCAGCCAGCACCTCTCCCCAGG + Intergenic
1104391796 12:128397220-128397242 CTGTGTCTCCACCTGTGCCCAGG + Intronic
1106246534 13:27954528-27954550 CTGGGTCTGCGCCGCTGCCCGGG - Intergenic
1108457558 13:50631798-50631820 CTGAGCCACCACATCTGGCCTGG - Intronic
1109259346 13:60124789-60124811 CTGTGTTTGCACCACTGCCCTGG + Intronic
1111956660 13:94766333-94766355 CTGCGTCATCACCTCTACTCTGG + Intergenic
1113408318 13:110062251-110062273 CTGAGTCAGAAACTCTGGCAGGG - Intergenic
1113647750 13:112011101-112011123 CTTGGACAGCCCCTCTGCCCAGG + Intergenic
1114699824 14:24665609-24665631 CACAGTCATCAACTCTGCCCAGG + Intergenic
1115939863 14:38596701-38596723 GTGAGTCACCACATCTGTCCAGG - Intergenic
1116493731 14:45536422-45536444 CTGATGAACCACCTCTGCCCCGG + Intergenic
1116493783 14:45536682-45536704 CTGGGTGACCACTTCTGCCCTGG + Intergenic
1118253513 14:64184523-64184545 CCGAGCCAGCACCTCTGAGCAGG + Intronic
1119214358 14:72857049-72857071 CTGATTCAGCAGCTCTTCCAGGG - Intronic
1121782063 14:96628313-96628335 CTCAGTCAACACCTCTGAACTGG - Intergenic
1122345772 14:101059131-101059153 GGGAGTCAGCACCACTGGCCAGG + Intergenic
1122533030 14:102442359-102442381 CTGTGTAAGAACCTCTGGCCTGG + Intronic
1122706944 14:103627958-103627980 CTGACTCAGTGCCTCTCCCCGGG + Intronic
1122806979 14:104264753-104264775 CTGCGTCAGCACCACTGCCTGGG - Intergenic
1122851745 14:104537092-104537114 CTGAGTGAGCATCTCTGACATGG - Intronic
1122857886 14:104568625-104568647 AGGAGTCAGCCCCTCTGCCCAGG + Intronic
1125363276 15:38887253-38887275 CTGAGTCTACACCTCAACCCAGG + Intergenic
1126789077 15:52204275-52204297 GTGAGTGAGGACCTCTGCTCAGG - Intronic
1128357565 15:66938827-66938849 CTGAGCCACCACATCAGCCCTGG + Intergenic
1129710898 15:77819807-77819829 CCGAGTCGGCACCTGGGCCCAGG - Intronic
1131849739 15:96526054-96526076 CAGAGTCAGTTTCTCTGCCCAGG - Intergenic
1132091833 15:98953586-98953608 CTGCGTTCACACCTCTGCCCTGG - Intronic
1132371170 15:101300183-101300205 CTGAGCCATCACACCTGCCCCGG + Intronic
1132383848 15:101386156-101386178 CTGAGGCAGCACCTGTGGCGCGG - Intronic
1132486861 16:197729-197751 CTGAGTGAGCAGCTCTTTCCTGG + Intronic
1132591758 16:729165-729187 CTGAGTGAGCATCTCTGGCTTGG + Intronic
1132744776 16:1432077-1432099 CAGCGCCAGCACCCCTGCCCTGG + Intergenic
1132845320 16:1998605-1998627 CTCAGTCATCCCCTCTGGCCCGG + Intronic
1135002634 16:18789986-18790008 CTGAGGCAGCGCCTTGGCCCCGG - Intronic
1137797868 16:51237445-51237467 CTCATTCAGCACCACTGTCCAGG - Intergenic
1137937816 16:52651384-52651406 GTGAGCCACCACCCCTGCCCAGG - Intergenic
1138021963 16:53492696-53492718 CTGAGTCAGCATCTTTTCTCTGG + Exonic
1138455237 16:57117174-57117196 CTGGGCCAGAACCTCTCCCCGGG + Intronic
1138490022 16:57371392-57371414 AAGAGTCAGCAGCTCTGCCTTGG - Intergenic
1139298235 16:65921575-65921597 CTGAGTCTTCACGTCTGCCCTGG - Intergenic
1141294887 16:82758392-82758414 CTGTGTCACCACCTTGGCCCAGG + Intronic
1141751735 16:85962750-85962772 CTGAGAAGGCACCTCAGCCCTGG + Intergenic
1142514995 17:422074-422096 CTGTGGCATCTCCTCTGCCCAGG + Intronic
1142625046 17:1186601-1186623 CTAAGCCAGCGGCTCTGCCCAGG - Intronic
1143392137 17:6565641-6565663 CTGAGCAGGAACCTCTGCCCTGG + Intergenic
1143502576 17:7347796-7347818 CTGGGCCAGCACCTCTGCACGGG + Intronic
1144494637 17:15738510-15738532 CTGAGTTACCATCTATGCCCAGG - Intronic
1144707240 17:17377795-17377817 CTGCGTCTCCACCTCCGCCCAGG + Intergenic
1144846252 17:18221207-18221229 CTGAGTCAGCAGCACTGGCAGGG - Intergenic
1144905619 17:18638166-18638188 CTGAGTTACCATCTATGCCCAGG + Intronic
1146400143 17:32495240-32495262 CAGAGTCAGAACCCCAGCCCTGG - Intronic
1146843954 17:36172157-36172179 CTGTGTCACCATCTGTGCCCAGG + Intronic
1146856260 17:36260092-36260114 CTGTGTCACCATCTGTGCCCAGG + Intronic
1146864359 17:36328283-36328305 CTGTGTCACCATCTGTGCCCAGG - Intronic
1146872167 17:36384003-36384025 CTGTGTCACCATCTGTGCCCAGG + Intronic
1146879529 17:36435088-36435110 CTGTGTCACCATCTGTGCCCAGG + Intronic
1146883458 17:36456231-36456253 CTGTGTCACCATCTGTGCCCAGG + Intergenic
1147067218 17:37928871-37928893 CTGTGTCACCATCTGTGCCCAGG - Intronic
1147075053 17:37984627-37984649 CTGTGTCACCATCTGTGCCCAGG + Intronic
1147078750 17:38008432-38008454 CTGTGTCACCATCTGTGCCCAGG - Intronic
1147086578 17:38064173-38064195 CTGTGTCACCATCTGTGCCCAGG + Intronic
1147094688 17:38132367-38132389 CTGTGTCACCATCTGTGCCCAGG - Intergenic
1147102521 17:38188136-38188158 CTGTGTCACCATCTGTGCCCAGG + Intergenic
1147726687 17:42569944-42569966 CTGCTGCAGCACCTCAGCCCTGG + Intronic
1148318609 17:46728103-46728125 CTGCATATGCACCTCTGCCCTGG - Intronic
1148563639 17:48620485-48620507 CTGGGTAAGCACCTCTGCAAAGG - Intronic
1148966968 17:51443836-51443858 CTGAGCCACCACTTCTGCCTTGG + Intergenic
1149485125 17:57036644-57036666 CTGGGTCACCACCCCTACCCTGG + Intergenic
1149521318 17:57320390-57320412 GTGAGACATCACCTCTGCCCTGG - Intronic
1149847094 17:60014602-60014624 CTGTGTCACCATCTGTGCCCAGG + Intergenic
1150085453 17:62271219-62271241 CTGTGTCACCATCTGTGCCCAGG + Intergenic
1150132941 17:62679105-62679127 CTGAGACACCACCTCTGTCCTGG + Intronic
1150802431 17:68292204-68292226 CTGAGTCAGCATCCCCGGCCCGG + Intronic
1150809244 17:68343744-68343766 CTGCTGCAGCACCTCTGCCAAGG - Exonic
1150875140 17:68962752-68962774 CGAAGTCAGCACCTCTGTCATGG + Intergenic
1151087931 17:71402725-71402747 TTGAGTCAGCACTCTTGCCCCGG + Intergenic
1151595987 17:75078234-75078256 CTGAGTGAGCAGCTCTGCTCTGG - Intergenic
1152527948 17:80900235-80900257 CTGAGCCAGCAGCTCTGGCCTGG + Intronic
1152587297 17:81194741-81194763 ATGAGTGTTCACCTCTGCCCAGG + Intronic
1152591089 17:81212589-81212611 CTGGGACAGCCCCTCTGCACGGG - Intronic
1152617284 17:81343739-81343761 CGGAGGCAGCAGCTCAGCCCTGG + Intergenic
1153466558 18:5394782-5394804 CTGAGCCAGCGCCTATCCCCGGG + Exonic
1156007818 18:32464367-32464389 CTGAGCCACCACATCTGGCCAGG - Intronic
1158164291 18:54521492-54521514 CAGACTCGGAACCTCTGCCCAGG - Intergenic
1158553150 18:58454037-58454059 CAGAGTCAGTACCTGTCCCCAGG - Intergenic
1159107552 18:64020540-64020562 CTAAGTCAGCTCCTCTGCCAAGG + Intergenic
1160496249 18:79377520-79377542 CTGTCTCAGCATCTGTGCCCTGG - Exonic
1160496277 18:79377651-79377673 CTGTCTCAGCATCTATGCCCTGG - Exonic
1160765718 19:806653-806675 CTGTGTCTGCGCCTCTGCCCTGG + Intronic
1161465687 19:4429015-4429037 CTGAGCCAGCACCGAAGCCCAGG - Intronic
1161811126 19:6471988-6472010 CCGAGTCAGGACCTGTCCCCAGG + Intronic
1162502945 19:11064905-11064927 CTGAGTCAGCGGCTCTGCCCGGG + Intronic
1162502951 19:11064936-11064958 CTGAGTCAGCACCTCTGCCCGGG + Intronic
1163631826 19:18421468-18421490 CTGATTCAGCATATCTGCCCTGG + Intronic
1163735553 19:18978186-18978208 CTTGGTCAGCACCTCAGGCCTGG - Intergenic
1164566079 19:29327025-29327047 CTGAGCCAGCACACCTGGCCAGG + Intergenic
1164710876 19:30356389-30356411 CCGAGTCAGCCCCTCCGTCCTGG + Intronic
1165137353 19:33677990-33678012 CTGATTCAGCACCTGTAGCCTGG - Intronic
1166749010 19:45155939-45155961 CTGAGTCAGGACCACTGGCCAGG + Intronic
1167665936 19:50822887-50822909 CTCAGCCAGCGCTTCTGCCCTGG - Intronic
1167687750 19:50967303-50967325 CTTATTCTGCTCCTCTGCCCAGG + Exonic
1168666749 19:58210133-58210155 CTGAGGCATCCACTCTGCCCTGG + Intronic
925113377 2:1354705-1354727 CTCAGTCAGCCGCTCTGCCTCGG - Intronic
925914098 2:8592432-8592454 GTGAGTGAGCACCTCATCCCTGG + Intergenic
926166207 2:10523239-10523261 CTGCCTCTGCTCCTCTGCCCAGG - Intergenic
927709103 2:25314209-25314231 CTGGGTCAGGCCCTCAGCCCAGG + Intronic
929604914 2:43227405-43227427 CAGAGTCAGCTCCCCCGCCCGGG - Intergenic
929623974 2:43387505-43387527 CTGAGCCACAACTTCTGCCCGGG + Intronic
929924337 2:46196413-46196435 CTCTGTCAGTTCCTCTGCCCCGG - Intergenic
932119743 2:69087733-69087755 CTGTGTCTACACCTCTGCCATGG + Intronic
932357152 2:71076375-71076397 CTGAGTGAGCACCTCTGTACAGG + Intronic
932434515 2:71695255-71695277 CTGAGGGAGCACCTCCGCCATGG + Intergenic
932485995 2:72084728-72084750 CTGTGTGGGCACCTCTGTCCTGG - Intergenic
935271167 2:101435653-101435675 CTGAGTCAGCAATTATACCCAGG + Intronic
935496134 2:103783658-103783680 CTGATTCAGCAGCTCTGCGATGG - Intergenic
936292379 2:111236120-111236142 CTGACTCAAAACCTCTTCCCAGG - Intergenic
936996760 2:118423938-118423960 CTGAGCCCGCACCCCTGCCCTGG - Intergenic
937895996 2:126977132-126977154 CTGAGTCTCCACCGCTCCCCCGG + Intergenic
937911720 2:127078822-127078844 GTGACTCAGCCCCTCTGCTCAGG + Intronic
938109121 2:128552479-128552501 CTGAATCAGCACCTCTATACTGG + Intergenic
938210129 2:129460083-129460105 CTGAGACAGCACCTTCTCCCAGG - Intergenic
940876703 2:158904862-158904884 CCCAGTCCTCACCTCTGCCCTGG - Intergenic
943676906 2:190724582-190724604 AAGAGTTAGCACGTCTGCCCAGG + Intergenic
947220400 2:227786303-227786325 CTGGGTAAGCACCCTTGCCCAGG - Intergenic
948600583 2:239105657-239105679 CAGAGTCAGCACCCCTTCTCTGG - Intronic
948809358 2:240466892-240466914 CTGAGACAGCACCACTGCTGAGG + Exonic
1170030545 20:11939560-11939582 CTGAGTCAGGCCTTCAGCCCAGG + Intergenic
1170044413 20:12070575-12070597 CTGAGTCAGAATCTCTGCAGGGG - Intergenic
1171421484 20:25020668-25020690 CTGAGACAGCACCTGGGCCATGG + Intronic
1171425249 20:25044790-25044812 CTGAGGCAGCCCTTCTCCCCTGG - Intronic
1172678115 20:36689685-36689707 CTGGGTCAGCACCTTTCCCTTGG + Intronic
1174532109 20:51222354-51222376 CTGAGAGAGCACCCTTGCCCAGG + Intergenic
1175547444 20:59787649-59787671 CTTAGACAGCCCCTCTGGCCAGG + Intronic
1177816914 21:25987736-25987758 CTGAGACAGCAGCTCTGACATGG + Intronic
1178308370 21:31509344-31509366 CTGGGTTTGCACCTCTGCCGGGG - Intronic
1179502092 21:41816330-41816352 CTGACTCAGCCCCTATGCCAGGG - Intronic
1179522975 21:41957206-41957228 GTGAGACTGCAGCTCTGCCCGGG + Intergenic
1179798461 21:43799269-43799291 CTGTGTAGGCACCTGTGCCCTGG + Intronic
1179977265 21:44875110-44875132 CAGAGTCTGAACCTCAGCCCTGG - Intergenic
1180006384 21:45023005-45023027 CTGAGTTATATCCTCTGCCCTGG - Intergenic
1180618419 22:17144006-17144028 GTCAGTCTGCACATCTGCCCAGG - Intronic
1181013703 22:20056536-20056558 CTGGCTCTGCACCACTGCCCAGG + Intronic
1183074603 22:35419064-35419086 CTGATTCAGCACCTCTGCCAGGG + Intronic
1183543868 22:38445208-38445230 CAGAGCCACCACCTCTCCCCAGG - Intronic
1183910588 22:41075968-41075990 CTTAGCCAGGTCCTCTGCCCAGG + Intergenic
1184808700 22:46813807-46813829 CTGAGCCACCTCCTCAGCCCAGG + Intronic
1185279983 22:49965884-49965906 CTGACTGAGCACCACGGCCCAGG + Intergenic
951236359 3:20240741-20240763 CTGAGCCAGTATCTCTGCCAAGG - Intergenic
951678442 3:25268641-25268663 CTGCCTCAGCACCTTTGCACTGG + Intronic
954437308 3:50503105-50503127 CGGACCCAGCGCCTCTGCCCTGG + Intronic
954610712 3:51943269-51943291 CTCAGTCCCCACCCCTGCCCTGG - Intronic
954638513 3:52084676-52084698 CTGGGGCAGCCCCTCTTCCCAGG + Intronic
954741489 3:52754564-52754586 CTGAGTCAGCATCTTTTCTCTGG - Intronic
961646791 3:128397083-128397105 CTGGCTCAGCCCCACTGCCCTGG + Intronic
961824500 3:129592054-129592076 CTGCCTCAGGACCTCTGGCCTGG + Intronic
962369305 3:134807603-134807625 CTGAGACAGCACTGTTGCCCTGG - Intronic
962943353 3:140145629-140145651 CTTAAGCAGCACCTCTGCCCAGG + Intronic
966900675 3:184481717-184481739 CAGAGTAAGAATCTCTGCCCAGG + Intronic
967088124 3:186112190-186112212 CTGAGCCAGCTCCTGGGCCCAGG + Intronic
968579235 4:1382143-1382165 CAGAGGCAGCAGCTCAGCCCTGG + Intronic
968872391 4:3248527-3248549 CTGTGTCTGCACCTCTGGGCAGG + Exonic
969134098 4:5016177-5016199 CTGAGTGATGACCTCTGCCATGG + Intronic
969463291 4:7340206-7340228 CTGAGCCAGCACCACAACCCAGG + Intronic
969498806 4:7540862-7540884 CTGACTCAGCAGCTCAGGCCTGG + Intronic
969689720 4:8697875-8697897 CTGGGTCCCCACCACTGCCCTGG + Intergenic
970378275 4:15480525-15480547 CTGGGTTGGCACCTCTTCCCTGG + Intronic
970450056 4:16157411-16157433 CTGATTCAGCACATCTGGGCAGG + Intergenic
970585468 4:17510790-17510812 CAGAGGCAGCACTTCTGCCAAGG - Intronic
983957153 4:173710916-173710938 CTGATTCCTCACCCCTGCCCTGG - Intergenic
984909684 4:184661678-184661700 CTGAGTCAGCTCTGTTGCCCAGG - Intronic
985586973 5:745524-745546 CTGAGTCAGCACCGTTCCCCAGG - Intronic
985622603 5:963312-963334 CCGAGGCAGCACCTCTGGCTTGG + Intergenic
986331985 5:6724021-6724043 CTCAGTCAGCACTGCTGCACTGG + Intronic
990176456 5:53113925-53113947 CTGAGTAAACACCTCTGACGTGG - Intergenic
990177443 5:53123474-53123496 CTGGGTCAGAACCTATCCCCCGG + Intergenic
993711001 5:91225126-91225148 CTCAATCAGCACATCTGACCTGG + Intergenic
996469734 5:123845544-123845566 CTGATTCAACACCTCTGCGGTGG - Intergenic
997627527 5:135341233-135341255 ATGAATCAGCCTCTCTGCCCTGG - Intronic
998390643 5:141785106-141785128 CTAGGTCAGCACCTCTTCCAGGG + Intergenic
998628379 5:143871447-143871469 CTGATTCAGAACCTCTGACAAGG + Intergenic
999091405 5:148939420-148939442 CTGAGTCAGAAACTCTGGGCGGG + Intronic
1000022663 5:157332051-157332073 CTGAGGCAGCTGCTGTGCCCTGG + Intronic
1001242696 5:170082170-170082192 CTCAGGCAGCTCCTCTGACCAGG + Intronic
1002923371 6:1589720-1589742 CTGGGGCAGCACCTCAGCCTCGG + Intergenic
1003177840 6:3766405-3766427 CTGAGATAGCTCGTCTGCCCAGG + Intergenic
1003645119 6:7908586-7908608 CTCAATCAGTACTTCTGCCCTGG - Intronic
1005348457 6:24911760-24911782 CTGAGTCAGGACCTTTTCCCTGG - Intronic
1005401580 6:25439550-25439572 CAGAGTCAGCACTCCTTCCCAGG - Intronic
1005836552 6:29713841-29713863 CTCAGTCAGCACCACTCTCCAGG + Intergenic
1006365714 6:33613968-33613990 CTGAGTCAGGCCTTCTGGCCCGG + Intergenic
1007393181 6:41562162-41562184 CTGAATTCTCACCTCTGCCCTGG - Intronic
1007989628 6:46241658-46241680 TTGAGCCAGCACCCTTGCCCTGG - Intronic
1010280177 6:74014206-74014228 CTGAGTGAGCTCCTGTTCCCAGG + Intergenic
1011137793 6:84118289-84118311 CTGGGAAACCACCTCTGCCCTGG + Intergenic
1015425620 6:133063123-133063145 CTCAGCCAGCACCTTTGACCCGG + Intergenic
1018370752 6:163165643-163165665 CTGGGCCAGCGCCTCTCCCCTGG - Intronic
1019272115 7:156233-156255 CTGAGGCAGCAGCTCTGGACAGG - Intergenic
1019300732 7:302216-302238 CTGAGTCAGGACCAGTGCGCTGG + Intergenic
1020348408 7:7190271-7190293 CTGAGTCAGCTTCTCAGCCCAGG - Intronic
1023058668 7:36309641-36309663 CTCAGTCAGCGCCTCTACCCAGG + Intergenic
1023983100 7:45080921-45080943 CTGAGTCAGCACCCAGGCCCCGG - Exonic
1024303239 7:47904026-47904048 CTCACTTAGCACCTTTGCCCAGG + Intronic
1026805598 7:73427839-73427861 CTGTGTGTGCACCTGTGCCCAGG - Intergenic
1027198585 7:76048205-76048227 CAGCTTCAGCACCTCGGCCCAGG + Exonic
1027695798 7:81408745-81408767 CTGAGGCAGCTCCGGTGCCCTGG + Intergenic
1029625605 7:101718594-101718616 CTCAGACAGCCCCACTGCCCGGG + Intergenic
1029655678 7:101922831-101922853 CAGGGGCAGCACCTCTGCACTGG + Intronic
1030042866 7:105467725-105467747 CTGAGTAAGCACCTCTCTCTGGG - Intronic
1031278039 7:119756853-119756875 CAGAGGCAGCCCCTCTGCCTTGG - Intergenic
1033668260 7:143464424-143464446 CTGATCCAGTATCTCTGCCCTGG + Intergenic
1033994530 7:147329583-147329605 GTGTGTAAGCATCTCTGCCCAGG + Intronic
1034619924 7:152449073-152449095 CTGAGACTGCACCGCTGCACTGG - Intergenic
1034881656 7:154767421-154767443 CAGAGTCACCAGATCTGCCCAGG - Intronic
1035276677 7:157752153-157752175 CTGTGTCTGCAGCTCTGGCCTGG + Intronic
1037821945 8:22139336-22139358 CTCATTCAGCTCCTCTGCCAGGG - Intronic
1037991717 8:23326092-23326114 CAGGGTCAGCCCCTCAGCCCTGG - Intronic
1038417299 8:27406546-27406568 GTGAGTCAGCTCTTCTCCCCAGG + Intronic
1038625898 8:29193040-29193062 CTGGCTCAGCACCTCTGGACAGG + Intronic
1038687427 8:29731304-29731326 GTGAGCCACCACCTCTGGCCAGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1042783135 8:72514085-72514107 CTCTGCCAGCACCTCTACCCAGG + Intergenic
1042964911 8:74339960-74339982 CAGAATCAGCACCTTTGCTCTGG + Intronic
1044541742 8:93416173-93416195 CTGAGTAGTCACCTCTTCCCAGG - Intergenic
1047450600 8:124962034-124962056 CTGACTCAGCACCTCTGGGGTGG - Intergenic
1048600791 8:135916741-135916763 CTGTGCCAGGCCCTCTGCCCAGG - Intergenic
1048749695 8:137658230-137658252 TTGAGTAAAGACCTCTGCCCTGG - Intergenic
1048988067 8:139745996-139746018 CAGAGTCAGCACTTCAACCCAGG + Intronic
1049248535 8:141575874-141575896 CTGAGTCTTCTCCTCTCCCCAGG - Intergenic
1050584851 9:7100027-7100049 ATGAGACAGGAGCTCTGCCCTGG + Intergenic
1051507929 9:17845922-17845944 CTGAGGCAGCTCCAGTGCCCTGG - Intergenic
1053466180 9:38310338-38310360 CTGGGTAAGCACCCATGCCCTGG + Intergenic
1053477676 9:38393720-38393742 CTGAGTCAGCAGATCTGCCAGGG - Intronic
1054916499 9:70499444-70499466 CGGATTCAGCACATCTGCCATGG - Intergenic
1055110839 9:72557698-72557720 CTGAGTCAGCCTCTTTGACCTGG + Intronic
1056101599 9:83305175-83305197 CAGGGCCAGGACCTCTGCCCAGG + Intronic
1056904340 9:90632340-90632362 CTGCCTCAGGACCTTTGCCCTGG + Intronic
1057239546 9:93396675-93396697 CTGTGCCTGCACCTTTGCCCAGG + Intergenic
1058824483 9:108762489-108762511 CTGACTCAGCACCCAGGCCCGGG + Intergenic
1060548206 9:124473020-124473042 CTCAGTCAGTCCCTCTCCCCAGG + Intronic
1060865329 9:126990571-126990593 CTGTCTCAGCACCTCCGCACAGG + Intronic
1060885599 9:127149912-127149934 ATGTGGCAGCACCCCTGCCCTGG + Intronic
1061478710 9:130885776-130885798 GTGAGTCAGCACCTTGGCCCAGG + Intronic
1062340075 9:136090234-136090256 CTGAGGCATCCCCTCTGGCCAGG - Intronic
1062678686 9:137763998-137764020 CTGATTCAGCAGGTCTGGCCTGG + Intronic
1185457833 X:319521-319543 CGGAGTCCCCACGTCTGCCCTGG + Intergenic
1186804534 X:13126760-13126782 CTGATTGAGCACCACTGCTCTGG + Intergenic
1190209483 X:48433375-48433397 CTGAGCAAGCTCCTCAGCCCAGG - Intergenic
1190268984 X:48847708-48847730 CTGAGGCCGCACCTCCGCCAGGG + Intergenic
1190651188 X:52570330-52570352 TTCAGTCAGCACCTTTACCCAGG - Intergenic
1197871377 X:131065731-131065753 CTGGGTCAGCACCTCATCCTGGG - Intronic
1198111331 X:133505010-133505032 CTGAGTGACCACCTCTGTCCAGG + Intergenic
1199964757 X:152810680-152810702 CTCTGCCAGCACCTCTGCCCTGG - Intergenic