ID: 1162503233

View in Genome Browser
Species Human (GRCh38)
Location 19:11066659-11066681
Sequence ACTTGTGTCATCTGGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162503233_1162503241 3 Left 1162503233 19:11066659-11066681 CCTGTTTCCCAGATGACACAAGT No data
Right 1162503241 19:11066685-11066707 GCTCGGGGAGGTTGAGCCAGTGG No data
1162503233_1162503240 -9 Left 1162503233 19:11066659-11066681 CCTGTTTCCCAGATGACACAAGT No data
Right 1162503240 19:11066673-11066695 GACACAAGTGGAGCTCGGGGAGG No data
1162503233_1162503245 30 Left 1162503233 19:11066659-11066681 CCTGTTTCCCAGATGACACAAGT No data
Right 1162503245 19:11066712-11066734 AGGCTACACAGATCTGAGCTTGG No data
1162503233_1162503242 10 Left 1162503233 19:11066659-11066681 CCTGTTTCCCAGATGACACAAGT No data
Right 1162503242 19:11066692-11066714 GAGGTTGAGCCAGTGGCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162503233 Original CRISPR ACTTGTGTCATCTGGGAAAC AGG (reversed) Intergenic
No off target data available for this crispr