ID: 1162506569

View in Genome Browser
Species Human (GRCh38)
Location 19:11089580-11089602
Sequence CGCGGCGAGGAGCAAGGCGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162506569_1162506578 -4 Complete closest: 257
total_pairs: 2
max_distance: 1000
Left 1162506569 19:11089580-11089602 CCGTCGCCTTGCTCCTCGCCGCG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1162506578 19:11089599-11089621 CGCGGCGGGGACTGCAGGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 120
1162506569_1162506580 19 Left 1162506569 19:11089580-11089602 CCGTCGCCTTGCTCCTCGCCGCG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1162506580 19:11089622-11089644 CTTGCTCCAGGCGCCAGAATAGG 0: 1
1: 0
2: 0
3: 3
4: 120
1162506569_1162506583 28 Left 1162506569 19:11089580-11089602 CCGTCGCCTTGCTCCTCGCCGCG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1162506583 19:11089631-11089653 GGCGCCAGAATAGGTTGAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 64
1162506569_1162506576 -9 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1162506569 19:11089580-11089602 CCGTCGCCTTGCTCCTCGCCGCG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1162506576 19:11089594-11089616 CTCGCCGCGGCGGGGACTGCAGG 0: 1
1: 0
2: 1
3: 15
4: 143
1162506569_1162506579 7 Complete closest: 958
total_pairs: 2
max_distance: 1000
Left 1162506569 19:11089580-11089602 CCGTCGCCTTGCTCCTCGCCGCG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1162506579 19:11089610-11089632 CTGCAGGTAAGGCTTGCTCCAGG 0: 1
1: 0
2: 5
3: 26
4: 280
1162506569_1162506582 27 Left 1162506569 19:11089580-11089602 CCGTCGCCTTGCTCCTCGCCGCG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1162506582 19:11089630-11089652 AGGCGCCAGAATAGGTTGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162506569 Original CRISPR CGCGGCGAGGAGCAAGGCGA CGG (reversed) Exonic
901758467 1:11455615-11455637 CGCCCCAAGGAGCAAGGTGAAGG + Intergenic
902273617 1:15324285-15324307 CGCGGGGTGGAGCCAGGCTAGGG - Intronic
904824761 1:33266979-33267001 AGCGGGGAGGACCAAGCCGAAGG - Intronic
906264366 1:44417519-44417541 CGCGGCGTGGAGCGAGGGCAGGG - Intronic
906416311 1:45623204-45623226 CGCGGCGAGGGTGAAGGAGATGG - Exonic
915600527 1:156920541-156920563 CGCAGGGCAGAGCAAGGCGAGGG - Intergenic
920379821 1:205528978-205529000 CCCTGCGAGGAGCAAGGGGTAGG - Exonic
922763441 1:228146046-228146068 CCCGGCGAGGAGAACGGCAAAGG + Exonic
922824992 1:228511753-228511775 CGTGGCCAGGGGCAAGGCCATGG - Intergenic
924230759 1:241959879-241959901 CACGGTGAGGAGCAAGGTGGAGG + Intergenic
1070570525 10:77637177-77637199 CGCGGCGCGGAGCGAGGAGGTGG + Intronic
1076372490 10:129964375-129964397 GGCGGCGAGGGGCGCGGCGAGGG - Intergenic
1083742199 11:64716922-64716944 CGCAGGGAGGGGAAAGGCGAGGG - Intronic
1084258038 11:67955792-67955814 CGCGGCGCGGAGCTAGGCATCGG + Intergenic
1090238256 11:125165051-125165073 CGCGGAGCGGAGCAGCGCGAGGG + Intronic
1091721916 12:2820145-2820167 CGCTGGGAGGAGCTAGGTGAGGG + Exonic
1094057637 12:26283007-26283029 CCCTGAGAGGAGCAAGGGGAGGG + Intronic
1102947130 12:116999651-116999673 CGTGGCGAGGAGCATGGGTAAGG + Intronic
1103086034 12:118061913-118061935 TGCGGCGAGGGTCAAGGCTAGGG + Intronic
1104203549 12:126615098-126615120 CCCCGCGATGAGCAAGGCGTGGG + Intergenic
1109780684 13:67106941-67106963 GGTGCCGAGGAGCAAGGCCAAGG + Intronic
1110296985 13:73878901-73878923 GGGGGTGAGGAGCAAGGCTATGG + Intronic
1110725348 13:78816670-78816692 AGAGGCGAGGAGCAAGGTGCAGG + Intergenic
1110965218 13:81686224-81686246 CAAGGCTAGGAGCAAGGCGTGGG - Intergenic
1111704505 13:91731674-91731696 CGGGGTGGGGAGCAAGGAGAGGG - Intronic
1114320318 14:21541730-21541752 AACTGCGAGGAGCAAGGAGAAGG + Intergenic
1119042390 14:71286821-71286843 CTAGGAGAGGAGCAAGGAGAAGG - Intergenic
1121201437 14:92121592-92121614 CGCGACGAGGATCACGGCGACGG - Intronic
1121364802 14:93299455-93299477 CGGAGAGAGGAGCAAGGAGAGGG + Intronic
1122227790 14:100289989-100290011 TGCGGCAAGGAGCAAGGTGAAGG - Intergenic
1122675491 14:103409295-103409317 CGGGGTGAGGGGCAAGGGGAGGG + Intronic
1123178533 14:106445012-106445034 CGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1124629183 15:31327354-31327376 CGCGTCGAGGAGCGCCGCGACGG + Exonic
1127142760 15:55993841-55993863 CGCGGCGGGGACCATGGCGTGGG + Intergenic
1128280015 15:66386937-66386959 AGCGGCTAGGAGCACGGCGGCGG + Exonic
1129606626 15:77028256-77028278 CGTGGCGAGGGGCGTGGCGAGGG + Intronic
1132128434 15:99251447-99251469 CGGGGCAGGGAGCCAGGCGAGGG - Exonic
1134332595 16:13264906-13264928 GGAGGGGAGGAGAAAGGCGAGGG - Intergenic
1136220044 16:28823060-28823082 CGCCGCGAGGCGGAAGGGGAGGG - Intronic
1138283848 16:55793140-55793162 AGCGGGGAGGAGGCAGGCGAGGG + Intergenic
1138285154 16:55803847-55803869 AGCGGGGAGGAGGCAGGCGAGGG - Intronic
1138884942 16:61065115-61065137 GGGGGTGGGGAGCAAGGCGAGGG + Intergenic
1141665356 16:85462859-85462881 CGCGGCGTGGAGCCCGGGGAGGG - Intergenic
1141882542 16:86869437-86869459 CGCGGGGAGGAGGAAAGCCATGG + Intergenic
1141910996 16:87058177-87058199 CGCGGCGAGGGGGCCGGCGAGGG - Intergenic
1142221324 16:88856591-88856613 CGCGGGGAGGAGGAGGGGGAGGG - Intronic
1143165071 17:4893536-4893558 GACGACGAGGAGGAAGGCGAAGG + Exonic
1144184798 17:12787073-12787095 CGCGGGTAGGGGCAAGGGGAGGG - Intergenic
1148167005 17:45490656-45490678 CGGAGCGAGGAGCGAGGCGAGGG + Exonic
1150398182 17:64837060-64837082 CGGAGCGAGGAGCGAGGCGAGGG + Intergenic
1151320683 17:73350546-73350568 CGCTGCCAGGAGCCAGGAGAGGG + Intronic
1152115585 17:78384990-78385012 CGCGCTGAGGAGAAAGGCGAGGG + Intronic
1152698458 17:81807564-81807586 CGGGGAGAGGGGCAAGGAGATGG - Intronic
1153991135 18:10401740-10401762 AGCGGGGAGGAGAAAGGGGAAGG + Intergenic
1154036578 18:10808891-10808913 CCAGGCGTGGAGCAAGGAGAAGG - Intronic
1160847631 19:1173501-1173523 AGGGGCGGGGAGCAAGGGGAGGG + Intronic
1160861857 19:1240518-1240540 CGCGGCGAGGGGCACAGCGCGGG - Intergenic
1161063477 19:2226674-2226696 CGCGGCAAGGAGGCAGGGGAGGG + Exonic
1161864876 19:6826521-6826543 AGCGGGGAAGAGCAAGGCCAGGG + Intronic
1162506569 19:11089580-11089602 CGCGGCGAGGAGCAAGGCGACGG - Exonic
1163218307 19:15896838-15896860 CACGGGGAGGAGAAAGGCCAAGG + Intronic
1167792796 19:51691549-51691571 CGGGGAGAGGAGAGAGGCGATGG + Intergenic
934247981 2:90323975-90323997 CGCGGCGAGCAGAAAGCCGTGGG + Intergenic
934966982 2:98731488-98731510 CGCGCCGAGGCGCAGGCCGAGGG - Intergenic
941905703 2:170715365-170715387 CGCGGCGAGGGGCAAGGGCGGGG + Exonic
945225686 2:207529769-207529791 CGCGGGGAGAGGGAAGGCGAAGG - Intronic
947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG + Intergenic
947669183 2:231925911-231925933 CCCGGCGAGCAGCAAAGGGAGGG - Intronic
948200261 2:236124460-236124482 GGAGGCGAGGAACAAGGAGAAGG + Exonic
1172703053 20:36864071-36864093 CGGGGCGAGGGGCGAGGCGCTGG - Intergenic
1175992638 20:62797054-62797076 AGCGGTGAGGAGAAAGGGGATGG - Intronic
1180927500 22:19566528-19566550 AGCGGTCAGGAGCAAGGAGAAGG + Intergenic
1182237039 22:28883919-28883941 CGCGGCGCGGGCCAAGGAGACGG + Exonic
1183560645 22:38570199-38570221 CGGGGCGAGGACCAAGGGGCCGG + Exonic
1184776361 22:46625480-46625502 CTGGGCCAGGAGCAAGGAGATGG - Intronic
1185272493 22:49935605-49935627 CGCGGGGAGGAGCAGGGTGGGGG + Intergenic
950457449 3:13101123-13101145 CGCAGCGAGGAGCCATGGGAGGG + Intergenic
956090226 3:65658667-65658689 AGCTGGGAGGAGCAAGGCTATGG + Intronic
958026982 3:88059668-88059690 GGGGGCGGGGAGCAAGGCGAGGG + Intronic
961406252 3:126681828-126681850 CAAGGTGAGGAGCAAGGAGAGGG - Intergenic
961539750 3:127591254-127591276 CGCCGCGTGGAGCAGGGCGCTGG - Intronic
961780037 3:129315951-129315973 CGCCGGGAAGAGGAAGGCGAGGG + Exonic
969796581 4:9532306-9532328 CGCGGCGCGGAGCTGGGCAACGG - Intergenic
971510850 4:27421618-27421640 GGGGGTGAGGAGCAAGGGGAGGG - Intergenic
972245706 4:37244120-37244142 CGCGGCGAGGAGCACGTGAACGG + Intergenic
973236758 4:47914248-47914270 CGCAGCGAGGACCGAGGCGAAGG + Intronic
992267561 5:75033827-75033849 GGGGGTGAGGAGCAAGGGGAGGG - Intergenic
994175170 5:96702930-96702952 CGCGGCCTGGAGCAAAGCGGCGG - Intronic
995065873 5:107861964-107861986 CGCTAGGAGGAACAAGGCGAGGG - Intronic
996623109 5:125534735-125534757 GGCACGGAGGAGCAAGGCGAGGG + Intergenic
996786848 5:127246454-127246476 CGGGGTGGGGAGCAAGGGGAGGG + Intergenic
998404075 5:141863721-141863743 CAGGGCGATGAGCAAGGCCACGG + Exonic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1015525792 6:134174946-134174968 CGGGGCGAGGGGCGAGGCGAAGG - Intronic
1018020948 6:159761961-159761983 CGCGGGGAGGTGGAGGGCGAGGG + Exonic
1018749231 6:166788685-166788707 CGGGGTGAGGGGCAAGGGGAGGG + Intronic
1019644933 7:2124063-2124085 CACCTCCAGGAGCAAGGCGAAGG + Intronic
1023081939 7:36534193-36534215 GGCAGCGTGGAGCAAGGCCAGGG - Intronic
1024547168 7:50531780-50531802 CGCGGAGAGAAGCACGGGGAGGG + Intronic
1029373127 7:100161965-100161987 CGGGGTGGGGAGCAAGGGGAGGG + Intronic
1033998499 7:147383618-147383640 CGGGGTGGGGAGCAAGGGGAGGG + Intronic
1034852423 7:154507428-154507450 CAGGGCGGGGAGCAAGGGGAGGG - Intronic
1035382718 7:158450058-158450080 CGCGGTGAGAAGCCAGGCGGAGG - Intronic
1037882331 8:22579267-22579289 CGCGGAGAGGAGCCCGGCGCCGG - Exonic
1039068782 8:33632008-33632030 GGCGGCGTGGAGCAAGGAGCGGG - Intergenic
1039843467 8:41309402-41309424 TGCGGCGAGCAGGAAGGCGCGGG + Exonic
1041673746 8:60517351-60517373 CGCGGCCAGGAGGGAGGCGCCGG - Intronic
1044692743 8:94895711-94895733 CTCGGGGAGGAGCAAAGCGTTGG + Intronic
1049261172 8:141640066-141640088 CCCGGCGAGGAGAAAGGAGAGGG - Intergenic
1057139655 9:92718804-92718826 GGCAGTGAGGAGCCAGGCGAGGG + Exonic
1057470407 9:95351218-95351240 CGCGGCGTGGCTCAAGGCGGTGG + Intergenic
1061052401 9:128204217-128204239 CGCGGCGAGGGGGGAGGCGCGGG + Intronic
1061400517 9:130365807-130365829 GGAGGGGATGAGCAAGGCGAGGG - Intronic
1187686437 X:21820172-21820194 CGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1196828654 X:119759519-119759541 AGCGTCGCGGACCAAGGCGAAGG + Exonic
1198158617 X:133985751-133985773 CGCGGCGTGGAGCGCGGCGGGGG + Intronic
1199699062 X:150363281-150363303 CGCGGCGCGGAGCCGGGCGGTGG + Intronic