ID: 1162506925

View in Genome Browser
Species Human (GRCh38)
Location 19:11090901-11090923
Sequence GCCGAGATCTTCAGCCACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 46}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162506918_1162506925 -2 Left 1162506918 19:11090880-11090902 CCCGCCCCTCCTTGGTCTGCAGC 0: 1
1: 0
2: 4
3: 52
4: 471
Right 1162506925 19:11090901-11090923 GCCGAGATCTTCAGCCACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 46
1162506922_1162506925 -8 Left 1162506922 19:11090886-11090908 CCTCCTTGGTCTGCAGCCGAGAT 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1162506925 19:11090901-11090923 GCCGAGATCTTCAGCCACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 46
1162506915_1162506925 10 Left 1162506915 19:11090868-11090890 CCTCAGAATCTCCCCGCCCCTCC 0: 1
1: 0
2: 3
3: 31
4: 398
Right 1162506925 19:11090901-11090923 GCCGAGATCTTCAGCCACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 46
1162506917_1162506925 -1 Left 1162506917 19:11090879-11090901 CCCCGCCCCTCCTTGGTCTGCAG 0: 1
1: 0
2: 1
3: 30
4: 328
Right 1162506925 19:11090901-11090923 GCCGAGATCTTCAGCCACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 46
1162506920_1162506925 -6 Left 1162506920 19:11090884-11090906 CCCCTCCTTGGTCTGCAGCCGAG 0: 1
1: 0
2: 2
3: 12
4: 185
Right 1162506925 19:11090901-11090923 GCCGAGATCTTCAGCCACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 46
1162506919_1162506925 -3 Left 1162506919 19:11090881-11090903 CCGCCCCTCCTTGGTCTGCAGCC 0: 1
1: 0
2: 4
3: 64
4: 451
Right 1162506925 19:11090901-11090923 GCCGAGATCTTCAGCCACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 46
1162506921_1162506925 -7 Left 1162506921 19:11090885-11090907 CCCTCCTTGGTCTGCAGCCGAGA 0: 1
1: 0
2: 0
3: 6
4: 139
Right 1162506925 19:11090901-11090923 GCCGAGATCTTCAGCCACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162506925 Original CRISPR GCCGAGATCTTCAGCCACGG TGG Intronic
907418533 1:54330866-54330888 GCAGTGATCTGCACCCACGGTGG - Intronic
913662426 1:121016242-121016264 GCTAACATCTTCAGCCACCGTGG - Intergenic
914013806 1:143799438-143799460 GCTAACATCTTCAGCCACCGTGG - Intergenic
914164018 1:145161759-145161781 GCTAACATCTTCAGCCACCGTGG + Intergenic
914446751 1:147757214-147757236 GACCAGATCATCAGCCACTGAGG - Exonic
914652429 1:149708057-149708079 GCTAACATCTTCAGCCACCGTGG - Intergenic
918420953 1:184363837-184363859 GGCGAGGTGTGCAGCCACGGGGG - Intergenic
919906968 1:202085083-202085105 TCCGGGATCTTCAGTCAAGGGGG - Intergenic
1079733197 11:23962019-23962041 GCCGAGTTCTACAGCCCAGGTGG - Intergenic
1084097452 11:66920984-66921006 GCCGAGATCTCCAGGCTGGGTGG + Intronic
1102990354 12:117311327-117311349 CCCAAGCTCTCCAGCCACGGCGG + Intronic
1103193982 12:119026069-119026091 GCCCAGATCTTCAACCACAGAGG - Intronic
1104464082 12:128976471-128976493 CCCGAGATCTTTAACGACGGCGG + Intronic
1129207633 15:74046409-74046431 GCTGAGGTCATCAGCCATGGAGG - Exonic
1129543107 15:76367391-76367413 GCCTTGGTCTTCAGCCATGGAGG - Intronic
1136113779 16:28081645-28081667 CCCAAGATCTTCAGCGACAGAGG - Intergenic
1141406229 16:83795720-83795742 GCCGTGATCCTGAGCCAAGGAGG + Intronic
1141860504 16:86713177-86713199 GACGAGATCTCCCGCCTCGGAGG + Intergenic
1142428112 16:90011435-90011457 GCCCAGCTCTTAAGCCACTGGGG - Intronic
1145867556 17:28250608-28250630 TCCGAGGTGTTCAGCCACTGGGG + Intergenic
1147924573 17:43938655-43938677 TCCGAGGTGTTCAGCCACTGGGG - Exonic
1151476210 17:74345536-74345558 GCCGAGCTCTGCAGCCTTGGTGG + Intronic
1160942504 19:1626996-1627018 GCCGAGATCCTCACCCACGCTGG - Intronic
1161328433 19:3674477-3674499 GCCGAGATCTGCAGCTACTCGGG - Intronic
1161328448 19:3674552-3674574 GCCGAGATCTGCAGCTACTCGGG - Intronic
1161462143 19:4403732-4403754 GCCATGATTTTCAGCCAAGGCGG - Intronic
1162506925 19:11090901-11090923 GCCGAGATCTTCAGCCACGGTGG + Intronic
1162859795 19:13497912-13497934 GCTGAGATTTGCAGCCAGGGTGG + Intronic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1163889806 19:20000686-20000708 GCATAGATCTTCAGCCAGGAAGG - Intronic
1164673965 19:30089644-30089666 GCTGGGGTCTTCACCCACGGTGG - Intergenic
1168527395 19:57099931-57099953 GCCGAGATCTCCAGCCTGGGTGG + Intergenic
925207977 2:2023403-2023425 GCCGAGTTCTTCACACACGCAGG - Intronic
927364384 2:22276988-22277010 GCTGACACCTTCAGCCACAGAGG + Intergenic
1184473797 22:44710206-44710228 GCTGAGATCTGCTGCCACTGGGG - Intronic
1185252330 22:49810704-49810726 GGCAACATCTTCAGCCACTGTGG + Intronic
949632636 3:5944699-5944721 CCAGAGATCTTCATCCACGATGG - Intergenic
952935511 3:38395416-38395438 GCAGAGTTCTTCAGCTACAGAGG - Intronic
954871883 3:53773518-53773540 GCAGAGATCTACAGCCACCTGGG - Intronic
958862913 3:99466704-99466726 GCAGATATCTTCAGCAACTGGGG - Intergenic
984865807 4:184279663-184279685 GCTGAGATCATCAGCCAAGCAGG - Intergenic
986664715 5:10091101-10091123 GCAGAGAACTTAAGCCACTGAGG + Intergenic
998689768 5:144574660-144574682 CCTGAAATCTGCAGCCACGGGGG - Intergenic
1001617183 5:173052144-173052166 GGTGAGATCTTGAGCCATGGAGG + Intergenic
1006099262 6:31675990-31676012 GCCAAGTTCTTCAGCCTCTGAGG - Intergenic
1024244474 7:47458758-47458780 GCCCTGCTCTTCAGCCACAGGGG - Intronic
1032548811 7:132765675-132765697 GCCGAGAACTCCAGCCCAGGGGG + Intergenic
1037877657 8:22556026-22556048 GCAGAGATGTTCAGCCATAGAGG + Intronic
1060927491 9:127465200-127465222 GCCGGGATCTGAAGCCATGGCGG + Intronic
1061296348 9:129678976-129678998 GCCCAGATCCTCAGCCAGGGAGG + Intronic
1185734886 X:2489053-2489075 GCCGAGATCTTCTGCCAGACAGG - Exonic
1195589366 X:106606151-106606173 GCGGAGAGCTTGAGCCCCGGAGG + Intergenic