ID: 1162517214

View in Genome Browser
Species Human (GRCh38)
Location 19:11155668-11155690
Sequence GCTGCTGGGGCGCCACGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 3, 2: 1, 3: 22, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162517214_1162517219 1 Left 1162517214 19:11155668-11155690 CCTGCTCGTGGCGCCCCAGCAGC 0: 1
1: 3
2: 1
3: 22
4: 257
Right 1162517219 19:11155692-11155714 GTCGCTGCTGCGCCTCCGCGCGG 0: 1
1: 0
2: 1
3: 3
4: 82
1162517214_1162517220 5 Left 1162517214 19:11155668-11155690 CCTGCTCGTGGCGCCCCAGCAGC 0: 1
1: 3
2: 1
3: 22
4: 257
Right 1162517220 19:11155696-11155718 CTGCTGCGCCTCCGCGCGGTTGG 0: 1
1: 0
2: 1
3: 4
4: 69
1162517214_1162517223 16 Left 1162517214 19:11155668-11155690 CCTGCTCGTGGCGCCCCAGCAGC 0: 1
1: 3
2: 1
3: 22
4: 257
Right 1162517223 19:11155707-11155729 CCGCGCGGTTGGCGCCCAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162517214 Original CRISPR GCTGCTGGGGCGCCACGAGC AGG (reversed) Exonic
900013316 1:133662-133684 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
900064818 1:724646-724668 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
900146025 1:1158951-1158973 GCTGCTGGAGGACCCCGAGCTGG - Intergenic
900243394 1:1627186-1627208 GCTGCGGAGGCGCCCAGAGCAGG + Exonic
900306895 1:2014536-2014558 GCTGCTGGGGAGACAAGATCTGG - Intergenic
900413480 1:2524386-2524408 GCTGCTGGGAGGCCACGCTCAGG - Intronic
900506664 1:3032740-3032762 CAGGCTGGGGCCCCACGAGCAGG + Intergenic
900647861 1:3717188-3717210 GCTGCCGGGGAGCGAGGAGCGGG + Intronic
900965213 1:5952714-5952736 GCTGCTGGAGCTCCACGTCCAGG - Exonic
901057200 1:6454163-6454185 GCTGCTGCGGCGGCAAGAACAGG - Intronic
901084794 1:6603664-6603686 GCTGCTCGGACTCCACGAGAGGG + Intronic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
902080496 1:13817468-13817490 TCTGCTGGTGACCCACGAGCAGG + Intronic
902477164 1:16694328-16694350 GCTGCTGCGGCGGCAAGAACAGG + Intergenic
902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG + Exonic
904047112 1:27615497-27615519 GCTGCTGCGGCACGACAAGCTGG - Exonic
904462623 1:30689252-30689274 CCTGCTGGGGCACCACCAGTAGG + Intergenic
905685046 1:39901850-39901872 GCTGCCGGGCTGCCCCGAGCCGG - Exonic
905862568 1:41361282-41361304 GCGGCGGGGTCGCCCCGAGCTGG + Intergenic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
913570066 1:120110854-120110876 GCTGCTGGGGAGACATCAGCCGG + Intergenic
913676617 1:121146887-121146909 GCTGTTGGGGCGTCAGGGGCAGG - Intergenic
914028513 1:143934837-143934859 GCTGTTGGGGCGTCAGGGGCAGG - Intergenic
914290875 1:146271820-146271842 GCTGCTGGGGAGACATCAGCCGG + Intergenic
914551919 1:148722603-148722625 GCTGCTGGGGAGACATCAGCCGG + Intergenic
919103543 1:193122158-193122180 GCAGCGGCGGCGCCCCGAGCCGG + Exonic
919758236 1:201079364-201079386 GCTGCTGGGAGGTCAGGAGCAGG - Intronic
920080147 1:203367170-203367192 GCAGCTGTGGCCCCACGAGAGGG - Intergenic
920382938 1:205546245-205546267 TCTGCTGGGGAGCCAAGGGCTGG + Intergenic
920446756 1:206023749-206023771 GCTGCTGGTGCTCCTGGAGCTGG - Exonic
920463979 1:206165728-206165750 GCTGTTGGGGCGTCAGGGGCAGG - Intergenic
921866752 1:220094438-220094460 GCTGCTGGGCCGCCAGCAGCCGG + Exonic
922099723 1:222470665-222470687 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
922261757 1:223950160-223950182 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
922729412 1:227942074-227942096 GCTGCTGGGGTGGCCCGGGCTGG - Intronic
922735323 1:227975585-227975607 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
923744292 1:236686389-236686411 GCGGCTGGGGCCCGACGGGCGGG + Intergenic
924342922 1:243052332-243052354 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
924727431 1:246683532-246683554 GCTGCTGCGCTGCCATGAGCGGG + Intergenic
1063391470 10:5652531-5652553 GCTGCTTGGGCCCAAAGAGCAGG - Intronic
1063663164 10:8047585-8047607 GCTGCTGGGCTGACCCGAGCTGG + Intergenic
1064161885 10:12953632-12953654 CTTGCTGGGGGACCACGAGCTGG + Intronic
1065140532 10:22714655-22714677 GCGGCTGCGGCGCCGCGGGCGGG + Intergenic
1066733561 10:38453220-38453242 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1067110461 10:43396719-43396741 GCTGCTGGAGTGCCGTGAGCAGG - Exonic
1067569597 10:47361584-47361606 GGTGCAGGGTCGCCACCAGCCGG - Intergenic
1068982164 10:63073079-63073101 GCTGCTGTGGGGACACGGGCTGG + Intergenic
1072710713 10:97714113-97714135 GCTGCTGGGCAAGCACGAGCTGG + Exonic
1073403570 10:103277703-103277725 CCTGCTGGAGCGCGACGGGCTGG + Exonic
1076969652 11:125866-125888 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1076999579 11:315948-315970 GCTGCTGGGCCGTGGCGAGCTGG - Intergenic
1077316727 11:1922641-1922663 GAGTCTGGGGCGCCAAGAGCTGG + Intronic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1078631843 11:13010302-13010324 GGTGCAGCGGCTCCACGAGCTGG + Intergenic
1081526465 11:43931231-43931253 CCTGCTGGGGCGTCATGAGTGGG + Intronic
1081716110 11:45251762-45251784 GCTGTTGGGGGGCCACAAGTGGG - Intronic
1082810592 11:57476884-57476906 GGTGGTGGGGCACCAGGAGCAGG - Exonic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083753688 11:64778047-64778069 GCTGCGGCGGCGACACGCGCTGG + Exonic
1084311193 11:68317274-68317296 GCTGGTGGGGTCCCAAGAGCTGG + Intronic
1084362383 11:68677466-68677488 GCAGCTGGGGGGCCACAAGGAGG - Intergenic
1088679467 11:112226636-112226658 GCTGCTGGGGCGACGCGCGCTGG + Intronic
1089163593 11:116458072-116458094 GCTGGTGGGGGGCCAGGGGCGGG + Intergenic
1091250715 11:134141680-134141702 GCTGGTGGGGGGCCCCAAGCTGG + Intronic
1091549945 12:1529975-1529997 GCTCCTTGGGCGCCCCGAGGGGG + Intronic
1091569153 12:1669437-1669459 GCACCTGGGGCCCCACGACCTGG + Intergenic
1092190052 12:6512635-6512657 GCCACTGGGGAGCCACAAGCAGG + Intronic
1096670876 12:53197649-53197671 GCTGCTGGGGCTCCCCTAGGGGG + Exonic
1097246755 12:57611402-57611424 GCCGCGGGGCCGCCACGAGGCGG - Intronic
1098226686 12:68332077-68332099 GATTCTGGGGCCCCTCGAGCAGG + Intronic
1101414734 12:104499313-104499335 GCTTCTGGGGCCCCACTGGCTGG - Intronic
1101866389 12:108523515-108523537 GCTGCTGGGGCGGCAACTGCAGG + Exonic
1104602421 12:130162547-130162569 GCTGTGGGGGCGCCGCGAGCTGG + Exonic
1104969693 12:132525630-132525652 GGTGCTGGGGTGCCGGGAGCAGG + Intronic
1105774154 13:23640996-23641018 GCTGCTTGGGCACTACGACCTGG - Intronic
1108478374 13:50843214-50843236 GCTGCTGGGGCCCCTCCAGCAGG - Exonic
1110119597 13:71865762-71865784 GCGGCTGGCGAGCCCCGAGCAGG + Intronic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1113554042 13:111216767-111216789 GCTCCTGTGCCGGCACGAGCAGG + Intronic
1117097701 14:52314680-52314702 GCTGCTGGCGCGCCGCTGGCGGG + Exonic
1118312793 14:64705539-64705561 CCTGCTGGGGCCCCCAGAGCAGG - Intronic
1122602936 14:102930283-102930305 GCAGCGGCGGCGCCACCAGCAGG - Exonic
1123987659 15:25659352-25659374 GCTCCTGGGGCGCAACGGGTGGG - Intergenic
1124328823 15:28789549-28789571 GCTGCTGCGGCGCCATGATCTGG - Intergenic
1124363419 15:29054814-29054836 GCTGAAGTGGCCCCACGAGCAGG + Exonic
1124971610 15:34495022-34495044 CCTGGTGGCGCGCCCCGAGCCGG + Intergenic
1125510793 15:40291413-40291435 GCTGCAGCGGCGGCACGAGAAGG - Exonic
1125599828 15:40909394-40909416 GCTGCTTGGGCGCCAGGCCCTGG - Intergenic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1128224633 15:65993386-65993408 GCTGCTGGGCCGCTGGGAGCTGG - Intronic
1128736135 15:70055012-70055034 GCTGCTGCGCCGCCTCCAGCTGG - Intronic
1129082495 15:73052741-73052763 GCTGCTCGGGCGCCGGGCGCCGG + Exonic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1129530652 15:76261633-76261655 GCTGCTGTGGCGGCAGCAGCAGG + Intronic
1132873031 16:2124034-2124056 GCTGCTGGGGCACCACTGGGTGG + Intronic
1133993409 16:10728244-10728266 GCTGCTTGAGCTCCACGGGCTGG + Intergenic
1134247633 16:12551837-12551859 GCTGCTGGGGACACAGGAGCAGG + Intronic
1134552119 16:15143213-15143235 GCTGCTGGGGCACCACTGGGTGG + Intergenic
1136349324 16:29696872-29696894 GCAGCTGGGGCGCGGGGAGCCGG - Intronic
1136398879 16:30007138-30007160 GCTGCAGGGGCGCCAGGGGAGGG - Intronic
1137053939 16:35734636-35734658 GCTGCTGTGGCACCAGGGGCTGG - Intergenic
1138782655 16:59807923-59807945 GCTACTGGGGCTCCAGGATCTGG - Intergenic
1139466047 16:67154765-67154787 GCTGCTGCGGCGCTTCGTGCAGG - Exonic
1139785011 16:69385746-69385768 CCGGCGGGGGCGCCACGAGCCGG - Exonic
1140302413 16:73771317-73771339 GCTGTTGGGGCGCCATCACCAGG - Intergenic
1140457830 16:75115038-75115060 GCTGCTGGGGGGACACCCGCGGG - Intronic
1141132502 16:81445304-81445326 GCTGCTGGGGGGCGACGTGTCGG + Exonic
1141967532 16:87456398-87456420 GCTGCTGGGGCTACAGGTGCCGG - Intronic
1142220674 16:88853487-88853509 GCTGCTGTGGCAACAGGAGCTGG + Intronic
1142432333 16:90036493-90036515 GCTGATGCAGCGCCACGAGGAGG + Exonic
1142451024 16:90173256-90173278 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1142456539 17:60439-60461 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1142954600 17:3513024-3513046 CCTGCTGGGCCGCCGCGATCTGG - Intronic
1142985762 17:3694761-3694783 GCTGCTGGGGCCCCACCCTCAGG + Intronic
1145018249 17:19412540-19412562 GCTCCCGGGGCGCCATGGGCTGG - Exonic
1145094044 17:20009460-20009482 GCGGCTGAGGCGCAAAGAGCCGG - Intronic
1145235309 17:21203758-21203780 GCTGCTGGGTGGTCAGGAGCTGG - Intronic
1145247089 17:21276292-21276314 TCTGTTGGGGGGCCACGACCCGG - Intergenic
1146352999 17:32111531-32111553 GGTGCTGTGGCGCCCCCAGCAGG + Intergenic
1147512627 17:41084451-41084473 GCAGCTGGGGCGGCAGCAGCTGG - Exonic
1147513882 17:41097773-41097795 GCAGCTGGGGCGGCAGCAGCTGG + Exonic
1147514817 17:41105753-41105775 GCAGCTGGGGCGACAGCAGCTGG - Exonic
1147515977 17:41117974-41117996 GCAGCTGGGGCGACAGCAGCTGG + Exonic
1147515993 17:41118079-41118101 GCAGCTGGGGCGACAGCAGCTGG + Exonic
1147517967 17:41140131-41140153 GCAGCTGGGGCGACAGCAGCTGG + Exonic
1148818282 17:50346167-50346189 GCTGGTGCGGCGCTACAAGCTGG + Exonic
1148860204 17:50600655-50600677 TCTGCTGAGGAGCCAGGAGCCGG + Intronic
1149570963 17:57672077-57672099 GCTGCTGGGTCCCCACTAGAGGG - Intronic
1150765535 17:67998895-67998917 GCTCCTGGGGTGGCACCAGCTGG + Intergenic
1151681432 17:75624772-75624794 GCTGCAGGGGCCGCACCAGCTGG - Intergenic
1151895084 17:76974724-76974746 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1152365886 17:79856032-79856054 GCTCCTGGGGAGCCACCGGCTGG + Intergenic
1152644768 17:81463673-81463695 ACTGCTCGCGCGCCACGACCTGG - Exonic
1152799081 17:82322769-82322791 CCTGCTGGGGCTCCAGGAGAGGG - Intronic
1152848279 17:82615894-82615916 GGTGCTGTGGCGCCCCCAGCTGG + Exonic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1156078955 18:33312454-33312476 ACTGCTGGGGCCTCATGAGCTGG - Intronic
1160621141 18:80171397-80171419 GCTGCTGTGGCGCCCCCTGCTGG - Exonic
1160646457 19:195792-195814 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1160792619 19:929570-929592 GCAGCGGGCGCGCCAGGAGCTGG + Exonic
1161215753 19:3094453-3094475 GCGGCTGGCGCGGCCCGAGCGGG + Exonic
1162397477 19:10425433-10425455 GGTGCTGGGCAGCCAGGAGCTGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163161869 19:15469697-15469719 GCTGCTGGGCCACCGCCAGCTGG - Exonic
1163287113 19:16355758-16355780 GCGGCTGCGGCGGCAGGAGCAGG - Exonic
1163767243 19:19170436-19170458 GATGCTGGGGCGCCATGGGTGGG + Intronic
1165070811 19:33253903-33253925 GCTGCTGGGACCAGACGAGCTGG - Intergenic
1165204565 19:34172629-34172651 GCGGCGGCGGCGCCATGAGCGGG + Exonic
1166331171 19:42078873-42078895 GCTCCTGGTGCTCCAGGAGCTGG - Exonic
1166862174 19:45816875-45816897 GCTGCTGGGGCGGCAGCTGCAGG + Exonic
1166898044 19:46036325-46036347 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1167659288 19:50786400-50786422 GGTGCTGGGGAGCCATGAGAGGG + Intergenic
1167738669 19:51311684-51311706 GCTGGGGGGGCGCGACGAGGCGG - Intergenic
1167747982 19:51364024-51364046 GGTGCTGGGGAGCCACAGGCAGG + Intronic
1168713402 19:58514071-58514093 GCTGCTGGAGCGCCACCTGGCGG - Exonic
1202711180 1_KI270714v1_random:20154-20176 GCTGCTGCGGCGGCAAGAACAGG + Intergenic
925608593 2:5684108-5684130 GCTGCTGGGGAACCAGGAGATGG - Intergenic
927419227 2:22912611-22912633 GCAGCTGGAGCGCCAGAAGCAGG + Intergenic
927980447 2:27371322-27371344 GCTCCTGGGGCTGCACGAGCAGG + Exonic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG + Exonic
937160938 2:119760190-119760212 GCTGCTGGGCAGCCGCGGGCCGG - Exonic
937231546 2:120400862-120400884 GCTTCCGGGGCCCAACGAGCTGG - Intergenic
938252843 2:129828887-129828909 GATGCTGGGGGGCCTCCAGCTGG + Intergenic
942653982 2:178195256-178195278 GCTGCAGGGGCGCCAGCAGCGGG - Intronic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
945946629 2:216001487-216001509 GCTGCTTCGTAGCCACGAGCAGG - Intronic
946417540 2:219547924-219547946 ACTGCTGGGGCGCTACGTGGTGG + Exonic
947913964 2:233819988-233820010 GCTGCTGGCGCACCACCACCAGG + Exonic
948850034 2:240701338-240701360 GCTGCTGCGGCGCCAGCCGCGGG + Intergenic
948862635 2:240760307-240760329 GCTGGCGGAGCGCCAAGAGCGGG - Intronic
1168827420 20:823140-823162 TCTGCTGGGGCCCCACAGGCAGG - Intergenic
1168973606 20:1947620-1947642 GCTGATGGAGGGCCTCGAGCTGG + Intergenic
1169498004 20:6133244-6133266 GCTGCTGGAGCCTCACGACCTGG + Intergenic
1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG + Intergenic
1175777716 20:61663588-61663610 GCTGCTGGGACGGCAGGACCGGG + Intronic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1176062366 20:63178085-63178107 GCTCCTGGGTCGGCACGGGCAGG + Intergenic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1181015640 22:20066894-20066916 GCTGCTGGGGAGCCCTGGGCAGG - Intergenic
1181060009 22:20277931-20277953 ACTGCTGGTGCGCCCTGAGCGGG - Intronic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181104299 22:20564463-20564485 GCTGCTGCAGCGCCACCTGCTGG - Exonic
1181635603 22:24172976-24172998 TCTCCTGGGGCCCCACCAGCTGG - Intronic
1181793048 22:25282798-25282820 GCTGGTGGGGCGCGCCGAGCAGG + Intergenic
1181813688 22:25421086-25421108 GCTGCTGGGGCGCGCAGAGCGGG + Intergenic
1182122723 22:27797872-27797894 GCTCCTGGGGCCCCAGGACCCGG - Exonic
1183431003 22:37765729-37765751 GCTGCAGCGGCACCACGAGCGGG + Exonic
1183780337 22:39995153-39995175 GCTGCTGGGCGGCGGCGAGCAGG + Exonic
1184473588 22:44709177-44709199 GGTGGTGGGGAGCCACAAGCAGG - Intronic
1184890377 22:47375475-47375497 GCTGCTAGGTAGCCACGACCCGG - Intergenic
1185171230 22:49295808-49295830 GCTGATGGGGCGGCGCAAGCCGG + Intergenic
1185278901 22:49961558-49961580 GGTGCTGGAGCGGCCCGAGCCGG + Exonic
1185380265 22:50504661-50504683 GCTGGTGGGGCACCACAACCGGG + Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950181848 3:10918938-10918960 GCTGGTGGGGCCACAGGAGCCGG - Intronic
952451747 3:33439994-33440016 GCTGCGGGGGCCCCACTGGCAGG + Exonic
954138136 3:48591700-48591722 TCTGCTGGAGGGCCACGAGGTGG - Exonic
954701465 3:52453003-52453025 GCTTCTGAGGCGGCACTAGCAGG - Intronic
955624260 3:60899979-60900001 GCTGCTGGGGCCCAATGAGTGGG - Intronic
956892256 3:73624444-73624466 GCTGCTGCGGCGCGACGTGGAGG - Exonic
957215735 3:77317675-77317697 GCTGCTGGGGGGCTACTAGGGGG + Intronic
958636173 3:96750201-96750223 GCTACTGGGGGACCAAGAGCAGG + Intergenic
959863780 3:111243302-111243324 GCTCTTGGGGGGCCAGGAGCAGG - Intronic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
962278624 3:134033754-134033776 GCTGCTGGGGAGGCAAGAGAAGG + Intronic
966721240 3:183064527-183064549 GCTGGTGGCGTGCCATGAGCAGG - Intronic
967281222 3:187825923-187825945 GCTGCTGGGGAAACAGGAGCAGG - Intergenic
968371224 3:198223734-198223756 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
968431121 4:559757-559779 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431125 4:559772-559794 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431139 4:559832-559854 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431146 4:559862-559884 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431153 4:559892-559914 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431174 4:559982-560004 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968627178 4:1631218-1631240 GCTGCTGGGAAGCCCCAAGCAGG - Intronic
968725765 4:2247188-2247210 GATGCTGTGGCGCCTGGAGCTGG - Intergenic
969485104 4:7467783-7467805 GCTGCTGTGGCTCCCGGAGCCGG + Intronic
973279307 4:48342069-48342091 GCCGCTGCGGCCCGACGAGCTGG + Exonic
978578158 4:110206579-110206601 GCTGCTGGGGAGCCATGGTCAGG - Intergenic
979259910 4:118636207-118636229 GCTGCTGGGGCAACATGGGCAGG - Intergenic
979328474 4:119404418-119404440 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
979495806 4:121380962-121380984 GGTGCTGGAGCGCCACGCGAGGG + Exonic
986597507 5:9439064-9439086 GCTGCTGGGGCGTCTCAGGCAGG - Intronic
995650388 5:114362289-114362311 GCTGCTGGTGCGCGAGGTGCGGG - Exonic
995745057 5:115394167-115394189 GCTCTTGGGGGGCCAGGAGCAGG - Intergenic
1002091832 5:176810648-176810670 GCCCCGGGGGCGCCCCGAGCTGG + Exonic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002206914 5:177569261-177569283 GCTGCTGGGGCCCCACGGTGTGG + Intergenic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1007261595 6:40567830-40567852 GCTGGTGAGGCGGCACCAGCAGG + Intronic
1010723992 6:79312703-79312725 GCTGTTGGGGCCCCAAGAGAAGG - Intergenic
1012245898 6:96925084-96925106 GCTGCTGGTGCGCCAAGTGGGGG + Intronic
1014459806 6:121682911-121682933 GCTGCGGTGGCACCATGAGCGGG + Intergenic
1014882705 6:126743293-126743315 GCTGCTGGGGATCCTCTAGCTGG + Intergenic
1016986033 6:149896590-149896612 GCTGCTGTGGGGACACCAGCGGG + Intronic
1019169447 6:170123970-170123992 GCTGCTGTGGTGCCAGCAGCAGG - Intergenic
1019302130 7:311012-311034 GATGCTGGGCTGCCACGATCAGG + Intergenic
1020137065 7:5593539-5593561 CCTGGTGGCGCGCCCCGAGCCGG + Exonic
1023989469 7:45119485-45119507 GCTGAGGGGGCGCCACAAGGAGG - Intergenic
1024075609 7:45816453-45816475 GCTGCTGGGGCAGCATGAGCAGG - Intergenic
1024647990 7:51384844-51384866 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1025051844 7:55739343-55739365 GCTGCTGGGGAAGCATGAGCAGG + Intergenic
1025128802 7:56365011-56365033 GCTGTTGGGGCAGCATGAGCAGG + Intergenic
1025177183 7:56807889-56807911 GCTGCTGGGGCAGCATGGGCAGG + Intergenic
1025694609 7:63768497-63768519 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1025959063 7:66205009-66205031 GCTGCAGGGGAGCCGCGGGCAGG - Intergenic
1027232990 7:76282764-76282786 GCGGCTGGAGCTCCAGGAGCGGG - Exonic
1028909523 7:96192440-96192462 GATTCTGGTGCTCCACGAGCAGG + Intronic
1032052134 7:128656200-128656222 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1034271241 7:149804279-149804301 ACTGCCTGGGCGCCAGGAGCAGG + Intergenic
1034347652 7:150397210-150397232 GCCGCGGGGGCGCCCCGAGTGGG + Exonic
1035901801 8:3465133-3465155 GCTGCTGGGGCCTCACCAGCAGG + Intronic
1038278087 8:26138702-26138724 ACGGCTGAGGCCCCACGAGCAGG + Intergenic
1039608409 8:38901149-38901171 GGTGCCGGGGCGCCGCGGGCTGG - Intergenic
1045277634 8:100721850-100721872 GCTGCTGCGGGGCCGCGGGCGGG + Exonic
1049168148 8:141139798-141139820 GCTGCTGGGAAGGCAGGAGCAGG - Intronic
1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG + Exonic
1049456418 8:142693310-142693332 TCTGCTGGGGAGCCTGGAGCCGG - Intergenic
1049566590 8:143343433-143343455 GCTGCTGGTGACCCACGTGCTGG + Intronic
1049608158 8:143539260-143539282 GCTGCTGGGGTACCAGGGGCCGG + Exonic
1050130417 9:2406547-2406569 GTTACTGGGGGGCCAGGAGCAGG + Intergenic
1057214579 9:93220792-93220814 GATGCTGGGGCAGCACGGGCAGG - Intronic
1059747204 9:117214577-117214599 GCTGCTGGGTCCCCAGGCGCGGG - Exonic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061203680 9:129151073-129151095 GCCGCTGGGGTGCCAGCAGCAGG - Intergenic
1061517308 9:131097138-131097160 GCTTGCGGGGAGCCACGAGCCGG - Intronic
1061609881 9:131739549-131739571 GCTGCGGGGGCGCCAGGGGCCGG - Intronic
1062499409 9:136845827-136845849 CCTGCTGGGGCGCGAGGTGCGGG + Exonic
1062754873 9:138281790-138281812 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1203578781 Un_KI270745v1:25959-25981 GCTGCTGGGGCAGCATGGGCAGG - Intergenic
1185759347 X:2677926-2677948 GCTGCCGGGTGGCCAGGAGCAGG + Intergenic
1190094481 X:47467576-47467598 GCTGCTGGGGCGAGGCAAGCAGG + Exonic
1192189173 X:68980308-68980330 TCTGCTGAGGAGCCATGAGCAGG - Intergenic
1192510367 X:71717581-71717603 GCTGCTGGGGATCCACGCGGAGG + Exonic
1192516330 X:71763972-71763994 GCTGCTGGGGATCCACGCGGAGG - Exonic
1198480221 X:137033922-137033944 GCTGCGGGCGCGGCAGGAGCGGG + Intergenic
1201948570 Y:19538643-19538665 GCTTCTGGGGAGCCAAGATCAGG + Intergenic
1202381403 Y:24278577-24278599 GCTGCTGGGGCAGCAAGGGCAGG - Intergenic
1202489382 Y:25391549-25391571 GCTGCTGGGGCAGCAAGGGCAGG + Intergenic