ID: 1162519916

View in Genome Browser
Species Human (GRCh38)
Location 19:11173711-11173733
Sequence GTCTCCTCCATCAGACTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 6, 2: 6, 3: 40, 4: 143}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162519903_1162519916 10 Left 1162519903 19:11173678-11173700 CCCGTGCCTCCCCCACCAGACTG 0: 1
1: 1
2: 7
3: 49
4: 421
Right 1162519916 19:11173711-11173733 GTCTCCTCCATCAGACTGGGAGG 0: 1
1: 6
2: 6
3: 40
4: 143
1162519911_1162519916 -1 Left 1162519911 19:11173689-11173711 CCCACCAGACTGGGAAGGAAGTG 0: 1
1: 0
2: 0
3: 24
4: 299
Right 1162519916 19:11173711-11173733 GTCTCCTCCATCAGACTGGGAGG 0: 1
1: 6
2: 6
3: 40
4: 143
1162519909_1162519916 1 Left 1162519909 19:11173687-11173709 CCCCCACCAGACTGGGAAGGAAG 0: 1
1: 0
2: 4
3: 27
4: 259
Right 1162519916 19:11173711-11173733 GTCTCCTCCATCAGACTGGGAGG 0: 1
1: 6
2: 6
3: 40
4: 143
1162519912_1162519916 -2 Left 1162519912 19:11173690-11173712 CCACCAGACTGGGAAGGAAGTGT 0: 1
1: 0
2: 1
3: 34
4: 270
Right 1162519916 19:11173711-11173733 GTCTCCTCCATCAGACTGGGAGG 0: 1
1: 6
2: 6
3: 40
4: 143
1162519913_1162519916 -5 Left 1162519913 19:11173693-11173715 CCAGACTGGGAAGGAAGTGTCTC 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1162519916 19:11173711-11173733 GTCTCCTCCATCAGACTGGGAGG 0: 1
1: 6
2: 6
3: 40
4: 143
1162519904_1162519916 9 Left 1162519904 19:11173679-11173701 CCGTGCCTCCCCCACCAGACTGG 0: 1
1: 2
2: 7
3: 92
4: 531
Right 1162519916 19:11173711-11173733 GTCTCCTCCATCAGACTGGGAGG 0: 1
1: 6
2: 6
3: 40
4: 143
1162519910_1162519916 0 Left 1162519910 19:11173688-11173710 CCCCACCAGACTGGGAAGGAAGT 0: 1
1: 0
2: 1
3: 20
4: 208
Right 1162519916 19:11173711-11173733 GTCTCCTCCATCAGACTGGGAGG 0: 1
1: 6
2: 6
3: 40
4: 143
1162519907_1162519916 4 Left 1162519907 19:11173684-11173706 CCTCCCCCACCAGACTGGGAAGG 0: 2
1: 1
2: 3
3: 42
4: 274
Right 1162519916 19:11173711-11173733 GTCTCCTCCATCAGACTGGGAGG 0: 1
1: 6
2: 6
3: 40
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162519916 Original CRISPR GTCTCCTCCATCAGACTGGG AGG Intronic
900784395 1:4638629-4638651 GACTCCTCCATCCCAGTGGGAGG + Intergenic
902403677 1:16171843-16171865 GACTCCTCTAGCAGACTGGAGGG + Intergenic
902777889 1:18686207-18686229 TTCTCCCCCATGAGATTGGGAGG + Intronic
903362311 1:22784275-22784297 GTCTTCACCATTAGACTGGAGGG + Intronic
903891577 1:26573586-26573608 GCCTCCCCCATCAGACTGGAGGG - Intronic
904868556 1:33601996-33602018 ATCTCTTCCATTAGTCTGGGTGG + Intronic
906206703 1:43991069-43991091 GCCTCCTCTCTCAGACAGGGAGG - Exonic
906810205 1:48819106-48819128 TTCTCCTAAATCAGCCTGGGTGG + Intronic
907158530 1:52355352-52355374 TTCTCCTCCCTCAGAGTGTGTGG - Intronic
907430657 1:54409380-54409402 GTCTCCCCCACCAGACTGGGAGG + Intronic
908098003 1:60760796-60760818 GTCTCCTCCATCAGACCTCACGG + Intergenic
911943312 1:104073916-104073938 CCCTCCTCCATCAGCCTGGACGG + Intergenic
912952678 1:114131149-114131171 GCCTCCCCCATCAGACTGCGAGG + Intronic
915509116 1:156377004-156377026 GTCTCTTACAACAGACTGGCTGG - Intronic
917976843 1:180245266-180245288 TTCTCCTGCTTCAGACTGGGGGG + Intronic
918927692 1:190809396-190809418 GTCTTGCCCATCAGACTGGCTGG + Intergenic
920365216 1:205444702-205444724 ATGTCCTTCATCAGAGTGGGCGG + Intronic
923781925 1:237032367-237032389 GTCTCCTCCCTGAGATGGGGTGG + Intergenic
1062820552 10:531551-531573 GACGCTTCCGTCAGACTGGGGGG - Intronic
1067052670 10:43031590-43031612 GTTTCCTCCATCAAACTGGAGGG + Intergenic
1070312196 10:75281969-75281991 GTCTCTTCCATCAGACCAAGAGG + Intergenic
1072337494 10:94411623-94411645 GTCTCCTGAATCTGACTAGGCGG - Intronic
1075812078 10:125231619-125231641 AGCTCCTCCACCAGGCTGGGTGG + Intergenic
1075844852 10:125536912-125536934 GTCTCCTCCAGCAGCCTGGGAGG - Intergenic
1083180386 11:60981493-60981515 CTCTCCTCCTTCAGGCTGAGTGG + Intronic
1084587235 11:70069315-70069337 GACTTCTCCATCAAACTGGAAGG + Intergenic
1084939841 11:72606689-72606711 ATCTCTTCCAGCAGCCTGGGAGG + Intronic
1085521854 11:77143768-77143790 CTCTCCTCCCTCAGACCAGGAGG - Intronic
1087929447 11:103959840-103959862 GTCTTCTCCTCCAGGCTGGGAGG + Intronic
1089324087 11:117645221-117645243 TTCTTATCCATCAAACTGGGAGG - Intronic
1091386208 12:96991-97013 TTCTCATCCATCAGACTGGTTGG - Intronic
1091906678 12:4194943-4194965 TACTCCTCCATGGGACTGGGGGG - Intergenic
1096255457 12:50059351-50059373 GTCTCATACCTCAGGCTGGGTGG - Intronic
1096583291 12:52602039-52602061 GCCTTCTCCAACAGACTGAGAGG - Intergenic
1097311066 12:58119470-58119492 GTTTCTTTCATCAGCCTGGGTGG - Intergenic
1100587736 12:95995450-95995472 TTCTCCTCCATCAGAGGTGGAGG + Intronic
1100840616 12:98608524-98608546 TTCTCCTGCCTCAGCCTGGGAGG - Intergenic
1102959653 12:117084539-117084561 GCCTCCCCCATCAGGCTGTGGGG + Intronic
1103946337 12:124528766-124528788 TTCTCCTCCTTCAGGCTAGGAGG - Intronic
1108890589 13:55253263-55253285 GATTCCCCAATCAGACTGGGAGG - Intergenic
1109055118 13:57537262-57537284 ATTTTCTCCATCAGACTGGGAGG - Intergenic
1112124770 13:96453016-96453038 ATCTCCTCCATGGGACTTGGAGG - Intronic
1113007966 13:105729189-105729211 GTTCCGTCCATCTGACTGGGTGG + Intergenic
1114737671 14:25059383-25059405 TTCTCCTGCATCAGACTGTGAGG - Intergenic
1123874397 15:24608864-24608886 TTCTCCTCCATCACCCTTGGTGG - Intergenic
1123880811 15:24676291-24676313 GTCTCCTCCAGGAGAGTGGCTGG - Exonic
1128687173 15:69695420-69695442 GTCTCCCCCATCTGAGTGAGTGG + Intergenic
1128734802 15:70047266-70047288 GTCTCCTCCATAAGCCTGAGAGG + Intergenic
1129238672 15:74239216-74239238 CTATCCTCCAGCAGCCTGGGAGG - Intronic
1130870772 15:87970215-87970237 GTCACCTCCACCAGCCTGGGCGG + Intronic
1131577890 15:93610523-93610545 GTCTGCTTCACTAGACTGGGAGG - Intergenic
1132496462 16:265659-265681 GTCTCCCCCAGCAGGATGGGTGG + Exonic
1133142659 16:3759267-3759289 GTCTCATTCATCAAACTGGGTGG + Intronic
1133176813 16:4021605-4021627 GGCTCCACCAGCAGCCTGGGAGG + Intronic
1133757445 16:8772844-8772866 GTCTCCACCCTCGGACTGGATGG - Exonic
1134810857 16:17166060-17166082 GGCTCCTCCAGCAGGCTGGTGGG + Intronic
1136687145 16:32002274-32002296 GTTTCCTCCATCAGACTTGAGGG - Intergenic
1136787758 16:32945825-32945847 GTTTCCTCCATCAGACTTGAGGG - Intergenic
1136882023 16:33907964-33907986 GTTTCCTCCATCAGACTTGAGGG + Intergenic
1137047718 16:35684483-35684505 GTCTCATTCATCAGACTGCCTGG + Intergenic
1137047828 16:35685141-35685163 GTCTCATCCATTAGAATGTGTGG + Intergenic
1137048152 16:35687186-35687208 GTCTCTTCCATTAGAATGCGTGG + Intergenic
1137674853 16:50299171-50299193 GAATCCTCCAGCAGGCTGGGTGG - Intronic
1137800098 16:51255135-51255157 GTCTCTCCCATTACACTGGGTGG + Intergenic
1139495266 16:67312299-67312321 TTCACATCCATCAGCCTGGGTGG - Intronic
1140890532 16:79280972-79280994 GTCTCCCAGATCAGAATGGGAGG + Intergenic
1141464606 16:84197401-84197423 GTCTCCTCCAGCACACAGGCTGG - Intergenic
1142027779 16:87823775-87823797 TTCTCCTCCCTGAGACAGGGTGG + Intergenic
1203089986 16_KI270728v1_random:1207482-1207504 GTTTCCTCCATCAGACTTGAGGG - Intergenic
1144782495 17:17815055-17815077 GTCTCCTCCCACAGGCTGGTGGG + Intronic
1146594231 17:34155682-34155704 GCCTCCTCCCTCTGACTGGGAGG + Intronic
1146950065 17:36899711-36899733 GCCTCCCCCCACAGACTGGGAGG - Intergenic
1147148117 17:38497943-38497965 GTTTCCTCCACCAGACTTGAGGG - Intronic
1147605421 17:41771490-41771512 ACCTCCTCCTTCAGACTGGGTGG + Intronic
1148078967 17:44956946-44956968 ATCTTCTCCATCAGACTAGGGGG - Intergenic
1148439871 17:47706389-47706411 ATCTCCCCCATCAGACTGGGAGG - Intronic
1148635593 17:49146766-49146788 CTGTCCTCCATCAGACTGGAAGG + Intronic
1148751211 17:49946926-49946948 GCCTCTCCCCTCAGACTGGGGGG + Intergenic
1150932765 17:69603152-69603174 GTCTCCCCCACTAGACTGTGAGG - Intergenic
1152226155 17:79093870-79093892 GCCTCCTCCCTCAGGCTGTGGGG - Intronic
1157241767 18:46016567-46016589 GTCTCCTCCATTAGACTCTGAGG - Intronic
1159200534 18:65178423-65178445 TTTTCCTCCAGCAGACTGGCTGG + Intergenic
1160445079 18:78921451-78921473 GAATCCTCCATCAGACAGGGAGG - Intergenic
1160757211 19:764082-764104 GCCTCCTCCCTCAGACTGGATGG - Exonic
1162519916 19:11173711-11173733 GTCTCCTCCATCAGACTGGGAGG + Intronic
1162519943 19:11173879-11173901 GTCTCCTCTATCAGACTGGGAGG + Intronic
1162519961 19:11173965-11173987 GTCTCCTCCATCAGCCTGGGAGG + Intronic
1162519968 19:11173993-11174015 GCCCCCCCCATCAGACTGGAAGG + Intronic
1162519991 19:11174077-11174099 ATCTCCTCCATCAGACTAGGAGG + Intronic
1162520005 19:11174132-11174154 GTCTCCTCCATCAGCCTGGGAGG + Intronic
1162520013 19:11174160-11174182 ATCTCCTCCATCAGACTGGGAGG + Intronic
1162520020 19:11174188-11174210 ATCTCCTCCATCAGACTGGGAGG + Intronic
1162520036 19:11174247-11174269 GTCTCCTCTATCAAACTGGAAGG + Intronic
1163023701 19:14497081-14497103 GTCTCCTCCATCTGACTGTGAGG + Intergenic
1163138889 19:15332832-15332854 GCCTCCTCCATCAGTCTGTGGGG - Intergenic
1163597835 19:18230825-18230847 GTCTCCACCATCAGCCTTAGGGG + Intronic
1163606048 19:18275975-18275997 GACTCCCCCATCAGACTGGAGGG + Intergenic
1163785110 19:19270954-19270976 GCCTCCACCCTCAGACTTGGGGG - Intronic
1164375185 19:27677930-27677952 GTCTCTTCCATTAGAATGTGGGG + Intergenic
1164384526 19:27761692-27761714 GTCTCCCCCATTAGAATGTGTGG + Intergenic
1165005517 19:32803240-32803262 GACTGCTCCCTCAGAGTGGGTGG - Intronic
1165932772 19:39370936-39370958 GGCTCTGCCATCAGACTGGTTGG - Intronic
1166375905 19:42326593-42326615 ATCTCCCCCACCAGACTTGGAGG - Intronic
1166670754 19:44708252-44708274 GCTTCCTCCATCAGGCTGGGGGG + Intronic
1167286145 19:48599778-48599800 CCCTCCTCCCTCAGACTGAGGGG - Intergenic
1167593101 19:50415000-50415022 GCCTCCTCCCTCAGACTCAGGGG + Intronic
1168604406 19:57747047-57747069 GCCGCCGCCATCCGACTGGGTGG - Exonic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
926913739 2:17874473-17874495 GTTTACTCCATCACACTGGCAGG - Intergenic
927026350 2:19072812-19072834 GTCTCCTCCTTCCGACCTGGTGG - Intergenic
931240667 2:60449619-60449641 GTCTCCTCCATCCAAGTGGCTGG + Intergenic
932463136 2:71896296-71896318 GTCACCTCCATCAGACTGTTAGG + Intergenic
932614546 2:73223574-73223596 GTGTCCACCATCTGACTGGGGGG - Intronic
934559797 2:95307151-95307173 GGCTCCTCCATCTGGCTGAGGGG - Intronic
935608609 2:104997041-104997063 TTCTCTTCCATCTGAGTGGGTGG + Intergenic
938365398 2:130729467-130729489 ATCTCCTCCAGCAGCCTGGGTGG + Exonic
941715254 2:168756676-168756698 GTGTCCTCCATCATAATGTGGGG + Intronic
945898182 2:215508324-215508346 TTCTCTTCCAGCAGCCTGGGTGG - Intergenic
946208190 2:218126051-218126073 ATCTCCACCTTCAGACTGGTAGG + Exonic
946391689 2:219420087-219420109 ATCTCCTCCTGCAGCCTGGGTGG - Exonic
1169204109 20:3730566-3730588 GACTCCCTCATCAGACTGAGGGG + Intergenic
1171486891 20:25491704-25491726 GTCACCTCCAGCAGCCTGTGAGG - Intronic
1172164455 20:32890475-32890497 GTCTCCTCCTCCAGACTGGAAGG + Intronic
1172839265 20:37892324-37892346 GTCTCCTCCACAGGACTGAGAGG - Intergenic
1172851856 20:37972179-37972201 GTCTCCTCCATCAGACTGTGAGG + Intergenic
1172950842 20:38722787-38722809 GCCTCCTCCGGGAGACTGGGAGG + Intergenic
1174959488 20:55139297-55139319 GTCTCCAACATCAGACTAGAAGG + Intergenic
1175925492 20:62469359-62469381 GTCCCCGCCTTCAGACTGAGGGG + Intronic
1180793433 22:18589999-18590021 GTCTCCACCATTAGACTGGCAGG + Intergenic
1181228306 22:21405313-21405335 GTCTCCACCATTAGACTGGCAGG - Intergenic
1181250344 22:21529537-21529559 GTCTCCACCATTAGACTGGCAGG + Intergenic
1182527148 22:30927563-30927585 CTCTCTTCCACCAGACTGGCAGG + Intronic
1182716434 22:32359475-32359497 GCCTCCTCCATGAGAATTGGCGG + Intronic
1183465223 22:37976894-37976916 GTCTCCTCTGTCAGAATGGCTGG + Intronic
1183650413 22:39150402-39150424 GTCTCCACCTTCAGAAGGGGTGG + Intronic
1184857885 22:47156468-47156490 GTCTCCTCCCTCGGACATGGTGG + Intronic
1185046909 22:48533143-48533165 GGCCACTCCATCAGGCTGGGCGG - Intronic
952412925 3:33065481-33065503 CTCTCCTCTATCAGAATGGAGGG - Exonic
952924933 3:38313849-38313871 TTCTCCTCCAGCAGATTGGGAGG + Exonic
961163942 3:124750732-124750754 GTCTCCTCACTTAGACGGGGCGG + Intergenic
961814765 3:129543778-129543800 GGCTTCCCCATCAGACCGGGAGG - Intronic
961834605 3:129646601-129646623 ATCTCCTGCATAAGACTGTGGGG + Intergenic
967096288 3:186180069-186180091 GTTTCTCCCATCAGACTGTGAGG - Intronic
968600850 4:1508624-1508646 GGCTCCCCCATGAGCCTGGGAGG - Intergenic
971326679 4:25650300-25650322 GTCTCCTCCATCACCCAGGCTGG + Intergenic
973724003 4:53754185-53754207 GTCTGCTTCCCCAGACTGGGGGG - Intronic
977722740 4:100259618-100259640 ATTTCCTCCATCAGACTGAATGG + Intergenic
983726481 4:170934787-170934809 ATCTCCTCCAGCAGAATGCGTGG - Intergenic
985070038 4:186158639-186158661 GTCTCCACCCTCAACCTGGGCGG - Intronic
990729855 5:58796425-58796447 GTCTTCTCCACCACTCTGGGTGG - Intronic
991653634 5:68881767-68881789 GTCTCCTACCTCAGACTAAGAGG + Intergenic
996346438 5:122493301-122493323 GTATCCTCGATCATACTGGCTGG - Intergenic
999196237 5:149783509-149783531 GTCTCCCCCATCTGACTGGACGG - Intronic
999196490 5:149784928-149784950 GTCTCCCCCATCTGACTGGATGG + Intronic
999911429 5:156205089-156205111 CCTTCCTCCATCAGAGTGGGAGG + Intronic
1001319253 5:170666864-170666886 GTGTCCTCCAGCAGACTCTGAGG + Intronic
1005890122 6:30130511-30130533 GTTTCCTCCACGCGACTGGGTGG + Intergenic
1005926614 6:30450592-30450614 GTCTCCTTCCTCACACTGTGGGG + Intergenic
1006791074 6:36701709-36701731 GTCTCCTGCATGAGGCTGTGAGG + Intronic
1007276274 6:40676454-40676476 CTCTCCCCTCTCAGACTGGGTGG + Intergenic
1007512011 6:42381048-42381070 CTCTCCCCCATCAGACTGGGAGG + Intronic
1007749837 6:44065152-44065174 GTCTCTCCCATCAGATTGGAGGG - Intergenic
1008065534 6:47043799-47043821 TTGTCCCCCATCAGCCTGGGTGG + Intergenic
1022441605 7:30437648-30437670 GTCTCCTCCCTCAGGATGTGGGG - Exonic
1023909345 7:44542312-44542334 TTCTCCTGCATGAGGCTGGGTGG - Intergenic
1026107043 7:67429552-67429574 TTCTGGTGCATCAGACTGGGAGG + Intergenic
1026438055 7:70417084-70417106 GTCTCCTCCAGCAGAGTGGAGGG - Intronic
1026472134 7:70702711-70702733 CTCACCTCCATCAGCCTGGGAGG + Intronic
1026865963 7:73824271-73824293 GACTCCTCCATCAGATTAGAGGG + Intronic
1029513571 7:101012127-101012149 CTCTCCTCCCTCTGTCTGGGTGG + Intronic
1030105182 7:105981357-105981379 GTTTCCTCCCTGGGACTGGGAGG - Intronic
1032085431 7:128881077-128881099 GTCTCCCCCCTCAGAATGTGTGG - Exonic
1035690496 8:1556528-1556550 GTCTCCTGCCTCAGACTTGGTGG + Intronic
1035912632 8:3584483-3584505 GTCTCCACCTTCAGCCTGGATGG + Intronic
1040106766 8:43546104-43546126 GTCTCCCACATCAGGGTGGGTGG - Intergenic
1044324509 8:90844484-90844506 CTCTCTTCCATCAGCCTGGTGGG - Intronic
1046934141 8:119870191-119870213 GTCTCCTCTATCAGCCAGGCTGG - Intergenic
1054200441 9:62075684-62075706 GTCTCCTGGATCACACTGGTCGG + Intergenic
1055664442 9:78539284-78539306 GTCTCCACCAAGAGACTGGAAGG - Intergenic
1056681264 9:88721143-88721165 CTCTCCTCCCCCAGAGTGGGTGG + Intergenic
1060892792 9:127199185-127199207 GGCTCCTTCAGCAGACTGGCTGG + Intronic
1061268583 9:129523127-129523149 GTCTTCACCATCAGGCTGTGGGG - Intergenic
1061427186 9:130506740-130506762 GTCTCCTCACTTAGACGGGGCGG + Intergenic
1061697830 9:132391112-132391134 GTCTCCCGCATCAAACTGTGAGG + Intronic
1062027520 9:134347407-134347429 AGCTCCTCCATCTGCCTGGGAGG + Intronic
1188528396 X:31111086-31111108 GTCTCCTCTAGCAGACTGTGAGG + Intronic
1190877018 X:54467294-54467316 GTGTTCCACATCAGACTGGGAGG + Intronic
1191243616 X:58208666-58208688 GTCTCTCCCATCAGAATGCGTGG - Intergenic
1191245772 X:58227121-58227143 GTCTCTTCCATTAGAATGGTTGG - Intergenic
1192227261 X:69237820-69237842 GTGTCTTTCATTAGACTGGGAGG - Intergenic
1192578696 X:72263115-72263137 GTCTCCCCCAGGAGACTGTGAGG - Intronic
1196688878 X:118537317-118537339 CTCTCCTTTATCACACTGGGAGG - Intronic
1198659720 X:138955080-138955102 ATCTCCTCAATCAGACTGTCTGG + Intronic
1199359109 X:146897078-146897100 GTATCCACCATCACAATGGGAGG + Intergenic
1200011393 X:153123399-153123421 GTCTCTTCCTTCAGAGCGGGGGG + Intergenic
1200028207 X:153276523-153276545 GTCTCTTCCTTCAGAGCGGGGGG - Intergenic