ID: 1162519943

View in Genome Browser
Species Human (GRCh38)
Location 19:11173879-11173901
Sequence GTCTCCTCTATCAGACTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 1, 2: 7, 3: 13, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162519940_1162519943 -2 Left 1162519940 19:11173858-11173880 CCATTTGACTGGGAAGACAGCGT 0: 1
1: 0
2: 1
3: 12
4: 103
Right 1162519943 19:11173879-11173901 GTCTCCTCTATCAGACTGGGAGG 0: 1
1: 1
2: 7
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162519943 Original CRISPR GTCTCCTCTATCAGACTGGG AGG Intronic
901406039 1:9046424-9046446 CTCTCATCTAACAAACTGGGAGG - Intronic
901421556 1:9154584-9154606 GCCTCCTCTTTCTGACTAGGAGG - Intergenic
902403677 1:16171843-16171865 GACTCCTCTAGCAGACTGGAGGG + Intergenic
902656125 1:17869545-17869567 GCCTGCCCTATCAGCCTGGGAGG + Intergenic
903467709 1:23563785-23563807 GTCTCTTCTATTAAATTGGGAGG + Intergenic
903891577 1:26573586-26573608 GCCTCCCCCATCAGACTGGAGGG - Intronic
904788710 1:33001627-33001649 ATCTCCTCTGCTAGACTGGGAGG + Intergenic
905125528 1:35713671-35713693 GTCTCCCCTGTCACACTGGATGG + Intergenic
906206703 1:43991069-43991091 GCCTCCTCTCTCAGACAGGGAGG - Exonic
906258530 1:44368632-44368654 GTCTCTTCTCCCAGACTGAGTGG + Intergenic
906810205 1:48819106-48819128 TTCTCCTAAATCAGCCTGGGTGG + Intronic
907430657 1:54409380-54409402 GTCTCCCCCACCAGACTGGGAGG + Intronic
912044863 1:105441567-105441589 ATCTATTCTCTCAGACTGGGAGG + Intergenic
912952678 1:114131149-114131171 GCCTCCCCCATCAGACTGCGAGG + Intronic
917776608 1:178343308-178343330 GTCTCTTCTTTCCTACTGGGTGG - Intronic
917966655 1:180183113-180183135 GTCTCCTCTCTCCGAGTTGGTGG + Intronic
917976843 1:180245266-180245288 TTCTCCTGCTTCAGACTGGGGGG + Intronic
1067052670 10:43031590-43031612 GTTTCCTCCATCAAACTGGAGGG + Intergenic
1068872484 10:61960081-61960103 GTTTCCTCTTTCAGATTGGAGGG + Intronic
1072337494 10:94411623-94411645 GTCTCCTGAATCTGACTAGGCGG - Intronic
1072735634 10:97877279-97877301 GGCTCCTCTATCTGGCTGGAGGG + Intronic
1074491883 10:113945924-113945946 GTTTCCTCTTTGAAACTGGGTGG + Intergenic
1075844852 10:125536912-125536934 GTCTCCTCCAGCAGCCTGGGAGG - Intergenic
1078322833 11:10352260-10352282 GTCCCTTCTATCAGATTGTGAGG + Intronic
1078340293 11:10493656-10493678 TTCTCTTCTATCTGACTGAGAGG + Intronic
1080786834 11:35483100-35483122 CTCTCCTCTATTAGGCTGGTGGG + Intronic
1085667488 11:78427778-78427800 GTCTCCTCTGCCAGAATGTGAGG - Intergenic
1090014490 11:123073973-123073995 GTCAACTCTATTATACTGGGAGG + Intronic
1091386208 12:96991-97013 TTCTCATCCATCAGACTGGTTGG - Intronic
1091835699 12:3584033-3584055 TTCTCCTGTATCAGTCTGTGAGG + Intronic
1097334268 12:58364812-58364834 GTCTCCTTTAGCATACTAGGAGG - Intergenic
1100812958 12:98358038-98358060 GCCTCATCTATCAGACTGCCTGG + Intergenic
1101726599 12:107393318-107393340 GTTTCCTGTATCAGGCAGGGTGG + Intronic
1102752903 12:115311304-115311326 GTGTCCTCTTCCAGACTGGCTGG - Intergenic
1105267267 13:18832074-18832096 GTCTCCTCTATTAGACTAATTGG + Intergenic
1108376693 13:49820716-49820738 GTCTCCTCTCTCTGTCTGGAAGG + Intergenic
1108890589 13:55253263-55253285 GATTCCCCAATCAGACTGGGAGG - Intergenic
1109055118 13:57537262-57537284 ATTTTCTCCATCAGACTGGGAGG - Intergenic
1110429956 13:75412310-75412332 GTCTCCTCTATCATCCAGGCTGG + Intronic
1112315654 13:98360123-98360145 GTCTCCTCTGTCACACAGGCTGG + Intronic
1112357563 13:98686720-98686742 ATCTCCTTTATTAGACTGTGAGG + Intronic
1114737671 14:25059383-25059405 TTCTCCTGCATCAGACTGTGAGG - Intergenic
1124960528 15:34389966-34389988 CTCCCCTCTCTCAGAGTGGGTGG - Intronic
1124977157 15:34536187-34536209 CTCCCCTCTCTCAGAGTGGGTGG - Intronic
1126426221 15:48529440-48529462 GGCTCCTCTGGCAGAATGGGAGG + Intronic
1127543867 15:59970852-59970874 GTTTCCCCTTTCAGATTGGGAGG - Intergenic
1128734802 15:70047266-70047288 GTCTCCTCCATAAGCCTGAGAGG + Intergenic
1130594457 15:85240184-85240206 TTCTCCTCTCCCAGAGTGGGCGG + Intergenic
1130870772 15:87970215-87970237 GTCACCTCCACCAGCCTGGGCGG + Intronic
1133142659 16:3759267-3759289 GTCTCATTCATCAAACTGGGTGG + Intronic
1136096832 16:27962926-27962948 GACTACTCTGTCAGACAGGGAGG + Intronic
1136687145 16:32002274-32002296 GTTTCCTCCATCAGACTTGAGGG - Intergenic
1136787758 16:32945825-32945847 GTTTCCTCCATCAGACTTGAGGG - Intergenic
1136882023 16:33907964-33907986 GTTTCCTCCATCAGACTTGAGGG + Intergenic
1137521942 16:49202057-49202079 ATCTTCCCTATCAGACTGTGAGG + Intergenic
1140890532 16:79280972-79280994 GTCTCCCAGATCAGAATGGGAGG + Intergenic
1141518341 16:84561279-84561301 GCCTCATCTGTCAGGCTGGGAGG + Intergenic
1203089986 16_KI270728v1_random:1207482-1207504 GTTTCCTCCATCAGACTTGAGGG - Intergenic
1143545731 17:7594065-7594087 GGCTCCCCTAGGAGACTGGGCGG - Intronic
1146594231 17:34155682-34155704 GCCTCCTCCCTCTGACTGGGAGG + Intronic
1147209454 17:38863625-38863647 GTCTCCTCTGTCAGCCAGGCAGG + Intergenic
1147605421 17:41771490-41771512 ACCTCCTCCTTCAGACTGGGTGG + Intronic
1148078967 17:44956946-44956968 ATCTTCTCCATCAGACTAGGGGG - Intergenic
1148439871 17:47706389-47706411 ATCTCCCCCATCAGACTGGGAGG - Intronic
1148635593 17:49146766-49146788 CTGTCCTCCATCAGACTGGAAGG + Intronic
1149686029 17:58535326-58535348 GTCTGCCCTATCAGAGTGGCTGG - Intronic
1150673994 17:67228630-67228652 GTCTCCTCTGTCATCCTGGCTGG - Intronic
1151404588 17:73878202-73878224 CTCTCCTCTCTCAGCCAGGGAGG + Intergenic
1153707577 18:7762107-7762129 GTCTTCTCTATTGCACTGGGCGG - Intronic
1154421144 18:14229355-14229377 GTCTCCTCTATTAGACTAATTGG - Intergenic
1157241767 18:46016567-46016589 GTCTCCTCCATTAGACTCTGAGG - Intronic
1157782278 18:50450057-50450079 GTCTCCTCTATCCCAGTGAGTGG - Intergenic
1160445079 18:78921451-78921473 GAATCCTCCATCAGACAGGGAGG - Intergenic
1160757211 19:764082-764104 GCCTCCTCCCTCAGACTGGATGG - Exonic
1162118141 19:8444741-8444763 GCCTCCTCTATCGGACTCAGAGG + Intronic
1162519916 19:11173711-11173733 GTCTCCTCCATCAGACTGGGAGG + Intronic
1162519943 19:11173879-11173901 GTCTCCTCTATCAGACTGGGAGG + Intronic
1162519961 19:11173965-11173987 GTCTCCTCCATCAGCCTGGGAGG + Intronic
1162519991 19:11174077-11174099 ATCTCCTCCATCAGACTAGGAGG + Intronic
1162520005 19:11174132-11174154 GTCTCCTCCATCAGCCTGGGAGG + Intronic
1162520013 19:11174160-11174182 ATCTCCTCCATCAGACTGGGAGG + Intronic
1162520020 19:11174188-11174210 ATCTCCTCCATCAGACTGGGAGG + Intronic
1162520036 19:11174247-11174269 GTCTCCTCTATCAAACTGGAAGG + Intronic
1163023701 19:14497081-14497103 GTCTCCTCCATCTGACTGTGAGG + Intergenic
1163138889 19:15332832-15332854 GCCTCCTCCATCAGTCTGTGGGG - Intergenic
1163606048 19:18275975-18275997 GACTCCCCCATCAGACTGGAGGG + Intergenic
1166670754 19:44708252-44708274 GCTTCCTCCATCAGGCTGGGGGG + Intronic
1166685943 19:44796300-44796322 TTCTCCTCTTTCAGGCTGTGTGG - Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
925172006 2:1755674-1755696 GCCTCCCCTAACACACTGGGCGG + Intergenic
932356544 2:71072512-71072534 TTCTCCTCTACAGGACTGGGTGG + Intronic
932463136 2:71896296-71896318 GTCACCTCCATCAGACTGTTAGG + Intergenic
932614546 2:73223574-73223596 GTGTCCACCATCTGACTGGGGGG - Intronic
932701988 2:73998377-73998399 GTGTCACCTATCAGCCTGGGAGG + Intronic
938365398 2:130729467-130729489 ATCTCCTCCAGCAGCCTGGGTGG + Exonic
944483569 2:200180935-200180957 GTGTCCTCTATGTAACTGGGTGG - Intergenic
947972801 2:234338004-234338026 GTCTCCTCTTTCTGACTTTGAGG + Intergenic
1172164455 20:32890475-32890497 GTCTCCTCCTCCAGACTGGAAGG + Intronic
1172284966 20:33733795-33733817 CTCTCCTCTACCAGACTGCAGGG - Intronic
1172851856 20:37972179-37972201 GTCTCCTCCATCAGACTGTGAGG + Intergenic
1174285967 20:49473835-49473857 CTCACCTCTCTGAGACTGGGAGG - Intronic
1176852332 21:13930604-13930626 GTCTCCTCTATTAGACTAATTGG + Intergenic
1180051369 21:45332976-45332998 GTCTCCTCTTACAGCATGGGTGG - Intergenic
1180793433 22:18589999-18590021 GTCTCCACCATTAGACTGGCAGG + Intergenic
1181029895 22:20144607-20144629 GTCTCCTCTACCCCACAGGGTGG + Intronic
1181079438 22:20404241-20404263 GTCTCCTCTGTCAAAGGGGGAGG - Intronic
1181228306 22:21405313-21405335 GTCTCCACCATTAGACTGGCAGG - Intergenic
1181250344 22:21529537-21529559 GTCTCCACCATTAGACTGGCAGG + Intergenic
1181429949 22:22873185-22873207 GTCTCCTCTTGCAGGCTGTGTGG + Intronic
1182313536 22:29426716-29426738 GTCTGCTCTATCACCCTGGCCGG - Intergenic
1183150059 22:36029770-36029792 CTCTCCCCTACCAGACTGTGAGG + Intergenic
1183465223 22:37976894-37976916 GTCTCCTCTGTCAGAATGGCTGG + Intronic
949320223 3:2801682-2801704 GTCTACTCTGTCAGACAGTGAGG + Intronic
952412925 3:33065481-33065503 CTCTCCTCTATCAGAATGGAGGG - Exonic
952924933 3:38313849-38313871 TTCTCCTCCAGCAGATTGGGAGG + Exonic
956008075 3:64801740-64801762 TTCTCCTCTCTCAGACTCAGTGG + Intergenic
961163942 3:124750732-124750754 GTCTCCTCACTTAGACGGGGCGG + Intergenic
961674698 3:128557425-128557447 TTGTCCTCTATCAGACTGCAAGG - Intergenic
965805099 3:172533896-172533918 GTCTTGCCTATCAGACGGGGTGG - Intergenic
975555591 4:75661626-75661648 GTCTCCTCTGTCACTCAGGGTGG - Intronic
986308629 5:6534113-6534135 GTCTTCTCTGTCAACCTGGGAGG - Intergenic
988772988 5:34450453-34450475 GTCTGCTATATCAGACTGCTGGG + Intergenic
996346438 5:122493301-122493323 GTATCCTCGATCATACTGGCTGG - Intergenic
996611411 5:125384476-125384498 GTCTCCTCTATCACTCAGGCTGG - Intergenic
996934396 5:128931792-128931814 GTCCCCTCTTTCAGAAAGGGAGG - Intronic
999196237 5:149783509-149783531 GTCTCCCCCATCTGACTGGACGG - Intronic
999196490 5:149784928-149784950 GTCTCCCCCATCTGACTGGATGG + Intronic
999424117 5:151472001-151472023 GTCTCCAGTAACAGACTGTGTGG - Intronic
1006020536 6:31115216-31115238 GTCTCCTCTGAGAGTCTGGGTGG - Exonic
1007276274 6:40676454-40676476 CTCTCCCCTCTCAGACTGGGTGG + Intergenic
1007512011 6:42381048-42381070 CTCTCCCCCATCAGACTGGGAGG + Intronic
1007753958 6:44086914-44086936 GTGTCCCCTGGCAGACTGGGTGG - Intergenic
1010146184 6:72672143-72672165 GTCTACTCTATCACCCTGGCTGG + Intronic
1013458496 6:110354465-110354487 TTCTCCTTTATCAATCTGGGAGG + Intronic
1013604909 6:111738747-111738769 GTTTCCTCTTTCAGCCAGGGAGG - Intronic
1014531807 6:122568396-122568418 CTCTCCTCTATCACACTCTGGGG - Intronic
1022561125 7:31350871-31350893 GTCTCCCCTACTAGACTGTGAGG + Intergenic
1022648952 7:32257478-32257500 GTATCCTCTATAAAAATGGGTGG + Intronic
1026438055 7:70417084-70417106 GTCTCCTCCAGCAGAGTGGAGGG - Intronic
1026472134 7:70702711-70702733 CTCACCTCCATCAGCCTGGGAGG + Intronic
1030830769 7:114218079-114218101 GTTTTCTCTATTAGACTGTGAGG + Intronic
1033942305 7:146670841-146670863 GTGTAGTCTACCAGACTGGGCGG - Intronic
1035690496 8:1556528-1556550 GTCTCCTGCCTCAGACTTGGTGG + Intronic
1038538534 8:28372268-28372290 GTTTCCTCTCTCAGACCTGGGGG - Intronic
1041103849 8:54422700-54422722 ATCTCTTCTACAAGACTGGGTGG + Intergenic
1044647099 8:94455605-94455627 GACTCCTGTAACAAACTGGGTGG + Intronic
1046917248 8:119690937-119690959 GTCTCCTCTAGCTGATTGGATGG + Intergenic
1046934141 8:119870191-119870213 GTCTCCTCTATCAGCCAGGCTGG - Intergenic
1047995212 8:130328638-130328660 GTCTCCTCTGTCACACAGGTTGG + Intronic
1052907816 9:33852279-33852301 GTCTGCTCTATCACACAGGCTGG - Intronic
1054200441 9:62075684-62075706 GTCTCCTGGATCACACTGGTCGG + Intergenic
1054887623 9:70215954-70215976 GTCCCCTCTATGTGCCTGGGAGG - Intronic
1056276804 9:85001703-85001725 TTCTCCTCTCTCAGTCTGTGTGG - Intronic
1057873145 9:98733083-98733105 GTCTCCTCTAAGATACTGTGGGG + Exonic
1059376512 9:113885949-113885971 GTTTTCTATAGCAGACTGGGGGG - Intronic
1060520344 9:124290665-124290687 GATTCCTCTCACAGACTGGGTGG + Intronic
1061427186 9:130506740-130506762 GTCTCCTCACTTAGACGGGGCGG + Intergenic
1061830411 9:133289340-133289362 GTCTCCTCTATCAGAGTAAAGGG - Intergenic
1062376162 9:136262829-136262851 GTCTCCTCTGTAAGGCAGGGAGG - Intergenic
1186236493 X:7516451-7516473 TCCTCCCCTATCATACTGGGGGG - Intergenic
1188528396 X:31111086-31111108 GTCTCCTCTAGCAGACTGTGAGG + Intronic
1189987287 X:46565051-46565073 GTCTCCTCTCTTAGGCTGGAAGG + Intergenic
1192059634 X:67810880-67810902 GTTTCCTCTCTCAGACTAGAAGG + Intergenic
1192361933 X:70445744-70445766 GTCTCCATTAGAAGACTGGGAGG + Intronic
1196688878 X:118537317-118537339 CTCTCCTTTATCACACTGGGAGG - Intronic
1198096228 X:133382394-133382416 GTCTCCTCTGTCACACAGGCTGG - Intronic
1198659720 X:138955080-138955102 ATCTCCTCAATCAGACTGTCTGG + Intronic