ID: 1162520005

View in Genome Browser
Species Human (GRCh38)
Location 19:11174132-11174154
Sequence GTCTCCTCCATCAGCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 2, 1: 2, 2: 8, 3: 28, 4: 269}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162520002_1162520005 -3 Left 1162520002 19:11174112-11174134 CCACAATGAACTGGGAAGGTGTC 0: 1
1: 0
2: 2
3: 11
4: 136
Right 1162520005 19:11174132-11174154 GTCTCCTCCATCAGCCTGGGAGG 0: 2
1: 2
2: 8
3: 28
4: 269
1162519994_1162520005 25 Left 1162519994 19:11174084-11174106 CCATCAGACTAGGAGGGCCACAT 0: 1
1: 0
2: 1
3: 10
4: 100
Right 1162520005 19:11174132-11174154 GTCTCCTCCATCAGCCTGGGAGG 0: 2
1: 2
2: 8
3: 28
4: 269
1162519995_1162520005 8 Left 1162519995 19:11174101-11174123 CCACATCCCCACCACAATGAACT 0: 1
1: 0
2: 3
3: 23
4: 377
Right 1162520005 19:11174132-11174154 GTCTCCTCCATCAGCCTGGGAGG 0: 2
1: 2
2: 8
3: 28
4: 269
1162519999_1162520005 1 Left 1162519999 19:11174108-11174130 CCCACCACAATGAACTGGGAAGG 0: 1
1: 0
2: 3
3: 12
4: 161
Right 1162520005 19:11174132-11174154 GTCTCCTCCATCAGCCTGGGAGG 0: 2
1: 2
2: 8
3: 28
4: 269
1162519998_1162520005 2 Left 1162519998 19:11174107-11174129 CCCCACCACAATGAACTGGGAAG 0: 1
1: 0
2: 4
3: 9
4: 191
Right 1162520005 19:11174132-11174154 GTCTCCTCCATCAGCCTGGGAGG 0: 2
1: 2
2: 8
3: 28
4: 269
1162519993_1162520005 28 Left 1162519993 19:11174081-11174103 CCTCCATCAGACTAGGAGGGCCA 0: 1
1: 1
2: 3
3: 17
4: 137
Right 1162520005 19:11174132-11174154 GTCTCCTCCATCAGCCTGGGAGG 0: 2
1: 2
2: 8
3: 28
4: 269
1162520001_1162520005 0 Left 1162520001 19:11174109-11174131 CCACCACAATGAACTGGGAAGGT 0: 1
1: 0
2: 2
3: 11
4: 101
Right 1162520005 19:11174132-11174154 GTCTCCTCCATCAGCCTGGGAGG 0: 2
1: 2
2: 8
3: 28
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162520005 Original CRISPR GTCTCCTCCATCAGCCTGGG AGG Intronic
900415994 1:2534927-2534949 GTCTCCACCCTCGGCCAGGGAGG + Intergenic
900715326 1:4140346-4140368 GCCTTCTCCATCATCCTGCGTGG - Intergenic
901879650 1:12186205-12186227 GTCTCCCACCTCAGCCTGGCAGG - Intronic
902656125 1:17869545-17869567 GCCTGCCCTATCAGCCTGGGAGG + Intergenic
903672499 1:25045073-25045095 GTGGCCTCCATCAGCCAGGAGGG + Intergenic
903858859 1:26353410-26353432 CTCTCCTAAATCTGCCTGGGGGG - Intronic
903891577 1:26573586-26573608 GCCTCCCCCATCAGACTGGAGGG - Intronic
904300423 1:29550209-29550231 GGCTCCTGCCTCTGCCTGGGTGG + Intergenic
904835095 1:33330586-33330608 GGCTGCTCCAACAGCCTGAGGGG + Intronic
904868556 1:33601996-33602018 ATCTCTTCCATTAGTCTGGGTGG + Intronic
904972182 1:34427665-34427687 GTCTCCACCTCCAGCCTGCGTGG + Intergenic
905189706 1:36224210-36224232 GTCCCCTCCCCCCGCCTGGGTGG - Intergenic
906810205 1:48819106-48819128 TTCTCCTAAATCAGCCTGGGTGG + Intronic
907430657 1:54409380-54409402 GTCTCCCCCACCAGACTGGGAGG + Intronic
907525310 1:55050501-55050523 GCCTCATCCCACAGCCTGGGAGG + Intronic
907785018 1:57603078-57603100 GTCTCCTGCCTCAGCCTACGGGG + Intronic
910876930 1:91886341-91886363 GGCTCATCCATCAGCCGCGGAGG - Intronic
911725780 1:101239489-101239511 GTCATCTCCCTCATCCTGGGTGG + Exonic
911943312 1:104073916-104073938 CCCTCCTCCATCAGCCTGGACGG + Intergenic
912533063 1:110340200-110340222 TTATCCTCCATCAGCCAGTGTGG + Exonic
912952678 1:114131149-114131171 GCCTCCCCCATCAGACTGCGAGG + Intronic
913202052 1:116502853-116502875 TTCTCCAGCATAAGCCTGGGTGG + Intergenic
914883649 1:151567319-151567341 TCCTCCTGCCTCAGCCTGGGAGG + Intronic
915490582 1:156248032-156248054 TCTTCCTCCATCAGCCTGGCTGG - Exonic
915897006 1:159819903-159819925 GTCTCCTTCGTCAGCCAGGTGGG - Intergenic
916547578 1:165820870-165820892 GTCTCCTCCACCACCCTGAAAGG + Intronic
917976843 1:180245266-180245288 TTCTCCTGCTTCAGACTGGGGGG + Intronic
918025158 1:180736845-180736867 GTCAGCTCCCTCAGCCTTGGGGG - Intronic
918235177 1:182573203-182573225 GTCTCTCCAATAAGCCTGGGAGG - Intergenic
919038603 1:192350561-192350583 TTCTCCTCCACCTGCCAGGGAGG - Intronic
919419813 1:197355786-197355808 GTCGGCTCCCTCAGCCTGCGGGG - Intronic
921457966 1:215394801-215394823 GCCACCTCCGTCAGCCTGCGGGG - Intergenic
921796657 1:219352486-219352508 GTCTCCTCCGTCACCCAGGCTGG - Intergenic
1064163574 10:12966895-12966917 GTCTCCTCAACAAACCTGGGAGG + Intronic
1064327797 10:14366840-14366862 TTGTCCTCCAGCAGCCTGGCTGG - Intronic
1065047781 10:21759405-21759427 GTAGCCTCCAGCAGCCTGGCTGG + Exonic
1065684241 10:28268003-28268025 GTGTACTTCACCAGCCTGGGTGG - Intronic
1065757005 10:28939880-28939902 GCGTCCTCCAACTGCCTGGGAGG - Intergenic
1065892685 10:30134631-30134653 CTCTCCAGCAGCAGCCTGGGTGG - Intergenic
1067052670 10:43031590-43031612 GTTTCCTCCATCAAACTGGAGGG + Intergenic
1067344345 10:45427193-45427215 ATCACCTTCACCAGCCTGGGTGG + Intronic
1068173921 10:53431781-53431803 TTCTCAGCCATCAGCCTGAGAGG + Intergenic
1070010987 10:72474229-72474251 TCCTACTCCATCAGCCAGGGTGG - Intronic
1070824111 10:79380949-79380971 AAGTCCTCCAGCAGCCTGGGTGG - Intergenic
1074150935 10:110759277-110759299 AACTCCTCCATCATCCTAGGGGG + Intronic
1075812078 10:125231619-125231641 AGCTCCTCCACCAGGCTGGGTGG + Intergenic
1075844852 10:125536912-125536934 GTCTCCTCCAGCAGCCTGGGAGG - Intergenic
1076121912 10:127943387-127943409 GTCTCTGCCACCAGCCTGGAAGG + Intronic
1076619716 10:131779469-131779491 TGCTCCTCCATTAGCCTGGAGGG + Intergenic
1076905000 10:133357210-133357232 GCCTCCTCCATCTGCCAGTGTGG - Exonic
1077277703 11:1723018-1723040 GTTTCCTGCAACAGCCTGGCTGG - Intergenic
1077286358 11:1767748-1767770 GTCTCCTGAATCGGCCTGGCAGG - Intergenic
1078561010 11:12372517-12372539 GTCTCCTCCAAATCCCTGGGTGG - Intergenic
1079244178 11:18741092-18741114 CTCTCCTCCATCACCGTTGGAGG + Intronic
1079361223 11:19771959-19771981 CTCCCCTCCACCAGCCTTGGAGG - Intronic
1081417347 11:42831838-42831860 GTTTGTTCCATCAGCCTGTGTGG - Intergenic
1081500409 11:43661015-43661037 TTCTCCTCCCTCAGCCTCTGGGG - Intronic
1082078140 11:47990791-47990813 TTCTCCTGCCTCAGCCTGGCTGG + Intronic
1083180386 11:60981493-60981515 CTCTCCTCCTTCAGGCTGAGTGG + Intronic
1083278214 11:61609342-61609364 GTCTCCTGCAGCGGCCTGAGGGG - Intergenic
1084716854 11:70879717-70879739 CGATCCTCCATAAGCCTGGGAGG - Intronic
1084939841 11:72606689-72606711 ATCTCTTCCAGCAGCCTGGGAGG + Intronic
1085054058 11:73393962-73393984 GTTTCCTCCAGGAGCCTGTGAGG + Intronic
1085821945 11:79803195-79803217 GTCTCCACCATCACCCAGGCTGG + Intergenic
1086588601 11:88485205-88485227 GCTTCCTCCAGCTGCCTGGGTGG - Intergenic
1087929447 11:103959840-103959862 GTCTTCTCCTCCAGGCTGGGAGG + Intronic
1091386208 12:96991-97013 TTCTCATCCATCAGACTGGTTGG - Intronic
1096255457 12:50059351-50059373 GTCTCATACCTCAGGCTGGGTGG - Intronic
1097311066 12:58119470-58119492 GTTTCTTTCATCAGCCTGGGTGG - Intergenic
1099486921 12:83240462-83240484 GTCTCCCCCATCACCCAGGCTGG + Intergenic
1100433679 12:94552492-94552514 GTCTCCTCCCTCAGCCTCACAGG + Intergenic
1100840616 12:98608524-98608546 TTCTCCTGCCTCAGCCTGGGAGG - Intergenic
1102959653 12:117084539-117084561 GCCTCCCCCATCAGGCTGTGGGG + Intronic
1103381071 12:120495174-120495196 GTCTCCTCCCTAAGCCAGAGGGG + Intronic
1103946337 12:124528766-124528788 TTCTCCTCCTTCAGGCTAGGAGG - Intronic
1104770135 12:131356352-131356374 TGCTCCTCCACCATCCTGGGTGG - Intergenic
1107789970 13:43991931-43991953 CTCCCATCCATCAGCCTGAGAGG - Intergenic
1108197472 13:48009465-48009487 TTTTTCTCCAGCAGCCTGGGAGG + Intergenic
1108955758 13:56155272-56155294 GTCTCTTGCCTCAGCCTCGGGGG - Intergenic
1109055118 13:57537262-57537284 ATTTTCTCCATCAGACTGGGAGG - Intergenic
1110429956 13:75412310-75412332 GTCTCCTCTATCATCCAGGCTGG + Intronic
1113005191 13:105693990-105694012 GTCTTTTGCATCAGCCAGGGTGG - Intergenic
1114737671 14:25059383-25059405 TTCTCCTGCATCAGACTGTGAGG - Intergenic
1117032038 14:51682901-51682923 ATCACCCCCATCAGCCAGGGTGG + Intronic
1118968757 14:70613510-70613532 GTCTCCACCGTCTGCCTTGGAGG + Intergenic
1119659089 14:76437867-76437889 TTCTCCTCCACCAGCATGGCCGG + Intronic
1119691483 14:76676203-76676225 TTCTCCTGCCTCAGCCTGGCTGG + Intergenic
1121525025 14:94613701-94613723 GTGTCCACCATAAGCCTGGAAGG - Exonic
1121867477 14:97376530-97376552 GTCTCCACCCTTACCCTGGGAGG + Intergenic
1122484578 14:102070180-102070202 GTCTCCTTCCTTAGCCTGGAAGG - Intergenic
1122705420 14:103617796-103617818 TTCTCCTGCCTCAGCCTCGGGGG - Intronic
1123068844 14:105631310-105631332 GCATCCTCCCCCAGCCTGGGAGG - Intergenic
1123874397 15:24608864-24608886 TTCTCCTCCATCACCCTTGGTGG - Intergenic
1128734802 15:70047266-70047288 GTCTCCTCCATAAGCCTGAGAGG + Intergenic
1129238672 15:74239216-74239238 CTATCCTCCAGCAGCCTGGGAGG - Intronic
1130109573 15:80953561-80953583 CTCTCCCTCACCAGCCTGGGAGG + Intronic
1130870772 15:87970215-87970237 GTCACCTCCACCAGCCTGGGCGG + Intronic
1131181255 15:90241515-90241537 GTCGGCTTCAACAGCCTGGGAGG + Exonic
1132496462 16:265659-265681 GTCTCCCCCAGCAGGATGGGTGG + Exonic
1133142659 16:3759267-3759289 GTCTCATTCATCAAACTGGGTGG + Intronic
1133176813 16:4021605-4021627 GGCTCCACCAGCAGCCTGGGAGG + Intronic
1134475417 16:14569180-14569202 GTCTCCTCCATCGCCCAGGCTGG - Intronic
1134810857 16:17166060-17166082 GGCTCCTCCAGCAGGCTGGTGGG + Intronic
1136561152 16:31039945-31039967 TTCTCTCCCAGCAGCCTGGGGGG + Exonic
1136687145 16:32002274-32002296 GTTTCCTCCATCAGACTTGAGGG - Intergenic
1136787758 16:32945825-32945847 GTTTCCTCCATCAGACTTGAGGG - Intergenic
1136882023 16:33907964-33907986 GTTTCCTCCATCAGACTTGAGGG + Intergenic
1137365444 16:47855730-47855752 GTATCCTCCACCACCCTGGTGGG - Intergenic
1137616523 16:49851316-49851338 GTCTGCACCATCAGCCTCAGTGG + Intronic
1137674853 16:50299171-50299193 GAATCCTCCAGCAGGCTGGGTGG - Intronic
1139495266 16:67312299-67312321 TTCACATCCATCAGCCTGGGTGG - Intronic
1142130943 16:88431208-88431230 TTCTCCTCCAGCCGCCTGTGCGG + Exonic
1203089986 16_KI270728v1_random:1207482-1207504 GTTTCCTCCATCAGACTTGAGGG - Intergenic
1142473380 17:175850-175872 ATCTTCTCCAACTGCCTGGGGGG + Intronic
1142762718 17:2051153-2051175 GTCGCCTCCCGCAGCCTGGCCGG + Intergenic
1142870253 17:2815117-2815139 TTCTGCCTCATCAGCCTGGGTGG + Intronic
1143611527 17:8020537-8020559 GTCTTTTCCAGCAGCCTGAGAGG - Intergenic
1143786651 17:9260698-9260720 GTGTCCCCCATGTGCCTGGGTGG + Intronic
1144729455 17:17518203-17518225 GTCTCCTCCCACAGCCAGGAGGG + Intronic
1144782495 17:17815055-17815077 GTCTCCTCCCACAGGCTGGTGGG + Intronic
1145099713 17:20064466-20064488 GTATCCTCACACAGCCTGGGAGG + Intronic
1146594231 17:34155682-34155704 GCCTCCTCCCTCTGACTGGGAGG + Intronic
1147209454 17:38863625-38863647 GTCTCCTCTGTCAGCCAGGCAGG + Intergenic
1147353480 17:39870149-39870171 GTCTCCTCCCTCAGCCTCCCGGG + Intronic
1147542277 17:41370312-41370334 GTTGCCTCCATCTGCCTGGATGG - Intronic
1147605421 17:41771490-41771512 ACCTCCTCCTTCAGACTGGGTGG + Intronic
1148078967 17:44956946-44956968 ATCTTCTCCATCAGACTAGGGGG - Intergenic
1148136211 17:45293529-45293551 GACTCATCCAACAGCCTGGCAGG + Intronic
1148439871 17:47706389-47706411 ATCTCCCCCATCAGACTGGGAGG - Intronic
1148635593 17:49146766-49146788 CTGTCCTCCATCAGACTGGAAGG + Intronic
1148944019 17:51242578-51242600 GTCTCCTCCATCATCCTTATTGG + Intronic
1150174803 17:63041441-63041463 GGCTTCTACAGCAGCCTGGGTGG + Intronic
1150673994 17:67228630-67228652 GTCTCCTCTGTCATCCTGGCTGG - Intronic
1151341912 17:73477096-73477118 GCCTCTTCCACCCGCCTGGGAGG - Intronic
1151404588 17:73878202-73878224 CTCTCCTCTCTCAGCCAGGGAGG + Intergenic
1151429306 17:74051684-74051706 GTCTCTGCCCTCAGCCTGTGGGG - Intergenic
1152226155 17:79093870-79093892 GCCTCCTCCCTCAGGCTGTGGGG - Intronic
1152590550 17:81209387-81209409 GTCTCCTCCGTCAGCAGGGTGGG + Intronic
1152996911 18:416303-416325 GTCACCTCCAGCAGCCAGTGTGG - Intronic
1155285063 18:24279974-24279996 GTCTACTCCATCACCCAGGCTGG + Intronic
1156263175 18:35463306-35463328 GTCACATCCATCAGCCCTGGTGG - Intronic
1157241767 18:46016567-46016589 GTCTCCTCCATTAGACTCTGAGG - Intronic
1157712138 18:49857433-49857455 GTCTCCTTCCTTACCCTGGGTGG - Intronic
1160445079 18:78921451-78921473 GAATCCTCCATCAGACAGGGAGG - Intergenic
1160629272 18:80234024-80234046 CACTCCACCTTCAGCCTGGGAGG - Intronic
1160733757 19:652582-652604 CTCACCTCCCTCAGCCTCGGCGG - Intronic
1160757211 19:764082-764104 GCCTCCTCCCTCAGACTGGATGG - Exonic
1162155649 19:8676652-8676674 GTCTCCACCATCACCCATGGAGG - Intergenic
1162519865 19:11173453-11173475 GAGTCCTTCATCAGCCCGGGAGG + Intronic
1162519916 19:11173711-11173733 GTCTCCTCCATCAGACTGGGAGG + Intronic
1162519943 19:11173879-11173901 GTCTCCTCTATCAGACTGGGAGG + Intronic
1162519961 19:11173965-11173987 GTCTCCTCCATCAGCCTGGGAGG + Intronic
1162519991 19:11174077-11174099 ATCTCCTCCATCAGACTAGGAGG + Intronic
1162520005 19:11174132-11174154 GTCTCCTCCATCAGCCTGGGAGG + Intronic
1162520013 19:11174160-11174182 ATCTCCTCCATCAGACTGGGAGG + Intronic
1162520020 19:11174188-11174210 ATCTCCTCCATCAGACTGGGAGG + Intronic
1162520036 19:11174247-11174269 GTCTCCTCTATCAAACTGGAAGG + Intronic
1163023701 19:14497081-14497103 GTCTCCTCCATCTGACTGTGAGG + Intergenic
1163070209 19:14833801-14833823 CTCACGTCCATCAGCCTGAGCGG + Intronic
1163138889 19:15332832-15332854 GCCTCCTCCATCAGTCTGTGGGG - Intergenic
1163517676 19:17774841-17774863 GTGTTCTCAAACAGCCTGGGAGG - Intronic
1163597835 19:18230825-18230847 GTCTCCACCATCAGCCTTAGGGG + Intronic
1163606048 19:18275975-18275997 GACTCCCCCATCAGACTGGAGGG + Intergenic
1163666438 19:18606106-18606128 GGCTCATCCCTCCGCCTGGGGGG + Intronic
1163756215 19:19107834-19107856 GGCTCCTCCCTGTGCCTGGGAGG + Intronic
1165073610 19:33269124-33269146 GTCTGCACCATGTGCCTGGGAGG - Intergenic
1165329510 19:35133829-35133851 GCCTCCACCCTCAGCCTAGGTGG + Intronic
1165585427 19:36911239-36911261 GTCTACTCCATCACCCAGGCTGG + Intronic
1166112780 19:40633112-40633134 GCCTCCTCCTCCACCCTGGGAGG - Intergenic
1166379709 19:42349569-42349591 GCCTCTTCCCTCTGCCTGGGCGG + Exonic
1166670754 19:44708252-44708274 GCTTCCTCCATCAGGCTGGGGGG + Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
925230116 2:2225667-2225689 TGCTCCTCCATGAGCCGGGGCGG + Intronic
925929164 2:8693729-8693751 CTCTGCTCCCTCATCCTGGGGGG + Intergenic
926270899 2:11365245-11365267 GTTTCCTCCAGCTGCCTGGTTGG - Intergenic
927506306 2:23617185-23617207 GCCTCCTCCTTCAGCCAGGCAGG + Intronic
932463136 2:71896296-71896318 GTCACCTCCATCAGACTGTTAGG + Intergenic
932614546 2:73223574-73223596 GTGTCCACCATCTGACTGGGGGG - Intronic
932701988 2:73998377-73998399 GTGTCACCTATCAGCCTGGGAGG + Intronic
934520660 2:95018221-95018243 GTCGCCTCCTTCTGCCTGGCCGG - Intergenic
934559797 2:95307151-95307173 GGCTCCTCCATCTGGCTGAGGGG - Intronic
934746567 2:96763408-96763430 CTCACTTCCTTCAGCCTGGGAGG - Intronic
938365398 2:130729467-130729489 ATCTCCTCCAGCAGCCTGGGTGG + Exonic
938584633 2:132677852-132677874 TGCTCTTCCATCAGCCTGGAAGG + Intronic
939516663 2:143177313-143177335 TTCTTCTCCATCAGCTTGAGGGG + Intronic
940261787 2:151788274-151788296 AGCTCTCCCATCAGCCTGGGAGG - Intergenic
941508557 2:166376864-166376886 CTTTCCTACAGCAGCCTGGGAGG + Intergenic
944431223 2:199635727-199635749 GGTTCCTCCATCAGCCAGAGTGG + Intergenic
944723252 2:202445254-202445276 GTCTCCCCCATCACCCAGGCTGG + Intronic
945246438 2:207721840-207721862 TTCTCCTGCCTCAGCCTCGGTGG + Intronic
945898182 2:215508324-215508346 TTCTCTTCCAGCAGCCTGGGTGG - Intergenic
946391689 2:219420087-219420109 ATCTCCTCCTGCAGCCTGGGTGG - Exonic
1168975503 20:1962642-1962664 GCCTCCTCCATCAGCTTGACAGG - Intergenic
1169486840 20:6041479-6041501 GTCACCCCCTGCAGCCTGGGCGG + Exonic
1170581302 20:17701535-17701557 GGCTCTTCCATCAGCATGGAAGG + Intronic
1171486891 20:25491704-25491726 GTCACCTCCAGCAGCCTGTGAGG - Intronic
1171806789 20:29688074-29688096 GTCTCCTCCTGCAGCCACGGTGG - Intergenic
1172025528 20:31945754-31945776 GGGTCCTCCATGACCCTGGGGGG + Exonic
1172164455 20:32890475-32890497 GTCTCCTCCTCCAGACTGGAAGG + Intronic
1172755543 20:37281349-37281371 GTCTCCTCCCTGGGCCGGGGTGG + Intergenic
1172851856 20:37972179-37972201 GTCTCCTCCATCAGACTGTGAGG + Intergenic
1173116399 20:40247612-40247634 GGCTCCTGCCTCACCCTGGGCGG + Intergenic
1173155213 20:40602896-40602918 GTCTCCTCCATCAACTATGGGGG + Intergenic
1173570006 20:44069911-44069933 CTCACCTCCACAAGCCTGGGTGG - Intergenic
1174668455 20:52282953-52282975 GCCTTCTCCTCCAGCCTGGGAGG + Intergenic
1175912678 20:62412276-62412298 GTCCCCACCATCATCCTGGAAGG - Intronic
1176103438 20:63374924-63374946 CTCTGCCCCATCAGCCTGGTGGG - Intronic
1177567848 21:22847068-22847090 TTCCCCTCCATGAACCTGGGAGG - Intergenic
1180051369 21:45332976-45332998 GTCTCCTCTTACAGCATGGGTGG - Intergenic
1180793433 22:18589999-18590021 GTCTCCACCATTAGACTGGCAGG + Intergenic
1181228306 22:21405313-21405335 GTCTCCACCATTAGACTGGCAGG - Intergenic
1181250344 22:21529537-21529559 GTCTCCACCATTAGACTGGCAGG + Intergenic
1182313536 22:29426716-29426738 GTCTGCTCTATCACCCTGGCCGG - Intergenic
1182430747 22:30297563-30297585 GTAGCCTCCACCAGCCTGAGGGG + Intronic
1183354451 22:37350841-37350863 CCCACCTCCATCAGCCTCGGAGG + Intergenic
1184403681 22:44287918-44287940 GTCTCCTCCCTCAGCCCCCGTGG - Intronic
1184411223 22:44327608-44327630 GTCTCCTCCACCTCCCTAGGGGG + Intergenic
1184817669 22:46884473-46884495 GGCTCCTCCCACAGCCGGGGAGG + Intronic
1184960545 22:47925341-47925363 GTCTCCTCCCCCATCCTGGATGG - Intergenic
1185046909 22:48533143-48533165 GGCCACTCCATCAGGCTGGGCGG - Intronic
1185110524 22:48897822-48897844 GACTCCACCATCAGCCGGTGGGG - Intergenic
950514605 3:13456205-13456227 GTCTCCTGCCTCAGCCTCCGAGG - Intergenic
952924933 3:38313849-38313871 TTCTCCTCCAGCAGATTGGGAGG + Exonic
953781261 3:45872776-45872798 CCCTCCCCCATCAGCCTGAGAGG - Intronic
956284883 3:67597828-67597850 TTCTCCTCCCTCAGCCTCCGGGG - Intronic
956627893 3:71284529-71284551 GTCTCCTCCATTACCCAGGCTGG - Intronic
958752462 3:98208199-98208221 GTCTTCGTCATCAGCCTGTGGGG - Intergenic
958924625 3:100144521-100144543 GTCTCCAACATCACCCTGGTAGG + Intronic
959699991 3:109289582-109289604 TTCTCCTGCCTCAGCCTGAGTGG - Intergenic
959860722 3:111212020-111212042 ATCTCCTCCAGCACCCTGTGTGG + Intronic
962255172 3:133865570-133865592 GTCTCTGCCATGACCCTGGGAGG + Intronic
962591123 3:136890393-136890415 GCCTGCTCCCTCAGCTTGGGGGG - Intronic
968600850 4:1508624-1508646 GGCTCCCCCATGAGCCTGGGAGG - Intergenic
970866629 4:20766456-20766478 GTCTCCTGCCTCAGCCTGCTGGG - Intronic
971326679 4:25650300-25650322 GTCTCCTCCATCACCCAGGCTGG + Intergenic
976793456 4:88906178-88906200 TTCTCCTGCATCAGCCTCTGGGG - Intronic
977806789 4:101309095-101309117 GTCTGCTCCTTCACCCTGGTTGG - Intronic
978368719 4:108009021-108009043 GATTCCTCCCTCAGCCAGGGTGG + Intronic
984537425 4:180994254-180994276 TTCTCCTGCCTCAGCCTTGGAGG - Intergenic
985070038 4:186158639-186158661 GTCTCCACCCTCAACCTGGGCGG - Intronic
985717091 5:1468800-1468822 GTGTCCACAGTCAGCCTGGGGGG + Intronic
985991071 5:3561809-3561831 GGTTCCTCCATCAGCATGTGGGG - Intergenic
986308629 5:6534113-6534135 GTCTTCTCTGTCAACCTGGGAGG - Intergenic
990729855 5:58796425-58796447 GTCTTCTCCACCACTCTGGGTGG - Intronic
993622179 5:90181290-90181312 ATCTCTTCCATAAGCCTGTGAGG - Intergenic
996779771 5:127172542-127172564 TTATCCTCCATCAGCCAGTGTGG - Intergenic
998216500 5:140241705-140241727 GTCCCTTCCATCTGCCTGGATGG - Intronic
999196237 5:149783509-149783531 GTCTCCCCCATCTGACTGGACGG - Intronic
999196490 5:149784928-149784950 GTCTCCCCCATCTGACTGGATGG + Intronic
1002587061 5:180255690-180255712 ATCACATCCACCAGCCTGGGAGG + Intronic
1004592250 6:17064004-17064026 GTCTCTTCCAAGATCCTGGGAGG - Intergenic
1005494297 6:26375318-26375340 GTCTCCACCCCTAGCCTGGGAGG + Intronic
1006459505 6:34150183-34150205 CTCTCCTCCTTCAGCCTGCCAGG - Intronic
1006791074 6:36701709-36701731 GTCTCCTGCATGAGGCTGTGAGG + Intronic
1007512011 6:42381048-42381070 CTCTCCCCCATCAGACTGGGAGG + Intronic
1008065534 6:47043799-47043821 TTGTCCCCCATCAGCCTGGGTGG + Intergenic
1009844043 6:69113867-69113889 GTCACCTAAGTCAGCCTGGGTGG + Intronic
1010146184 6:72672143-72672165 GTCTACTCTATCACCCTGGCTGG + Intronic
1011771406 6:90677596-90677618 GTGCCCTCCATCACCATGGGAGG - Intergenic
1012169559 6:96002010-96002032 GGCTCCACCTTCAGCCAGGGAGG - Intergenic
1013604909 6:111738747-111738769 GTTTCCTCTTTCAGCCAGGGAGG - Intronic
1015962078 6:138660531-138660553 TTCTCCTGCCTCAGCCTTGGTGG - Intronic
1016845321 6:148563313-148563335 GTCTCATGCAGCTGCCTGGGAGG + Intergenic
1016988063 6:149909897-149909919 GTCTCCTCCACCACCCACGGTGG - Intergenic
1016988529 6:149912900-149912922 GTCTCCTCCACCACCCACGGTGG - Intergenic
1016991902 6:149935859-149935881 GTCTCCTCCACCATCCACGGTGG + Intergenic
1017682798 6:156881129-156881151 GTCTTCTCCTTCTCCCTGGGTGG + Intronic
1017778333 6:157696887-157696909 GTCTGGTGCCTCAGCCTGGGTGG - Intergenic
1018744755 6:166753253-166753275 GTCTCCTTGTTCAGCCTGAGGGG - Intronic
1022441605 7:30437648-30437670 GTCTCCTCCCTCAGGATGTGGGG - Exonic
1023294817 7:38703482-38703504 GGCGCCTCCCTGAGCCTGGGAGG + Intergenic
1023909345 7:44542312-44542334 TTCTCCTGCATGAGGCTGGGTGG - Intergenic
1026438055 7:70417084-70417106 GTCTCCTCCAGCAGAGTGGAGGG - Intronic
1026472134 7:70702711-70702733 CTCACCTCCATCAGCCTGGGAGG + Intronic
1026929390 7:74215466-74215488 GTCACCTCCAGGAGCCAGGGTGG + Intronic
1029513571 7:101012127-101012149 CTCTCCTCCCTCTGTCTGGGTGG + Intronic
1030377538 7:108770923-108770945 GACTCTGTCATCAGCCTGGGGGG + Intergenic
1030594106 7:111515761-111515783 GTATCTTCCATCAACCTGAGCGG + Intronic
1033817638 7:145094244-145094266 GTCACATCCGTCTGCCTGGGTGG + Intergenic
1034810625 7:154128826-154128848 GTCTTCTCCCTGACCCTGGGAGG + Intronic
1035690496 8:1556528-1556550 GTCTCCTGCCTCAGACTTGGTGG + Intronic
1035912632 8:3584483-3584505 GTCTCCACCTTCAGCCTGGATGG + Intronic
1039704041 8:39989282-39989304 GGTCCCTCCATCAGCCTGTGGGG + Intronic
1039767168 8:40640927-40640949 GTCTCCCCCATCAACCAGGCTGG - Intronic
1040106766 8:43546104-43546126 GTCTCCCACATCAGGGTGGGTGG - Intergenic
1044324509 8:90844484-90844506 CTCTCTTCCATCAGCCTGGTGGG - Intronic
1046934141 8:119870191-119870213 GTCTCCTCTATCAGCCAGGCTGG - Intergenic
1049252839 8:141598352-141598374 GGCTGTTCCTTCAGCCTGGGAGG + Intergenic
1049254073 8:141604720-141604742 GTGGCCTCCATCTGCATGGGAGG + Intergenic
1049326935 8:142026432-142026454 GTGTCCCCCAGCGGCCTGGGTGG - Intergenic
1049326950 8:142026479-142026501 GTGTTCCCCAGCAGCCTGGGTGG - Intergenic
1054805927 9:69395840-69395862 GCATCCTACAGCAGCCTGGGGGG - Intergenic
1054887623 9:70215954-70215976 GTCCCCTCTATGTGCCTGGGAGG - Intronic
1058072139 9:100612149-100612171 GTCTCCACCTTCAGCATGGCAGG + Intergenic
1059341084 9:113597944-113597966 ATCTCCTCCCCAAGCCTGGGAGG + Intergenic
1059365921 9:113786318-113786340 GTCTCTTGCATGAGCCAGGGTGG + Intergenic
1060799586 9:126535155-126535177 GGCTCCTTCACCAGCCTGAGTGG - Intergenic
1060941783 9:127546634-127546656 ATGTCCTCCATCAGCCAGCGCGG + Intronic
1061102518 9:128503120-128503142 TCCTCCTGCATCAGCCTGTGGGG + Intergenic
1061268583 9:129523127-129523149 GTCTTCACCATCAGGCTGTGGGG - Intergenic
1061790692 9:133057416-133057438 GCCTCCTCCCCAAGCCTGGGAGG - Intronic
1062027520 9:134347407-134347429 AGCTCCTCCATCTGCCTGGGAGG + Intronic
1062323970 9:136003819-136003841 GTCACCTCCCTTAGCCTGGTGGG + Intergenic
1186858183 X:13645929-13645951 TTCACCTCCAGCAGCCTGGATGG - Intergenic
1188528396 X:31111086-31111108 GTCTCCTCTAGCAGACTGTGAGG + Intronic
1191076738 X:56461429-56461451 GTCTTCTCAATCAGCCTGTTAGG - Intergenic
1192401944 X:70844825-70844847 TTCTCATGCCTCAGCCTGGGAGG - Intronic
1193198231 X:78658195-78658217 GAATCCCCCAGCAGCCTGGGAGG - Exonic
1199368373 X:147015933-147015955 GTCTCTTGCATCAGCATGGATGG + Intergenic