ID: 1162520013

View in Genome Browser
Species Human (GRCh38)
Location 19:11174160-11174182
Sequence ATCTCCTCCATCAGACTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 2, 1: 3, 2: 9, 3: 22, 4: 164}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162519999_1162520013 29 Left 1162519999 19:11174108-11174130 CCCACCACAATGAACTGGGAAGG 0: 1
1: 0
2: 3
3: 12
4: 161
Right 1162520013 19:11174160-11174182 ATCTCCTCCATCAGACTGGGAGG 0: 2
1: 3
2: 9
3: 22
4: 164
1162520007_1162520013 1 Left 1162520007 19:11174136-11174158 CCTCCATCAGCCTGGGAGGGTGG 0: 2
1: 0
2: 6
3: 32
4: 332
Right 1162520013 19:11174160-11174182 ATCTCCTCCATCAGACTGGGAGG 0: 2
1: 3
2: 9
3: 22
4: 164
1162520001_1162520013 28 Left 1162520001 19:11174109-11174131 CCACCACAATGAACTGGGAAGGT 0: 1
1: 0
2: 2
3: 11
4: 101
Right 1162520013 19:11174160-11174182 ATCTCCTCCATCAGACTGGGAGG 0: 2
1: 3
2: 9
3: 22
4: 164
1162520002_1162520013 25 Left 1162520002 19:11174112-11174134 CCACAATGAACTGGGAAGGTGTC 0: 1
1: 0
2: 2
3: 11
4: 136
Right 1162520013 19:11174160-11174182 ATCTCCTCCATCAGACTGGGAGG 0: 2
1: 3
2: 9
3: 22
4: 164
1162520009_1162520013 -2 Left 1162520009 19:11174139-11174161 CCATCAGCCTGGGAGGGTGGCAT 0: 1
1: 0
2: 5
3: 27
4: 260
Right 1162520013 19:11174160-11174182 ATCTCCTCCATCAGACTGGGAGG 0: 2
1: 3
2: 9
3: 22
4: 164
1162519998_1162520013 30 Left 1162519998 19:11174107-11174129 CCCCACCACAATGAACTGGGAAG 0: 1
1: 0
2: 4
3: 9
4: 191
Right 1162520013 19:11174160-11174182 ATCTCCTCCATCAGACTGGGAGG 0: 2
1: 3
2: 9
3: 22
4: 164
1162520010_1162520013 -9 Left 1162520010 19:11174146-11174168 CCTGGGAGGGTGGCATCTCCTCC 0: 1
1: 0
2: 0
3: 30
4: 289
Right 1162520013 19:11174160-11174182 ATCTCCTCCATCAGACTGGGAGG 0: 2
1: 3
2: 9
3: 22
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162520013 Original CRISPR ATCTCCTCCATCAGACTGGG AGG Intronic
901448156 1:9320438-9320460 ATCTCCGCCATTTGATTGGGAGG + Intronic
902777889 1:18686207-18686229 TTCTCCCCCATGAGATTGGGAGG + Intronic
903891577 1:26573586-26573608 GCCTCCCCCATCAGACTGGAGGG - Intronic
904788710 1:33001627-33001649 ATCTCCTCTGCTAGACTGGGAGG + Intergenic
904868556 1:33601996-33602018 ATCTCTTCCATTAGTCTGGGTGG + Intronic
906810205 1:48819106-48819128 TTCTCCTAAATCAGCCTGGGTGG + Intronic
907158530 1:52355352-52355374 TTCTCCTCCCTCAGAGTGTGTGG - Intronic
907430657 1:54409380-54409402 GTCTCCCCCACCAGACTGGGAGG + Intronic
911943312 1:104073916-104073938 CCCTCCTCCATCAGCCTGGACGG + Intergenic
912044863 1:105441567-105441589 ATCTATTCTCTCAGACTGGGAGG + Intergenic
912952678 1:114131149-114131171 GCCTCCCCCATCAGACTGCGAGG + Intronic
915557402 1:156668328-156668350 ATCTCCTCAGCCTGACTGGGTGG - Intergenic
917267976 1:173242129-173242151 ATCTCCCTCTTCAGGCTGGGAGG - Intergenic
917976843 1:180245266-180245288 TTCTCCTGCTTCAGACTGGGGGG + Intronic
920365216 1:205444702-205444724 ATGTCCTTCATCAGAGTGGGCGG + Intronic
922450162 1:225730871-225730893 ATTTCTTCCATCAGACAGGATGG - Intergenic
924562942 1:245172203-245172225 ACCCCCCCCACCAGACTGGGAGG - Intronic
1062964150 10:1594474-1594496 ATCCTTTCCAACAGACTGGGTGG - Intronic
1063597878 10:7453568-7453590 ATCACCACCATAAGACTTGGGGG - Intergenic
1067052670 10:43031590-43031612 GTTTCCTCCATCAAACTGGAGGG + Intergenic
1067344345 10:45427193-45427215 ATCACCTTCACCAGCCTGGGTGG + Intronic
1068235989 10:54232963-54232985 ATCTCCTCCATCACTCAGGCTGG + Intronic
1068428217 10:56895331-56895353 ATCTCCTGCATGGGACTTGGGGG + Intergenic
1070824111 10:79380949-79380971 AAGTCCTCCAGCAGCCTGGGTGG - Intergenic
1074150935 10:110759277-110759299 AACTCCTCCATCATCCTAGGGGG + Intronic
1074880801 10:117656066-117656088 ATCTCCTCCATCAGACCTCAGGG + Intergenic
1075812078 10:125231619-125231641 AGCTCCTCCACCAGGCTGGGTGG + Intergenic
1075844852 10:125536912-125536934 GTCTCCTCCAGCAGCCTGGGAGG - Intergenic
1079969748 11:27021527-27021549 ATCTTCAGCCTCAGACTGGGAGG + Intergenic
1083180386 11:60981493-60981515 CTCTCCTCCTTCAGGCTGAGTGG + Intronic
1084939841 11:72606689-72606711 ATCTCTTCCAGCAGCCTGGGAGG + Intronic
1085521854 11:77143768-77143790 CTCTCCTCCCTCAGACCAGGAGG - Intronic
1085766027 11:79282271-79282293 ATATCCCTCATCAGATTGGGTGG + Intronic
1089324087 11:117645221-117645243 TTCTTATCCATCAAACTGGGAGG - Intronic
1090908753 11:131099722-131099744 ATCTTCTCAAACAGAATGGGAGG + Intergenic
1091386208 12:96991-97013 TTCTCATCCATCAGACTGGTTGG - Intronic
1091597107 12:1885489-1885511 AACTCCTCCATCACAGAGGGAGG + Intronic
1091906678 12:4194943-4194965 TACTCCTCCATGGGACTGGGGGG - Intergenic
1095962365 12:47843803-47843825 ATCTTCTCCATCTGGCAGGGTGG - Exonic
1100587736 12:95995450-95995472 TTCTCCTCCATCAGAGGTGGAGG + Intronic
1100840616 12:98608524-98608546 TTCTCCTGCCTCAGCCTGGGAGG - Intergenic
1103946337 12:124528766-124528788 TTCTCCTCCTTCAGGCTAGGAGG - Intronic
1109055118 13:57537262-57537284 ATTTTCTCCATCAGACTGGGAGG - Intergenic
1111354326 13:87079453-87079475 ATCTCCTGCATCACGGTGGGCGG + Intergenic
1112124770 13:96453016-96453038 ATCTCCTCCATGGGACTTGGAGG - Intronic
1112357563 13:98686720-98686742 ATCTCCTTTATTAGACTGTGAGG + Intronic
1113082269 13:106532806-106532828 ATCTTCATCATCAGAATGGGGGG + Intronic
1113781857 13:112981722-112981744 ACCTCCTCCTTCAGGCCGGGCGG + Intronic
1114737671 14:25059383-25059405 TTCTCCTGCATCAGACTGTGAGG - Intergenic
1116352051 14:43875333-43875355 ATCTCCTACCTCAGATTGTGGGG - Intergenic
1117032038 14:51682901-51682923 ATCACCCCCATCAGCCAGGGTGG + Intronic
1117674037 14:58138139-58138161 ATGTCTTCCATCAGACTTGTGGG + Exonic
1118966462 14:70590908-70590930 ATCTACTACATCAGGCTGGAAGG + Intronic
1120104210 14:80475951-80475973 ATCTCCTCCAGCAGTCTGCACGG + Intergenic
1122093476 14:99354706-99354728 AGCTCCTCCATCAGACAGACAGG + Intergenic
1122593253 14:102870733-102870755 ATCTCCTCCATGGAACTGTGAGG - Intronic
1123874397 15:24608864-24608886 TTCTCCTCCATCACCCTTGGTGG - Intergenic
1128569217 15:68721231-68721253 ATCTCCCCCTTAAGACTGTGAGG - Intronic
1128734802 15:70047266-70047288 GTCTCCTCCATAAGCCTGAGAGG + Intergenic
1129238672 15:74239216-74239238 CTATCCTCCAGCAGCCTGGGAGG - Intronic
1129266994 15:74398644-74398666 ATCCCCGCCATCAGAGTGTGAGG - Intergenic
1130021471 15:80235164-80235186 ATCTGCTCCGCCAGGCTGGGAGG - Intergenic
1130870772 15:87970215-87970237 GTCACCTCCACCAGCCTGGGCGG + Intronic
1133142659 16:3759267-3759289 GTCTCATTCATCAAACTGGGTGG + Intronic
1135266518 16:21031268-21031290 AACTCCTCCATCTGATTGGCTGG + Exonic
1136687145 16:32002274-32002296 GTTTCCTCCATCAGACTTGAGGG - Intergenic
1136787758 16:32945825-32945847 GTTTCCTCCATCAGACTTGAGGG - Intergenic
1136882023 16:33907964-33907986 GTTTCCTCCATCAGACTTGAGGG + Intergenic
1137399370 16:48140882-48140904 AAATCCTCCAGCAGACTGAGAGG - Exonic
1137521942 16:49202057-49202079 ATCTTCCCTATCAGACTGTGAGG + Intergenic
1138545340 16:57715850-57715872 ATCTCATCCATCAGGCTCCGAGG + Intronic
1139484436 16:67247957-67247979 ACCTCTTCCTTCAAACTGGGTGG - Intronic
1139495266 16:67312299-67312321 TTCACATCCATCAGCCTGGGTGG - Intronic
1142027779 16:87823775-87823797 TTCTCCTCCCTGAGACAGGGTGG + Intergenic
1203089986 16_KI270728v1_random:1207482-1207504 GTTTCCTCCATCAGACTTGAGGG - Intergenic
1142473380 17:175850-175872 ATCTTCTCCAACTGCCTGGGGGG + Intronic
1144720397 17:17465379-17465401 ATGTCAGTCATCAGACTGGGTGG + Intergenic
1146594231 17:34155682-34155704 GCCTCCTCCCTCTGACTGGGAGG + Intronic
1146892340 17:36514212-36514234 ACCTCCTCCATCAGACCAGAAGG - Intronic
1147605421 17:41771490-41771512 ACCTCCTCCTTCAGACTGGGTGG + Intronic
1148078967 17:44956946-44956968 ATCTTCTCCATCAGACTAGGGGG - Intergenic
1148439871 17:47706389-47706411 ATCTCCCCCATCAGACTGGGAGG - Intronic
1148635593 17:49146766-49146788 CTGTCCTCCATCAGACTGGAAGG + Intronic
1148691160 17:49527862-49527884 ATCTTTCCCATCAGTCTGGGAGG - Intergenic
1153459783 18:5320596-5320618 ATTTCCCCCATCAGACAGTGAGG + Intergenic
1157241767 18:46016567-46016589 GTCTCCTCCATTAGACTCTGAGG - Intronic
1159200534 18:65178423-65178445 TTTTCCTCCAGCAGACTGGCTGG + Intergenic
1160445079 18:78921451-78921473 GAATCCTCCATCAGACAGGGAGG - Intergenic
1160757211 19:764082-764104 GCCTCCTCCCTCAGACTGGATGG - Exonic
1162519916 19:11173711-11173733 GTCTCCTCCATCAGACTGGGAGG + Intronic
1162519920 19:11173739-11173761 ATCTCCCCCATAAGACCAGGAGG + Intronic
1162519943 19:11173879-11173901 GTCTCCTCTATCAGACTGGGAGG + Intronic
1162519961 19:11173965-11173987 GTCTCCTCCATCAGCCTGGGAGG + Intronic
1162519991 19:11174077-11174099 ATCTCCTCCATCAGACTAGGAGG + Intronic
1162520005 19:11174132-11174154 GTCTCCTCCATCAGCCTGGGAGG + Intronic
1162520013 19:11174160-11174182 ATCTCCTCCATCAGACTGGGAGG + Intronic
1162520020 19:11174188-11174210 ATCTCCTCCATCAGACTGGGAGG + Intronic
1162520036 19:11174247-11174269 GTCTCCTCTATCAAACTGGAAGG + Intronic
1162520059 19:11174371-11174393 ATCTTCCCCATCAGATGGGGAGG + Intronic
1163023701 19:14497081-14497103 GTCTCCTCCATCTGACTGTGAGG + Intergenic
1163038170 19:14583583-14583605 ACCTCCGCCATCAGACTGACAGG - Intronic
1163138889 19:15332832-15332854 GCCTCCTCCATCAGTCTGTGGGG - Intergenic
1163606048 19:18275975-18275997 GACTCCCCCATCAGACTGGAGGG + Intergenic
1163939328 19:20477972-20477994 AATTCCTACAACAGACTGGGAGG + Intergenic
1164379247 19:27718169-27718191 ATCTCCCCCATTAGAATGGCTGG + Intergenic
1166375905 19:42326593-42326615 ATCTCCCCCACCAGACTTGGAGG - Intronic
1166670754 19:44708252-44708274 GCTTCCTCCATCAGGCTGGGGGG + Intronic
1166675562 19:44738726-44738748 ACCTCTGCCATCAGACTTGGAGG - Intergenic
1167027025 19:46927701-46927723 ATCACCTCATTAAGACTGGGAGG - Intronic
1167286145 19:48599778-48599800 CCCTCCTCCCTCAGACTGAGGGG - Intergenic
1167419967 19:49397136-49397158 ACCTCCTTCATCAGGCTTGGGGG + Intronic
1168266233 19:55225226-55225248 AGCTCCTCCCTCAGACTCAGGGG + Intergenic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
929979124 2:46662609-46662631 ATATTCTACAACAGACTGGGAGG + Intergenic
931174278 2:59837225-59837247 ATGGCCTCCAGCAGACTAGGAGG - Intergenic
932463136 2:71896296-71896318 GTCACCTCCATCAGACTGTTAGG + Intergenic
932614546 2:73223574-73223596 GTGTCCACCATCTGACTGGGGGG - Intronic
934709890 2:96508029-96508051 ATCTCCTCCACTGGACTGCGCGG + Intronic
935608609 2:104997041-104997063 TTCTCTTCCATCTGAGTGGGTGG + Intergenic
938365398 2:130729467-130729489 ATCTCCTCCAGCAGCCTGGGTGG + Exonic
940261787 2:151788274-151788296 AGCTCTCCCATCAGCCTGGGAGG - Intergenic
944200155 2:197098220-197098242 ATCTCTACCACTAGACTGGGAGG + Intronic
944904900 2:204252540-204252562 AGCTCCTCCAAGAGACTGGCTGG - Intergenic
945898182 2:215508324-215508346 TTCTCTTCCAGCAGCCTGGGTGG - Intergenic
946208190 2:218126051-218126073 ATCTCCACCTTCAGACTGGTAGG + Exonic
946391689 2:219420087-219420109 ATCTCCTCCTGCAGCCTGGGTGG - Exonic
1168811940 20:710163-710185 ATCTGCGCCAGCAGACCGGGCGG - Intergenic
1170136964 20:13085280-13085302 ATAACCTCCATTAGACTGGATGG + Intronic
1172164455 20:32890475-32890497 GTCTCCTCCTCCAGACTGGAAGG + Intronic
1172851856 20:37972179-37972201 GTCTCCTCCATCAGACTGTGAGG + Intergenic
1180288586 22:10776026-10776048 ATCTAATTCATCAAACTGGGTGG + Intergenic
1180793433 22:18589999-18590021 GTCTCCACCATTAGACTGGCAGG + Intergenic
1181228306 22:21405313-21405335 GTCTCCACCATTAGACTGGCAGG - Intergenic
1181250344 22:21529537-21529559 GTCTCCACCATTAGACTGGCAGG + Intergenic
1181695323 22:24590052-24590074 ATCTCCTCCCTAAGGCTGGCTGG + Intronic
1182527148 22:30927563-30927585 CTCTCTTCCACCAGACTGGCAGG + Intronic
949686253 3:6575036-6575058 ATTTCCTCCTTCAAACTGGAGGG + Intergenic
950005849 3:9690455-9690477 ATCTCTTCAATCACAATGGGAGG - Intronic
950514654 3:13456656-13456678 ATCTTCGCCAACAGACTGGTTGG - Intergenic
952412925 3:33065481-33065503 CTCTCCTCTATCAGAATGGAGGG - Exonic
952924933 3:38313849-38313871 TTCTCCTCCAGCAGATTGGGAGG + Exonic
954109348 3:48425438-48425460 AGCTCCACCAGCAGGCTGGGCGG - Intronic
959860722 3:111212020-111212042 ATCTCCTCCAGCACCCTGTGTGG + Intronic
960434146 3:117604886-117604908 ATCTTCTCCACCAGATTTGGTGG + Intergenic
961136289 3:124514297-124514319 ATCTCTTCCATTAGATGGGGTGG - Intronic
961136303 3:124514361-124514383 ATCTCTTCCATTAGATCGGGTGG - Intronic
961834605 3:129646601-129646623 ATCTCCTGCATAAGACTGTGGGG + Intergenic
967506063 3:190254260-190254282 ATGTCCTAAATCACACTGGGGGG - Intergenic
973877558 4:55235272-55235294 ATGTCCTCCACCTGACTTGGAGG + Intergenic
976812204 4:89109990-89110012 AGCTACTCCAGCAGACTCGGGGG + Intronic
977722740 4:100259618-100259640 ATTTCCTCCATCAGACTGAATGG + Intergenic
981514301 4:145590392-145590414 ATATCCTTCATGAAACTGGGTGG + Intergenic
982822205 4:159955303-159955325 ATCCCCCCCATCAAACTGGCAGG - Intergenic
983726481 4:170934787-170934809 ATCTCCTCCAGCAGAATGCGTGG - Intergenic
984243670 4:177248629-177248651 ATCTACTTCATCAGACTGCACGG + Intronic
984310082 4:178046788-178046810 AGCTGGTCCATCAGACTGCGGGG + Intergenic
986094462 5:4541024-4541046 ACCTCCACCACCAGGCTGGGTGG + Intergenic
992791287 5:80216387-80216409 ATCTCCACAGTCAGACTGTGGGG + Intronic
993622179 5:90181290-90181312 ATCTCTTCCATAAGCCTGTGAGG - Intergenic
994578820 5:101613173-101613195 ATCTCCTTCATATTACTGGGAGG - Intergenic
998087967 5:139342123-139342145 AGCTCATCCCTCAGACTTGGTGG - Intronic
999196237 5:149783509-149783531 GTCTCCCCCATCTGACTGGACGG - Intronic
999196490 5:149784928-149784950 GTCTCCCCCATCTGACTGGATGG + Intronic
999502581 5:152161507-152161529 ATCTCCTCCTTCACAATGAGAGG + Intergenic
999911429 5:156205089-156205111 CCTTCCTCCATCAGAGTGGGAGG + Intronic
1002587061 5:180255690-180255712 ATCACATCCACCAGCCTGGGAGG + Intronic
1003190409 6:3869639-3869661 ATCTCCTCCTGCAGAAAGGGCGG + Intergenic
1004504353 6:16235890-16235912 AGCTGGTCCATCAGAATGGGGGG + Intergenic
1007276274 6:40676454-40676476 CTCTCCCCTCTCAGACTGGGTGG + Intergenic
1007347431 6:41242844-41242866 ATCTCCTCCTTCAGTGTGTGGGG - Intergenic
1007512011 6:42381048-42381070 CTCTCCCCCATCAGACTGGGAGG + Intronic
1008065534 6:47043799-47043821 TTGTCCCCCATCAGCCTGGGTGG + Intergenic
1013918889 6:115375946-115375968 ATATCATCCATCAGACTGCCTGG + Intergenic
1023909345 7:44542312-44542334 TTCTCCTGCATGAGGCTGGGTGG - Intergenic
1026107043 7:67429552-67429574 TTCTGGTGCATCAGACTGGGAGG + Intergenic
1026438055 7:70417084-70417106 GTCTCCTCCAGCAGAGTGGAGGG - Intronic
1026472134 7:70702711-70702733 CTCACCTCCATCAGCCTGGGAGG + Intronic
1029513571 7:101012127-101012149 CTCTCCTCCCTCTGTCTGGGTGG + Intronic
1029536482 7:101160531-101160553 ATCTCCTCCAGCACACTCCGTGG - Exonic
1034615045 7:152408962-152408984 ATCTAATTCATCAAACTGGGTGG + Intronic
1035690496 8:1556528-1556550 GTCTCCTGCCTCAGACTTGGTGG + Intronic
1041103849 8:54422700-54422722 ATCTCTTCTACAAGACTGGGTGG + Intergenic
1044324509 8:90844484-90844506 CTCTCTTCCATCAGCCTGGTGGG - Intronic
1046889356 8:119404256-119404278 ATCTCTGCCATCAGACTGCCTGG - Intergenic
1048016993 8:130506572-130506594 AGCTCCTCCCACAGACTGCGTGG - Intergenic
1050025973 9:1334952-1334974 ATTCCCTACATCACACTGGGGGG + Intergenic
1052354198 9:27487515-27487537 ATCACCTCCATGAGACCTGGGGG + Intronic
1053062113 9:35040199-35040221 ACCTCCTTCTTCAGACTGGTGGG + Intergenic
1055310166 9:74970992-74971014 AACTCCTCAATAAGGCTGGGCGG + Intergenic
1056681264 9:88721143-88721165 CTCTCCTCCCCCAGAGTGGGTGG + Intergenic
1059341084 9:113597944-113597966 ATCTCCTCCCCAAGCCTGGGAGG + Intergenic
1060941783 9:127546634-127546656 ATGTCCTCCATCAGCCAGCGCGG + Intronic
1061714712 9:132511430-132511452 ATCTCCCCCACCAGACTCAGTGG + Intronic
1062027520 9:134347407-134347429 AGCTCCTCCATCTGCCTGGGAGG + Intronic
1188528396 X:31111086-31111108 GTCTCCTCTAGCAGACTGTGAGG + Intronic
1189430624 X:40943733-40943755 ATCACCATCATCAGACTTGGGGG + Intergenic
1195828186 X:109025409-109025431 ATCTTCTGCATCAGTCTCGGTGG + Intergenic
1196490778 X:116263227-116263249 ATCCCCTTGATTAGACTGGGTGG + Intergenic
1196688878 X:118537317-118537339 CTCTCCTTTATCACACTGGGAGG - Intronic
1198659720 X:138955080-138955102 ATCTCCTCAATCAGACTGTCTGG + Intronic