ID: 1162520109

View in Genome Browser
Species Human (GRCh38)
Location 19:11174650-11174672
Sequence GCTGCAGGAGTGGCTGCGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 528}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162520109_1162520112 -10 Left 1162520109 19:11174650-11174672 CCAGGCGCAGCCACTCCTGCAGC 0: 1
1: 0
2: 4
3: 40
4: 528
Right 1162520112 19:11174663-11174685 CTCCTGCAGCACTGTGGTGTAGG 0: 1
1: 0
2: 0
3: 20
4: 257
1162520109_1162520117 17 Left 1162520109 19:11174650-11174672 CCAGGCGCAGCCACTCCTGCAGC 0: 1
1: 0
2: 4
3: 40
4: 528
Right 1162520117 19:11174690-11174712 TTTCTGCATGCGAGTCAGGTGGG 0: 1
1: 0
2: 1
3: 66
4: 1992
1162520109_1162520119 30 Left 1162520109 19:11174650-11174672 CCAGGCGCAGCCACTCCTGCAGC 0: 1
1: 0
2: 4
3: 40
4: 528
Right 1162520119 19:11174703-11174725 GTCAGGTGGGAGAGGATGTGAGG 0: 1
1: 0
2: 6
3: 39
4: 482
1162520109_1162520115 13 Left 1162520109 19:11174650-11174672 CCAGGCGCAGCCACTCCTGCAGC 0: 1
1: 0
2: 4
3: 40
4: 528
Right 1162520115 19:11174686-11174708 CCACTTTCTGCATGCGAGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 77
1162520109_1162520118 22 Left 1162520109 19:11174650-11174672 CCAGGCGCAGCCACTCCTGCAGC 0: 1
1: 0
2: 4
3: 40
4: 528
Right 1162520118 19:11174695-11174717 GCATGCGAGTCAGGTGGGAGAGG 0: 1
1: 0
2: 1
3: 21
4: 204
1162520109_1162520116 16 Left 1162520109 19:11174650-11174672 CCAGGCGCAGCCACTCCTGCAGC 0: 1
1: 0
2: 4
3: 40
4: 528
Right 1162520116 19:11174689-11174711 CTTTCTGCATGCGAGTCAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162520109 Original CRISPR GCTGCAGGAGTGGCTGCGCC TGG (reversed) Exonic
900585659 1:3431204-3431226 GCTGGAGTAGGGGCTGAGCCAGG - Intronic
901060674 1:6470571-6470593 GCGGCAGGAGCGGCAGCGGCTGG - Exonic
902577393 1:17386847-17386869 GCTGCGGCCGTGGCTGCCCCTGG - Intronic
904130709 1:28273408-28273430 GCTGCAGGAGAGCCTGCTGCGGG + Exonic
904304636 1:29580269-29580291 GGTGCAGGACTCTCTGCGCCTGG + Intergenic
904869489 1:33607755-33607777 GCTGAGGGAGTGGCTGTGCCTGG + Intronic
905172095 1:36115378-36115400 GCAGCAGGAGGGGCTGGGCTGGG + Intronic
905180585 1:36163178-36163200 GCTCCAAGAGGGGCTGTGCCTGG - Intronic
905683898 1:39895158-39895180 GCTGCAGAAGTGGTGGAGCCAGG + Intergenic
905804968 1:40869615-40869637 GCTGCTGGAGAGGCTGGGGCAGG + Intergenic
906513352 1:46423996-46424018 GCTGCCGGAGTCACTGGGCCAGG - Intergenic
907225405 1:52941621-52941643 GCTACTGGGGTGGCTGAGCCAGG + Intronic
907822392 1:57983638-57983660 GCTGCAGGAATAGCGGCGCTGGG - Intronic
908647582 1:66295538-66295560 GCTACATGAGAGGCTGAGCCAGG - Intronic
908796586 1:67835922-67835944 GCTGCAGGATTTGCTTTGCCTGG + Intergenic
909024624 1:70468187-70468209 GCTGCAGCAGTGGCAGGGCAGGG - Intergenic
910145720 1:84078067-84078089 GCAGCAGCAGTGGCGGCGGCGGG - Intronic
910241652 1:85093160-85093182 GCTGCAGGGATGGCTGGGCCTGG - Intronic
910441825 1:87260836-87260858 GATGCAGCAGTGGCTGCTGCTGG + Intergenic
911455615 1:98119145-98119167 TCTGCAGGTCTGGCTGTGCCTGG - Intergenic
912477372 1:109947803-109947825 GCTGCAGGAGTGGCAGGCCTTGG - Intergenic
912484336 1:110012978-110013000 GCTGCAGCACTGGCTGAGGCTGG + Exonic
912682514 1:111738522-111738544 GCTGGAGGAGGGGCTCTGCCTGG - Intronic
913251437 1:116914792-116914814 TAGGCAGGAGTGGCTGTGCCTGG - Intronic
915113108 1:153577379-153577401 GGTGAAGGAGTGGCAGAGCCAGG - Intergenic
916456277 1:164973951-164973973 GCCGCAGGAGTGGATGCACCAGG - Intergenic
916683063 1:167121673-167121695 GCTGCAGGGAAGGCAGCGCCTGG - Intronic
916757872 1:167790491-167790513 GCTGCAGGGGTGGGTGTGCAGGG - Exonic
918044775 1:180935310-180935332 GCTGCAGCAGCGCCAGCGCCAGG + Exonic
918064264 1:181089091-181089113 GCTGCTGCGGTGGCGGCGCCGGG - Exonic
918097271 1:181345762-181345784 GCTTCTTGAGTGGCTGAGCCAGG + Intergenic
919113102 1:193244468-193244490 GCTGCTGGAGAGGTTGGGCCAGG + Intronic
919769030 1:201145366-201145388 GTTGCAGGAGGGGCTGCCTCAGG + Intronic
920212088 1:204335608-204335630 GCTCCAGGACTGGCAGTGCCAGG + Intronic
920361449 1:205419574-205419596 GCTGCTGGAGGGGCTGAGGCCGG - Intronic
920920348 1:210292846-210292868 GCCTCAGGAGGGGCAGCGCCCGG + Intergenic
920933684 1:210411641-210411663 GCTGCAGGGGAGGCTGAGGCAGG + Intronic
921891318 1:220356802-220356824 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
923272368 1:232369410-232369432 GCTGCAGGCGAGGCTGGGCATGG + Intergenic
923490240 1:234478278-234478300 GGTGCAGGCGGGGCTGGGCCAGG - Exonic
923662414 1:235969642-235969664 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
924723342 1:246644275-246644297 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1063274673 10:4552542-4552564 GCTTCAGGAGTGTCCCCGCCAGG - Intergenic
1063429626 10:5977429-5977451 GCAGCAGCAGTAGCAGCGCCGGG + Exonic
1063458923 10:6203361-6203383 GTTGCAGGGCGGGCTGCGCCGGG + Intronic
1063864277 10:10347028-10347050 GCAGCATGAATGCCTGCGCCGGG + Intergenic
1064080715 10:12305905-12305927 GCTACAGGAGAGGCTGAGGCTGG + Intergenic
1064764765 10:18659582-18659604 GCAGCAGGTGCCGCTGCGCCGGG - Exonic
1065727622 10:28681101-28681123 GCTGCAGGAAGGGCTTCTCCAGG + Intronic
1066568694 10:36748460-36748482 GCAGCTGCAGTGGGTGCGCCAGG + Intergenic
1068157820 10:53223470-53223492 GCTGCAGGGGAGGCTTGGCCAGG - Intergenic
1069574507 10:69517106-69517128 GCTCAGGGAGTGGCTGTGCCAGG + Intergenic
1069594353 10:69661018-69661040 GCTGAAGGAGTGTCTGGGACAGG + Intergenic
1069805979 10:71125337-71125359 GATGCAGCAGTGGCTGGGCAGGG + Intergenic
1069984630 10:72274786-72274808 GCTGCAGGAGAGCCTGGCCCAGG + Exonic
1070705276 10:78632962-78632984 GCTGGAACAGTGTCTGCGCCAGG - Intergenic
1070895836 10:79982359-79982381 GCCGCGGGAGCGGCTGCGCGGGG - Intronic
1070946183 10:80393741-80393763 GCTACTGGAGAGGCTGAGCCAGG + Intergenic
1072252662 10:93593853-93593875 GCGGCAGGAGGAGCTGTGCCTGG - Exonic
1072757742 10:98031472-98031494 GCGGCAGGAGCGGGTGGGCCAGG - Intergenic
1073514920 10:104067661-104067683 GCTGCAGGTGTGGGGGCGGCAGG + Intronic
1074158776 10:110820322-110820344 TTTGGAGGAGTGGCTGTGCCTGG + Intronic
1074198217 10:111207920-111207942 GTTGCAGGAGTGGCTGCTGTGGG + Intergenic
1074499681 10:114012350-114012372 GCTGCAAGAGAGGCTGAGGCAGG - Intergenic
1075672275 10:124270739-124270761 GCTGCAGGAGAGGATGAGCCAGG - Intergenic
1075712858 10:124540124-124540146 GCTGCATGAACGGCTGGGCCAGG - Intronic
1076301750 10:129433600-129433622 GCTGCAGGACTGGCTGGCTCTGG - Intergenic
1076722007 10:132396938-132396960 GCTGGAGAGGGGGCTGCGCCCGG - Intergenic
1076886438 10:133264940-133264962 GCTGCAGCAGGAGCTGCGCGTGG - Intronic
1077092791 11:787286-787308 GCTGCACGAGGGGCTTCCCCAGG + Exonic
1077497858 11:2895227-2895249 GCTCCAGGGCTGGCTGCCCCAGG + Intronic
1078685026 11:13521483-13521505 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1079242390 11:18729728-18729750 GGTGCAGGAGTGGGGGGGCCCGG + Exonic
1080120148 11:28667703-28667725 TCTGCAGGAGTTCCTGCTCCTGG + Intergenic
1080456868 11:32426912-32426934 GGTGGGGGAGTGGCCGCGCCTGG - Intronic
1082657980 11:55874307-55874329 GCTGCAGACGTTGGTGCGCCGGG - Intergenic
1083233762 11:61339187-61339209 CATGCAGGAGGGGCTGCGGCAGG + Intronic
1083486225 11:62984483-62984505 GCTGGAGGTCTGGCTGCCCCGGG - Exonic
1083635124 11:64116720-64116742 GCTGCTGGAGAAGCTGCACCTGG + Exonic
1083750605 11:64758762-64758784 GGTCCAGGCGTGGCTGGGCCTGG - Intronic
1083803139 11:65058180-65058202 GCTGCAGCAGCAGCTGCACCAGG + Exonic
1084156265 11:67314461-67314483 GCTGCAGGAGGGGCAGGGCCTGG - Intergenic
1084685061 11:70688461-70688483 GCTGCTGGCTTGGCTGGGCCAGG - Intronic
1084957046 11:72697118-72697140 GCTGCTGGAGAGCCTGCGGCAGG - Exonic
1086101996 11:83110514-83110536 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1087884276 11:103459660-103459682 GCTGAAGGAGTGGCCGGGCGCGG + Intronic
1088849255 11:113691498-113691520 GCTGCAGAAGTTGCTGCACCTGG - Intronic
1089209497 11:116790769-116790791 GCTGCAGGAGCAGTTGCGCGTGG - Exonic
1089324691 11:117649187-117649209 GCTGCTGGGGTGGCTGAGGCAGG - Intronic
1089665093 11:120013352-120013374 TCGGCAGGTGTGGCTGGGCCTGG + Intergenic
1090037607 11:123262361-123262383 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1090329745 11:125921775-125921797 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1090381603 11:126331445-126331467 CCTGCAGAAGTACCTGCGCCAGG + Exonic
1090712388 11:129399471-129399493 GCTGCTGGAGAGGCTGAGACAGG - Intronic
1091631084 12:2161457-2161479 GGTGCCGGTGTGGCTGTGCCAGG + Intronic
1091656132 12:2348132-2348154 GCTGCAGGAGTGGGAGCGTGGGG + Intronic
1092355882 12:7794821-7794843 GTTCCAGGAGTGGTTGCTCCAGG - Exonic
1092368487 12:7896866-7896888 GTTCCAGGAGTGGTTGCTCCAGG + Intergenic
1092368715 12:7898629-7898651 GTTCCAGGAGTGGTTGCTCCAGG - Intergenic
1092583377 12:9872826-9872848 GCTGCAGGCGTGGCGGCGGCAGG - Intergenic
1096233566 12:49910828-49910850 GCTGCAGGAATTGCTGGGTCAGG + Intergenic
1096314974 12:50556652-50556674 GCTGCTGGAGAGGCTGAGGCAGG - Intronic
1097052375 12:56231087-56231109 GCTGCAGTAGGGGCTGCTGCTGG + Intronic
1097290470 12:57910236-57910258 GCAGGAGGAGTGGGTGCGACTGG + Intergenic
1100280850 12:93116817-93116839 ACTGCAGCAGTGGCTGCACTTGG - Intergenic
1101836635 12:108300228-108300250 GCTCCAGGAGCAGGTGCGCCAGG + Intronic
1102161048 12:110769219-110769241 GCTGCAGCTGTGGCTACGCTGGG + Intergenic
1102913845 12:116738203-116738225 GCTGCGGGCGTAGCTGTGCCCGG + Intronic
1103036082 12:117657658-117657680 GCTGCAGGGCTGGCTGGGCTTGG - Intronic
1103209551 12:119156596-119156618 GCTCCGGGAGTAGCTGCGGCTGG - Exonic
1103271916 12:119680477-119680499 GCTGCAGGAGCTGCTCTGCCTGG - Exonic
1103602203 12:122061526-122061548 GCTCGAGGAGCGACTGCGCCAGG - Exonic
1103822902 12:123712598-123712620 ACTGCAGGAAGAGCTGCGCCAGG - Exonic
1103961431 12:124611443-124611465 GCTGCAGGTTGGGCTGTGCCTGG + Intergenic
1104556748 12:129807204-129807226 GCTACAGGGGTAGCTGCTCCAGG - Intronic
1104800960 12:131555020-131555042 GCTTCAGGAGTGGGTGCTCTGGG - Intergenic
1104836444 12:131795204-131795226 GCTGCTGGAGGGGCTGTCCCTGG - Intronic
1104892065 12:132144832-132144854 ACTGCAGGAGAGGCGGCGGCAGG - Exonic
1104947150 12:132420901-132420923 GCTGCAGAAGAGGCTGCGTCAGG + Intergenic
1105039242 12:132948865-132948887 CCTGCAGGTGTGGCTGCTGCTGG - Intronic
1105396763 13:20043725-20043747 GCTGCATGAGTGGCAGGGCAGGG + Intronic
1105459421 13:20569459-20569481 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1106163376 13:27219906-27219928 GCTGCCGGAGTGCCTGGGCTAGG + Intergenic
1107468178 13:40667273-40667295 ACTGCAGGAGCCGCGGCGCCGGG - Intergenic
1108855476 13:54787856-54787878 GCTGCTGGAGTGCCTGGGCTAGG - Intergenic
1110626862 13:77662484-77662506 CCTGCACGTGTGCCTGCGCCGGG - Intergenic
1114406429 14:22461224-22461246 GCTGGAGGAGAGTCTGAGCCAGG + Intergenic
1114501728 14:23174700-23174722 GCTGCAGGAGTGGGAGCAGCTGG - Intronic
1114549342 14:23524126-23524148 GATGCAGGGGTGGCTGTGGCAGG + Exonic
1114566361 14:23635911-23635933 GCTGCTGGAGTGCCTGGGCTAGG + Intronic
1114569817 14:23658827-23658849 GCTGGGGGAGTGGCTGCCCATGG + Intergenic
1115962749 14:38854025-38854047 GCTGCAGGGGTGGCTGCCCCAGG + Intergenic
1116608610 14:47036156-47036178 GCTGCTGGGGTGGCTGAGGCAGG + Intronic
1117912025 14:60646230-60646252 GCTGCAGTGGTTGCTGCTCCAGG + Exonic
1117985553 14:61383079-61383101 GGTGTAGGAGTGGCTGTGCTGGG + Intronic
1118030364 14:61812670-61812692 GCGGCAGGAGGGGCTGTGCGCGG + Intergenic
1118288954 14:64503605-64503627 GCGGCAGGAGGGACTGAGCCCGG + Intronic
1119189346 14:72669791-72669813 GCTGCTGGAGTGTCTCCCCCTGG - Intronic
1121031325 14:90660976-90660998 TCGGCAGGAGTGGCTGGGCGAGG + Intronic
1121036161 14:90705422-90705444 GCTCTAGGAGGGGCTGAGCCAGG + Intronic
1121148147 14:91604654-91604676 GTTCCAGGAGTGGTTGCTCCAGG + Intronic
1121751615 14:96362880-96362902 TCTGCAGGAGAAGCTGAGCCTGG - Exonic
1121775146 14:96585337-96585359 GCTGCAGGAGTGGGGGCTGCTGG + Intergenic
1121781245 14:96623870-96623892 GCGCCAGGAGGGGCTTCGCCAGG - Intergenic
1122119183 14:99542775-99542797 GCTGCAGGACCCGCTGGGCCTGG - Intronic
1122307800 14:100776711-100776733 GGTGCAGGAGGGGCTGGGGCAGG - Intergenic
1122427477 14:101620306-101620328 GCAGCAGGAGTGTCTAAGCCAGG - Intergenic
1122619995 14:103050661-103050683 GCTGGAGGACTGCCTGAGCCTGG + Intronic
1122635355 14:103127207-103127229 GCCGCCCGAGCGGCTGCGCCAGG + Exonic
1122743071 14:103882889-103882911 CCTGCAGGAGTGGCTCCACTTGG - Intergenic
1123831596 15:24144999-24145021 GCTGCTGGGGAGGCTGAGCCAGG - Intergenic
1123845795 15:24300804-24300826 CCTGCAGGGGTGGCTGAGGCAGG - Intergenic
1123987665 15:25659367-25659389 GCTGCAGGAGTAGAGGCTCCTGG - Intergenic
1124959231 15:34382460-34382482 GCTGCAGGAGAAGCTGGGCCAGG - Exonic
1124975857 15:34528681-34528703 GCTGCAGGAGAAGCTGGGCCAGG - Exonic
1125032230 15:35084445-35084467 GTTCCAGGAGTGGTTGCTCCAGG + Intergenic
1125610133 15:40964116-40964138 GCCCCATGAGTGGCTGTGCCTGG - Intergenic
1125671726 15:41478287-41478309 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1125721623 15:41847803-41847825 GCTGCTGGAGGCTCTGCGCCAGG + Exonic
1126048007 15:44662554-44662576 GCTGCTGGGGAGGCTGAGCCCGG + Intronic
1128003458 15:64216111-64216133 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1128511507 15:68316453-68316475 TCTGCAGGAGTGGCTGGGCGTGG + Intronic
1128673358 15:69591091-69591113 GCTGCAGGGGTGGCCATGCCTGG + Intergenic
1128990204 15:72253438-72253460 ACTGCAGGAGAGGATGGGCCAGG + Exonic
1129597299 15:76974813-76974835 GATGCTGGAGAGGCTGGGCCAGG - Intergenic
1129799677 15:78404875-78404897 GCTACACGAGTGGCTGAGGCAGG + Intergenic
1130298362 15:82662874-82662896 GCGGCAGGAGCTGCTGCACCGGG - Exonic
1130303860 15:82699857-82699879 GCTGCAGGAATCGCTGCATCAGG + Intronic
1130369674 15:83274271-83274293 GCTACAGGGGAGGCTGAGCCAGG + Intronic
1132111550 15:99105472-99105494 GCTGCGGGAGCTGCAGCGCCTGG + Exonic
1132592559 16:732518-732540 GCTTCAGGAGTGACCGGGCCTGG - Intronic
1132606362 16:795410-795432 GCTGCCCGTGTGGCTGCCCCCGG + Intronic
1132737607 16:1394694-1394716 GGAGCAGGAGGGGCTGGGCCAGG - Intronic
1132751784 16:1460985-1461007 GCTGCCAGAGTGACTGCGCCAGG - Intronic
1132806038 16:1775565-1775587 GCTGCAGGAGTACCAGGGCCTGG - Exonic
1132826880 16:1909575-1909597 TTTGCAGGAGGGGCTGCGTCTGG - Intergenic
1132870706 16:2114581-2114603 GCTGCAGGAGAGGTTGTGCCTGG + Exonic
1132988172 16:2778773-2778795 GCTGCTCGAGAGGCTGAGCCAGG + Intergenic
1132995340 16:2819704-2819726 GCAGGAGGAGAGGCCGCGCCTGG - Intronic
1133271974 16:4614698-4614720 CCTGCAGCAGTTGCTTCGCCTGG + Exonic
1133702489 16:8322034-8322056 GCTGCAGGGGTTGCTGGTCCTGG + Intergenic
1134521825 16:14922323-14922345 GCTGCAGGACAGGTTGTGCCTGG - Intronic
1134527496 16:14955611-14955633 GCTACTGGAGAGGCTGAGCCAGG - Intergenic
1134673560 16:16073661-16073683 GCAGGAGGATTGGCTGAGCCCGG + Intronic
1134709495 16:16320974-16320996 GCTGCAGGACAGGTTGTGCCTGG - Intergenic
1134716708 16:16361003-16361025 GCTGCAGGACAGGTTGTGCCTGG - Intergenic
1134950108 16:18347671-18347693 GCTGCAGGACAGGTTGTGCCTGG + Intergenic
1134958042 16:18391156-18391178 GCTGCAGGACAGGTTGTGCCTGG + Intergenic
1135228557 16:20683227-20683249 GCTGCTGGAGAGGCTGAGACAGG - Intronic
1135423748 16:22322231-22322253 GCCGCAGCAGGGGCTGAGCCGGG + Intronic
1136428341 16:30183719-30183741 GCAGCAGGTGAGGCTGGGCCTGG + Exonic
1136550686 16:30980860-30980882 GCTGCAGGAGGGGCTGGGTGGGG + Intronic
1137796626 16:51225701-51225723 GCCACAGGAGTGGCTGAGCAAGG - Intergenic
1138410294 16:56834018-56834040 GCTGCAGGAGTAGATGCTGCTGG + Intronic
1138440841 16:57034168-57034190 GCTGCAGAAGTGTCAGCTCCAGG + Exonic
1138478377 16:57285024-57285046 TCTTCAAGAGTCGCTGCGCCGGG - Intergenic
1138591202 16:58000596-58000618 GCTGCCGGAGTAGCGGGGCCGGG + Intronic
1139432085 16:66916258-66916280 GCTACAGGTATGGCTGGGCCAGG - Exonic
1140264410 16:73408046-73408068 GCTGCAGGAGTGGATGGGGGTGG + Intergenic
1140718708 16:77750835-77750857 GCTGTAGGAGTGGATGAGCAGGG - Intergenic
1141572359 16:84941635-84941657 GCTGCAGCAGTTGCTGAGCGCGG + Intergenic
1141646573 16:85370971-85370993 GCAGGAGGAGGGCCTGCGCCCGG + Intergenic
1141968122 16:87461009-87461031 ACTGCAGGAGTGTCTGTGACAGG + Intronic
1142019340 16:87771174-87771196 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1142196964 16:88743393-88743415 GGTGCAGGAGTTGCTGCCCCAGG - Intronic
1142210811 16:88807670-88807692 GCTGCAGGTGTGGAGGGGCCGGG - Intronic
1142374120 16:89697993-89698015 GCTGCAGCAGCGGCTGGCCCAGG - Exonic
1142429468 16:90018750-90018772 GCTGCAAGGGTGGCTGGTCCGGG - Intronic
1142474156 17:180035-180057 GCAGCAGGGATGTCTGCGCCTGG - Intronic
1142981979 17:3677609-3677631 CCAGCTGGAGTGGCTGGGCCTGG + Intronic
1143545479 17:7592773-7592795 GCGGCGGGAGCGGCGGCGCCTGG + Exonic
1144444546 17:15314852-15314874 GCTGCTGGAGTGTGTGAGCCTGG - Intronic
1145379006 17:22376854-22376876 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145379484 17:22379224-22379246 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145379963 17:22381594-22381616 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145380921 17:22386316-22386338 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145381401 17:22388691-22388713 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145382134 17:22392465-22392487 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145382609 17:22394830-22394852 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145382889 17:22396193-22396215 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145383462 17:22399016-22399038 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145383976 17:22401484-22401506 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145384414 17:22403686-22403708 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145384733 17:22405148-22405170 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1146896489 17:36545316-36545338 GCTGCAGGAGTCCCGGCCCCAGG - Intronic
1146915068 17:36673118-36673140 CCTGGAGGAGTGGCTGGGGCTGG + Intergenic
1147175634 17:38654565-38654587 GCTGGAGGAGTGGAGGCGGCAGG + Intergenic
1147296978 17:39491836-39491858 GATACAGGAGTGGCTGGGCGCGG + Intronic
1147662764 17:42125789-42125811 GCTGCAGCACTGGCTCCGGCTGG + Exonic
1147935376 17:44007699-44007721 GCTGTGGGAGTGCCTGCGGCGGG + Exonic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1148784880 17:50141119-50141141 GCTGCAGGAGTTGCTGTGCCTGG - Intronic
1148878535 17:50707606-50707628 GCAGCAGGAGAGGCTGCGGGAGG - Exonic
1149849693 17:60027207-60027229 GCAGCAGGGGTGTCTGCGCTGGG + Intergenic
1149860475 17:60119317-60119339 GCAGCAGGGGTGTCTGCGCTGGG - Intergenic
1150038541 17:61832023-61832045 GCTGTTGGAGTTGCTGCTCCAGG - Intronic
1150221216 17:63496903-63496925 GCTGCTGGACTGGCTCCGCACGG + Exonic
1150435009 17:65146968-65146990 GCTGCAGGAGTGACTCCTTCTGG - Intronic
1150764728 17:67993895-67993917 CCTCAAGGAGTGGCTGCGCGCGG + Intergenic
1151371443 17:73648650-73648672 GCTGTAGGTGGGGCTGGGCCAGG + Intergenic
1151425345 17:74027651-74027673 GCTCCAGGAGTGTCTGAGCCAGG - Intergenic
1151556712 17:74850426-74850448 GCTGGAGGAGTGGCTGGGGCGGG - Intronic
1151576139 17:74953464-74953486 TCTGCAGTAGGGGCTGGGCCGGG - Intronic
1151821123 17:76497439-76497461 TCTGTAGGAGTGGCTGTGTCTGG - Intronic
1152225522 17:79090987-79091009 GGGGCAGGTGTGGCGGCGCCAGG - Intronic
1152252798 17:79220504-79220526 GCAGCAGGAGTGACTGCGACAGG - Intronic
1152335456 17:79698005-79698027 GCTCCTGCAGTGGCTGCTCCAGG - Intergenic
1152419408 17:80184028-80184050 GCTGCAGGAGCACCTGGGCCTGG + Exonic
1152737280 17:82003772-82003794 ACAGCAGGAGAGGCTGTGCCAGG - Intronic
1153354369 18:4119201-4119223 GCTGCAGGGGAGGCTGAGGCGGG - Intronic
1153872527 18:9334464-9334486 GCAGCTGGGGTGGGTGCGCCTGG + Intergenic
1154344061 18:13527857-13527879 GCTGCAGGAGTGGCAGCCCGGGG - Intronic
1154492791 18:14934169-14934191 GCTGCTGGGCTGGCTCCGCCAGG + Intergenic
1156118928 18:33820142-33820164 GCTGCCGGAGTGCCTGGGCTAGG - Intergenic
1157674502 18:49559144-49559166 GCTGCAAGAGAGGCTGGGGCTGG + Intergenic
1158841993 18:61397356-61397378 GCTTCAGGAGTGGGTAGGCCAGG - Intronic
1159333156 18:67028680-67028702 GCTTCAGGAGTGGCTGCGATTGG + Intergenic
1160221981 18:76984541-76984563 GCTTGAGGAAGGGCTGCGCCTGG - Intronic
1160551525 18:79696558-79696580 GCTACAGGAGCGGCTGCTGCTGG + Intronic
1160559582 18:79747677-79747699 CCTGCAGGAGGCGCTGCGCATGG - Intronic
1160698579 19:496019-496041 GCTACTGGAGTGGCTGAGGCAGG + Intronic
1160751486 19:736456-736478 GCAGTAGGACTGGCTGCCCCGGG + Intronic
1160908948 19:1466022-1466044 GCCGCAGCAGCGGGTGCGCCCGG - Exonic
1161008144 19:1946722-1946744 GCTGCTGGAGAGGCTGAGGCAGG - Intronic
1161060401 19:2211815-2211837 CCTGCAGGAGCTGCTGGGCCAGG + Exonic
1161206745 19:3045410-3045432 GCAGCAGGATTGGCTGAGGCAGG - Intronic
1161252150 19:3285988-3286010 GCTGCAGGAGGGGCGGCGGCTGG - Exonic
1161283455 19:3457571-3457593 GATGTAGGAGTGGCTGCCACAGG + Intronic
1161723353 19:5915453-5915475 GCTGCAGGACTGGCTAGACCAGG + Exonic
1162104920 19:8364450-8364472 GCTGCAGGAGTCCGTGCGCCAGG - Exonic
1162325445 19:9996441-9996463 GCTGCAGAACTGCCTGAGCCTGG + Exonic
1162520109 19:11174650-11174672 GCTGCAGGAGTGGCTGCGCCTGG - Exonic
1163268938 19:16237933-16237955 GAGGCAGGATTGGCTGAGCCTGG - Intronic
1163416970 19:17192775-17192797 CCTGCAGGAGACGCTGCACCGGG + Exonic
1163554174 19:17983208-17983230 GAGGCAGGAGGGGCTCCGCCAGG + Intronic
1164021477 19:21310567-21310589 TCTGGAGGAGTGGCAGTGCCTGG - Exonic
1164044953 19:21529696-21529718 TCTGGAGGAGTGGCAGTGCCTGG + Exonic
1164296922 19:23919411-23919433 TCTGGAGGAGTGGCAGTGCCTGG + Exonic
1164473475 19:28554876-28554898 GCTGTAGGAGAGGCAGGGCCAGG - Intergenic
1164715229 19:30385916-30385938 TCTGAAGGAGTGGCAGTGCCTGG + Intronic
1166356474 19:42230345-42230367 GCTGTAGGAGGGGCGGGGCCAGG + Exonic
1166832233 19:45645565-45645587 GGGCCAGGATTGGCTGCGCCCGG + Exonic
1166860771 19:45809733-45809755 CCTGCAGGAGTCTCTGCTCCCGG - Intronic
1167569531 19:50278211-50278233 GCTGCAGGAGGTGCAGGGCCGGG + Exonic
1167630371 19:50622576-50622598 GAGGGAGGAGGGGCTGCGCCTGG - Intronic
1167668314 19:50835840-50835862 GCTGCAGGGGTGGCGGCGAAAGG - Intronic
1167709891 19:51104138-51104160 GCAGCAGGAGCGGCTGCGGCCGG + Exonic
1168148961 19:54434897-54434919 ACTGCAGGAGGGGGTGCTCCTGG + Intronic
1168238772 19:55078943-55078965 GATGGAGGAGGGGCTGGGCCTGG + Intronic
1168327886 19:55547174-55547196 GCAGGAGGAGGGGCTGGGCCTGG - Intergenic
1168465241 19:56596317-56596339 TCTGCAGGGGTGGGTGCGTCTGG + Intronic
925237470 2:2292248-2292270 GCTTCAGGAGAGGCTGAGCAGGG - Intronic
925344323 2:3159883-3159905 GCGGTAGGACTGGCTGGGCCTGG + Intergenic
927159313 2:20242720-20242742 GCTGCAAAAGTGGCTGTGCGCGG - Intergenic
927855888 2:26527796-26527818 GGGGCAGGAGGGGCTGGGCCTGG - Intronic
928511835 2:32010304-32010326 GCGGCAGGAGCGGCTCCGCGAGG + Exonic
928793870 2:34992194-34992216 GCTGCTGGAGTGCCTGGGCTAGG + Intergenic
929576591 2:43056276-43056298 GATGCAGGAGCAGCTGAGCCGGG + Intergenic
931858007 2:66323991-66324013 GCAGAAGGAGTGGCTGCCACAGG + Intergenic
932655968 2:73611385-73611407 GCTGCAGGAGTGGCTGCACGAGG - Intergenic
933375703 2:81477525-81477547 GCTGCAGGGGAGGCTGAGGCAGG - Intergenic
934567053 2:95346862-95346884 GCTGCTGGGTTGGCTGGGCCGGG - Intronic
936153904 2:110036098-110036120 GCTGCAGGATTGGCAATGCCCGG + Intergenic
936190781 2:110335317-110335339 GCTGCAGGATTGGCAATGCCCGG - Intergenic
936583461 2:113728101-113728123 GCTGCATGAGAGGCTGAGGCAGG - Intronic
936594160 2:113831882-113831904 GCTGCAGGGGAGGCTGAGGCCGG - Intergenic
937029360 2:118725257-118725279 ACTGCTGGAGAGGCTGGGCCAGG - Intergenic
937195953 2:120156499-120156521 GCTGCAGCAGTGGCAGGGCAGGG - Intronic
939914442 2:148021554-148021576 GCTGGGGAAGTGGCTGCTCCTGG - Intronic
940423912 2:153509368-153509390 GCAGCAGGGGAGGCTCCGCCAGG - Intergenic
940749790 2:157612514-157612536 GCTGCAGCAGTTGCTGCCACTGG - Intronic
942046655 2:172102821-172102843 GGGGCAGGGGTGGCTGGGCCGGG + Exonic
944042445 2:195371034-195371056 GCTGCATGAGTGGCTGAGTGTGG + Intergenic
944688208 2:202136566-202136588 GCTGCCGGAGTGCCTGGGCTAGG - Intronic
946023698 2:216659206-216659228 GCTGCTGGAGTGCCAGCACCCGG + Intronic
946391428 2:219418936-219418958 GCTGCGGGAGCTGCGGCGCCAGG + Exonic
946603847 2:221380194-221380216 GCTGCCTGATTGGCTGTGCCAGG - Intergenic
947531547 2:230911850-230911872 GCTGCAGGTGTGGTTGCACAGGG + Intronic
948354675 2:237368598-237368620 GGTGCAGGAGTGGCTGCGGAGGG + Exonic
948836594 2:240628987-240629009 GCTGCAGGGGTGGCCGAGTCAGG + Intronic
1168762056 20:356045-356067 CCTGGAGGGGTGGCTGGGCCAGG + Intronic
1168840239 20:905462-905484 GCTCCAGCAGTGGCTGGGCCTGG - Intronic
1169250161 20:4054380-4054402 GCAGCAGGAGTGCTTGAGCCTGG + Intergenic
1169321835 20:4639434-4639456 GCTACAGGAGAGGCTGAGGCAGG - Intergenic
1169469175 20:5868885-5868907 GCTGCAGGAGTCACAGGGCCAGG + Intergenic
1170408250 20:16062271-16062293 GCAGCAGAAGTGGCAGCACCTGG - Intergenic
1171422208 20:25024882-25024904 GATGCAGGGGTGGCTGCATCTGG - Intronic
1171524117 20:25796415-25796437 GCTGCAGGCGCGGCGGCGGCTGG + Intronic
1171552710 20:26059468-26059490 GCTGCAGGCGCGGCGGCGGCTGG - Intergenic
1172750125 20:37244948-37244970 GCTGCAGTAGCGCCTGGGCCTGG + Intergenic
1173508077 20:43605015-43605037 GCTGCAGGAAAGGCTGTGCCTGG + Exonic
1174552524 20:51372373-51372395 GCTGCAAGAGTGGCTTCCACAGG - Intergenic
1174713104 20:52728149-52728171 GCTGCTGGAGTGCCTGGGCTAGG - Intergenic
1175726521 20:61322326-61322348 GCTGCGGGAGAGACTGAGCCTGG - Intronic
1175863015 20:62160216-62160238 GCTCCTGGAGTGGCTTCTCCGGG - Intronic
1175940456 20:62535361-62535383 CCTGCAGGAGAGGCTGGCCCTGG + Intergenic
1176078754 20:63261212-63261234 GCTGCAGATGAGGCTGCCCCAGG + Intronic
1176201286 20:63861783-63861805 GCTGCAAGAGGCACTGCGCCTGG - Exonic
1177775521 21:25562152-25562174 GCTGCAGGCGGCGCTGGGCCCGG - Intergenic
1178233924 21:30820456-30820478 GCTGGAGGATTGCCTGAGCCTGG - Intergenic
1178705882 21:34872376-34872398 GCTGGAGGAGTGGCTGCAGGTGG - Intronic
1178839993 21:36130410-36130432 GCGGCAGGAGCGGCTCCGCGAGG - Intergenic
1179539365 21:42074168-42074190 CCTGCAGGAGTCTCTGCTCCGGG + Intronic
1180105828 21:45617469-45617491 GCAGAGGGAGTGGCTGCCCCAGG - Intergenic
1180128613 21:45809633-45809655 GCTGCTGTAGTGGCAGCGGCAGG - Intronic
1180797050 22:18611065-18611087 GCTGCAGCAGCTGCTGCACCGGG - Exonic
1181224674 22:21384206-21384228 GCTGCAGCAGCTGCTGCACCGGG + Exonic
1181253958 22:21550607-21550629 GCTGCAGCAGCTGCTGCACCGGG - Exonic
1181521165 22:23449454-23449476 GCTGCAGGAGCAGCTGCGTGTGG + Intergenic
1181697893 22:24603006-24603028 GCTGCAGGTGTCTCTGAGCCCGG - Intronic
1181948013 22:26533324-26533346 GCTGGAGGATTGGTTGAGCCCGG + Intronic
1182445485 22:30387205-30387227 GCTGCCGCTGTGGCTGGGCCTGG - Exonic
1182741508 22:32571309-32571331 GCAGCGGGAGTGGCTGGCCCTGG + Intronic
1183033946 22:35126656-35126678 CCTGCAGAGGTGGCTGCCCCAGG - Intergenic
1183199488 22:36376071-36376093 GCTACTGGAGTGGCTGAGGCAGG - Intronic
1183405827 22:37630114-37630136 GCTGCAGGAGGGTCTTCCCCAGG - Exonic
1183405831 22:37630129-37630151 CCTGCAGCAGTCGCTGCCCCCGG + Exonic
1183651812 22:39159871-39159893 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1183942068 22:41301613-41301635 GCTGCCGGGGCGGCGGCGCCGGG + Exonic
1184224040 22:43118848-43118870 GCTGCAGGAGTGTCAGAGCGGGG - Intronic
1184549576 22:45197305-45197327 GATGCATGAGTGGCTGAGGCGGG - Intronic
1185305395 22:50112616-50112638 GCTGCTGGGGTGGGTGAGCCAGG + Intronic
1185335738 22:50270205-50270227 GCGGCTGCAGGGGCTGCGCCCGG - Exonic
1185409692 22:50675041-50675063 GCTGCAGAAGTGCCTGCGCCTGG + Intergenic
950007181 3:9698803-9698825 GCTGCAGAGGAGGCTGTGCCAGG - Intronic
950020889 3:9787017-9787039 CCTGCAGGAGGCGCTGCGTCAGG + Exonic
950576776 3:13836901-13836923 GGTGCAGCAGTGGCAGCCCCAGG + Intronic
950880093 3:16316536-16316558 GCTGGAGGAGTGGTGGAGCCAGG + Exonic
951211405 3:19979393-19979415 GCTACAGGAGAGGCTGAGGCAGG - Intronic
951844694 3:27072858-27072880 GCTGCAGTGGTGGATGCGCTTGG - Intergenic
953793589 3:45966633-45966655 GCTGCAAGAGCAGCTGCACCGGG - Exonic
955216374 3:56987728-56987750 GCTGCAGGATTGGCTGTGCACGG - Intronic
956193807 3:66632324-66632346 TCTTCAGGAGTGGCTGGGCGTGG - Intergenic
956304128 3:67805385-67805407 GCTGTAGCAGTGGCCGTGCCTGG + Intergenic
959056655 3:101574189-101574211 GCTGCAGGGGAGGCCGCGGCGGG + Exonic
960936509 3:122907451-122907473 GATGCAGGAGTGGGTGCTCCAGG - Intergenic
961179665 3:124866719-124866741 GCTGCAGGTGTGGCTGGTCAGGG - Intronic
961781126 3:129320526-129320548 GCTGCAGGTGTGTCTGTGTCGGG - Intergenic
962353241 3:134671692-134671714 GCTGCAGGAGTGTCTGCTGCTGG + Intronic
962601269 3:136992403-136992425 GCTGCAGGAGAGGCAGCCACAGG + Intronic
965139868 3:164818620-164818642 GCTGCTGGAGTGCCTGGGCTAGG + Intergenic
965911898 3:173788707-173788729 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
966003582 3:174980386-174980408 GCTGCTGCAGAGGCTGAGCCAGG + Intronic
967827318 3:193887993-193888015 TCTGCAGGAGTGGGTGGGCCTGG - Intergenic
968145143 3:196292262-196292284 GGTGCAGGAGTTGCTGAGGCAGG - Intronic
968473561 4:792510-792532 GCGGCAGGAGGCGCTGCGCCAGG - Exonic
968557535 4:1254315-1254337 GCTGCAGGGGTGGTAGGGCCTGG - Intergenic
968923021 4:3532352-3532374 GCAGCAGCAGTAGCAGCGCCGGG + Exonic
969203321 4:5622847-5622869 GCTGCAGGAGCGTCTGGACCAGG - Exonic
969597709 4:8158427-8158449 CCGGCCGGCGTGGCTGCGCCAGG - Intronic
969631592 4:8341863-8341885 GCTGCAGGCGTGGGAGCGACAGG - Intergenic
970522288 4:16898167-16898189 GCTACAAGAGTTGCTGTGCCTGG + Intronic
970598290 4:17619607-17619629 GCTGGAAGAGTGTCTGGGCCTGG + Intronic
972725822 4:41745952-41745974 GCTGGAGGCCTGGCTGCGGCTGG - Exonic
972784623 4:42315276-42315298 GCTGCAGGAGTGCCCGAGCTAGG - Intergenic
972993619 4:44852343-44852365 GCTGCAGGGGTGGGTGCTCATGG + Intergenic
973632915 4:52836183-52836205 AATGCAGGAGTGGCTTTGCCAGG + Intergenic
973870459 4:55160967-55160989 GCTTCAGGTGTGGCTGCAACCGG + Intergenic
974260514 4:59518903-59518925 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260536 4:59518967-59518989 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260558 4:59519031-59519053 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260580 4:59519095-59519117 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260584 4:59519107-59519129 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260588 4:59519119-59519141 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260601 4:59519157-59519179 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260614 4:59519195-59519217 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260627 4:59519233-59519255 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260631 4:59519245-59519267 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260635 4:59519257-59519279 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260648 4:59519295-59519317 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260661 4:59519333-59519355 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260674 4:59519371-59519393 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260678 4:59519383-59519405 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260682 4:59519395-59519417 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260695 4:59519433-59519455 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260699 4:59519445-59519467 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260703 4:59519457-59519479 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
974260707 4:59519469-59519491 GCTGCAGGAGGGGCTGCAGGAGG - Intergenic
976565991 4:86551714-86551736 GCTACTGGAGAGGCTGCGGCAGG - Intronic
979351219 4:119646435-119646457 GCTCCAAGAGTGGGTGCTCCAGG - Intergenic
979780957 4:124650884-124650906 GCTGCCGGAGTGCCTGGGCTAGG + Intergenic
981000544 4:139825018-139825040 GCTGCAGGAGGGGCTGCCTAGGG - Intronic
981170338 4:141615748-141615770 GCTGCAGGAGTGCCCGGGCTAGG + Intergenic
981913259 4:150007173-150007195 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
982701784 4:158665089-158665111 GCTGCTGGAGTGCCTGGGCTAGG + Intergenic
984973433 4:185209953-185209975 GCAGCAGCAGCGGCGGCGCCGGG + Intronic
985621991 5:960671-960693 TCTGCAGGAGTGGCAGGGCAAGG - Intergenic
985722378 5:1496511-1496533 GCTGCAGAGGAGGCTGCGGCGGG + Intronic
985730939 5:1548433-1548455 CCTGCGGGAGTGGCTGCTGCTGG + Intergenic
987313396 5:16701619-16701641 GCTGCAGGAGCGGCGGGACCAGG - Exonic
987708308 5:21482207-21482229 GCTGCAGGAGCGGAGGTGCCAGG + Intergenic
987767165 5:22247561-22247583 GCTGCAGGAGAGGCTGAGGCAGG + Intronic
988599215 5:32623908-32623930 GCTGCAGGAGTGGCAGGGACTGG + Intergenic
989253517 5:39342657-39342679 GCTACAGGAATGGCTGGGCCTGG - Intronic
990330715 5:54722847-54722869 GCTGCTTGAGTGGCTGAGGCAGG - Intergenic
991120581 5:63008499-63008521 GCTGCTGGAGTGCCTGGGCTAGG + Intergenic
992910726 5:81393925-81393947 GCTGCGGGAGCGGCGGCGGCTGG - Intronic
994486495 5:100390274-100390296 GCTGCAGGAGCCGATGTGCCAGG - Intergenic
994921381 5:106048803-106048825 GCTACAGGAGAGGCTGAGGCAGG - Intergenic
995146126 5:108788258-108788280 GCTGCAGGACAGGCAGCTCCAGG - Intronic
995836921 5:116408501-116408523 GGAGAAGGAGTTGCTGCGCCAGG - Intronic
996236881 5:121141500-121141522 GCTGCTGGGGTGGCTGCTCATGG - Intergenic
996954233 5:129164209-129164231 GCTGCAGCAGTGGCAGGGCAGGG + Intergenic
997175959 5:131778128-131778150 GCTGCAGGACTGCTTGAGCCTGG + Intronic
997319079 5:132963297-132963319 GCTGCGGCAGTGGCGGCGCCGGG + Exonic
997830526 5:137145941-137145963 GCTGGAGAAGAGGCTGAGCCTGG + Intronic
1001143085 5:169161478-169161500 GCTGAAGGAGTGGAGGCGGCAGG - Intronic
1001483971 5:172106575-172106597 CCTGCCGGGGTGCCTGCGCCGGG - Intronic
1002106037 5:176879818-176879840 GCTGCAGCAGTGGCTGGACTGGG + Exonic
1002698239 5:181104357-181104379 GCCTCTGGAGTAGCTGCGCCTGG + Intergenic
1002784643 6:392106-392128 GCCCCAGGAGTGGCTGAGGCGGG + Intronic
1003995784 6:11538123-11538145 GCTGCAGCAGCAGCAGCGCCCGG + Intergenic
1004000721 6:11594502-11594524 TCTGCAGGCGAGGCTGCACCTGG + Intergenic
1006026205 6:31148671-31148693 GCTGCAGGATGGCCTGCTCCTGG + Exonic
1006078263 6:31548246-31548268 GCTGGAGGAGGGCCTGGGCCCGG - Exonic
1006092470 6:31636231-31636253 GCTGAGGGAGGGGCTGGGCCGGG - Exonic
1006341160 6:33447852-33447874 GGTGGAGGAGGAGCTGCGCCGGG + Exonic
1006475309 6:34249089-34249111 GCTACCGGATTGGCTGCGTCCGG - Exonic
1006614682 6:35318354-35318376 GCTGCAGGAGGCGCAGCGGCAGG + Exonic
1006657416 6:35607698-35607720 CCTGCAGCAGCGGCTGTGCCTGG - Intronic
1006897320 6:37479417-37479439 CCTGCAGGTGTGGCTGGACCTGG + Intronic
1009266064 6:61556145-61556167 ACTGCAGGAGTGAATGCGCATGG - Intergenic
1009690932 6:67031198-67031220 GCTGCTGGAGTGCCTGCACTAGG + Intergenic
1010177298 6:73044006-73044028 CAGGCAGGAGTGACTGCGCCAGG - Intronic
1010742529 6:79525803-79525825 GCTGCAGGTGTGGGGGCGGCAGG + Intronic
1011272476 6:85593664-85593686 GCTGAAGCAGCGGCTGCGACTGG - Exonic
1011825732 6:91303347-91303369 GCTGCTGGAGTGCCTGGGCTAGG - Intergenic
1013314398 6:108927209-108927231 GAGGAAGGAGTGGCTGCCCCTGG + Intronic
1013576077 6:111483939-111483961 GCTGCTGCAGTGTCTGCGCCGGG + Intergenic
1015979583 6:138825469-138825491 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1017017776 6:150115847-150115869 GCTGCTGGAGTGCCTGGGCTAGG - Intergenic
1017114387 6:150963204-150963226 GCTGCAGGACAGGCTGGGCATGG - Intronic
1017327188 6:153152745-153152767 GCTGCAGGTGTGGGGGCGGCGGG + Intergenic
1017805503 6:157942315-157942337 GCTGCAGTGGTCTCTGCGCCAGG - Intronic
1017936801 6:159012692-159012714 GCTGCATGAGAGGCTGAGGCAGG + Intergenic
1017944323 6:159081187-159081209 GCTGCTGGGGTGGCTGAGGCAGG + Intergenic
1018033351 6:159861777-159861799 GGTCTAGGAGTGGCTGGGCCAGG - Intergenic
1018091244 6:160348275-160348297 GCAGGAGGAGCGGCTGCGGCCGG + Exonic
1018663715 6:166113983-166114005 GCAGCAGGAGTGACTGGGGCTGG + Intergenic
1018872268 6:167792240-167792262 AGTGAAGGGGTGGCTGCGCCTGG + Intronic
1019310886 7:360047-360069 GCTGCAGGAGGGGCATCCCCAGG + Intergenic
1019319977 7:411126-411148 GGGGCAGGAGAGGCTGCCCCGGG - Intergenic
1019320097 7:411486-411508 GGGGCTGGAGAGGCTGCGCCGGG - Intergenic
1019320134 7:411594-411616 GGGGCAGGAGAGGCTGCGCCGGG - Intergenic
1019320148 7:411630-411652 GGGGCAGGAGAGGCTGCCCCGGG - Intergenic
1019320160 7:411666-411688 GGGGCAGGAGAGGCTGCGCCGGG - Intergenic
1019320217 7:411815-411837 GGGGCAGGAGAGGCTGCCCCGGG - Intergenic
1019320231 7:411851-411873 GGGGCAGGAGAGGCTGCCCCAGG - Intergenic
1019320260 7:411928-411950 GCGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019390805 7:785914-785936 GCTGCTGAAGTGGCTGCGGGAGG - Exonic
1019590173 7:1827024-1827046 GCTGCAGGAGCAGCTGCGTGTGG - Intronic
1019634686 7:2069286-2069308 GCTGCAGGAGGAGCTCCGGCAGG - Exonic
1020418567 7:7972202-7972224 GCAGCAGCAGTGGCAGCGGCAGG - Intronic
1022030552 7:26488168-26488190 GCTGCAGGAGAGGCTGAACTGGG - Intergenic
1023425936 7:40036050-40036072 GCTGCTGGGGTGGCTGAGGCAGG + Intronic
1023721085 7:43095524-43095546 GGTGCAGGAATGGCTGGCCCTGG - Intergenic
1023856083 7:44185259-44185281 GCAGAAGGAGGGGCTGGGCCAGG + Intronic
1024230607 7:47360718-47360740 GCTCCAGGAGTGTCTATGCCTGG + Intronic
1025129123 7:56366669-56366691 GAGGCAGGAGAGGCTGGGCCTGG + Intergenic
1026000399 7:66556438-66556460 GATGCTGGAGGGCCTGCGCCAGG + Intergenic
1026615496 7:71899253-71899275 GCTGCTGGGGAGGCTGCGGCAGG - Intronic
1027656518 7:80936895-80936917 GCTGCTCGAGAGGCTGCGGCAGG - Intergenic
1027774080 7:82443567-82443589 TCTGGAGGGCTGGCTGCGCCCGG + Exonic
1028302342 7:89216193-89216215 GCTGCTGGAGGGGCTGAGACGGG + Intronic
1029539314 7:101173454-101173476 GCTGGTGGAGGGGCTGCGCGTGG - Exonic
1029737472 7:102472756-102472778 GCAGCAGGGGTGGCTGCTTCAGG - Exonic
1032453157 7:132052007-132052029 GCAGCAGGAGTGACTTAGCCTGG + Intergenic
1032898548 7:136280109-136280131 GCTGCAGCAGTGGGTGCCCCAGG - Intergenic
1033214364 7:139483123-139483145 GCAGCAGGAGCTGGTGCGCCGGG + Exonic
1033951285 7:146788098-146788120 GCTGCTGGAGTGCCTGGGCTAGG - Intronic
1034196765 7:149254322-149254344 GCTGCAGGAGGTGCTGCTTCTGG - Exonic
1034957426 7:155343761-155343783 GTTGCAGGAGGGGCTGCCACAGG - Intergenic
1035266261 7:157691790-157691812 GCTGCGGGCCTGACTGCGCCAGG - Intronic
1035319507 7:158019745-158019767 TCTGCAGGCCTGGCTGTGCCTGG + Intronic
1035716043 8:1755647-1755669 CCCGCAGGAGAGGCTGGGCCAGG - Intergenic
1035769156 8:2133054-2133076 GCTGCAGGGGTGGGAGCTCCAGG + Intronic
1035872756 8:3153688-3153710 CCTGCAGGAGGGGCTGGCCCAGG + Intronic
1036236448 8:7043307-7043329 GCTGCAGGTGTGGGTGTGACAGG + Intergenic
1036466557 8:9003114-9003136 GCTGCTGGAGTCGCCGCGGCCGG + Exonic
1036709164 8:11067328-11067350 GCTGCCACAGTGGCTGCTCCAGG - Intronic
1037886972 8:22600396-22600418 GCTGCAGGAGAGACTTCACCTGG + Intronic
1038011406 8:23479499-23479521 CCTCCAGAAGTGGCTGGGCCCGG - Intergenic
1038170727 8:25128958-25128980 GCTGCAGCAGTGGCAGGGCGGGG - Intergenic
1039273255 8:35906564-35906586 GCTGCAGGAGTGGGGGCGGCAGG - Intergenic
1040638797 8:49306565-49306587 GCTGCCGGAGTGCCCGCGCTGGG + Intergenic
1042316800 8:67434709-67434731 GCTGCAGCAGTGGCAGCAGCAGG + Intronic
1042337199 8:67640812-67640834 GCAGCAGCAGTGGCAGCCCCTGG + Intronic
1043542522 8:81280222-81280244 GGTGCAGGAGAGGCGGGGCCAGG + Intergenic
1045484685 8:102621904-102621926 GCTGCAGGAGTGGCAGAAGCTGG - Intergenic
1045501718 8:102748852-102748874 GCTGCAGGAGTGCAGGAGCCAGG + Intergenic
1049205517 8:141361772-141361794 GCTGCAGGTGTGGCGGGGCAGGG + Intronic
1049241014 8:141537354-141537376 GCTGTAGGAGAGGCATCGCCCGG + Intergenic
1049615750 8:143575211-143575233 GCCGCAGTAGTGGCTCCACCTGG + Exonic
1049745890 8:144263157-144263179 GCTGGCTGAGTGGCTGAGCCGGG + Intronic
1049797775 8:144504445-144504467 GCTGGAGCAGGAGCTGCGCCAGG + Exonic
1049802375 8:144523946-144523968 GCTGCGGGAGTGGGTGTGCTGGG - Exonic
1049867370 8:144947514-144947536 GCTGCAGCACAGGCTGCCCCTGG - Intronic
1051968830 9:22863082-22863104 GCTGCCGGAGTGCCTGGGCTAGG - Intergenic
1052994160 9:34541055-34541077 GCTGCAGGAGCTGGTGTGCCAGG - Intergenic
1055093931 9:72390698-72390720 GCTACTGGAGTGGCTGAGGCAGG + Intergenic
1055095883 9:72413914-72413936 GCTGCTGGGGAGGCTGAGCCAGG - Intergenic
1055287245 9:74741776-74741798 GCTGCATGAGAGGCTGAGGCAGG + Intronic
1055699417 9:78926577-78926599 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1056141956 9:83690576-83690598 GCTGCAGCAGGGGCTGGGCGTGG + Intronic
1056560666 9:87726552-87726574 GCTCCAGGCGTGGCAGGGCCGGG - Intronic
1057143908 9:92745820-92745842 GATCCAGAAGTGGCTGGGCCTGG + Intronic
1058446077 9:105056604-105056626 GCTACAGGAGAGGCTGAGGCAGG - Intergenic
1059251958 9:112893909-112893931 GCAGGAGGATTGGCTGAGCCCGG - Intergenic
1059633989 9:116154532-116154554 GCTGCAAGTGTGGCTGCGAGCGG + Exonic
1061009854 9:127948463-127948485 GCTGCAGGGGGCCCTGCGCCTGG - Intronic
1061291100 9:129650760-129650782 GGTACAGGAGTGGCAGTGCCGGG + Intergenic
1061365960 9:130172591-130172613 CCAGCAGGAGCGGCTGGGCCGGG - Exonic
1061610024 9:131739978-131740000 GCGGCGGGAGCGGCTGGGCCCGG - Intronic
1062355588 9:136160529-136160551 ACTGCAGGAGTGGGAGGGCCTGG + Intergenic
1062413939 9:136438735-136438757 GCACCAGGAGCGGCTGCGCGCGG + Exonic
1062483582 9:136763495-136763517 GCTGGAGAAGTGGATGGGCCCGG + Intronic
1062533507 9:137011749-137011771 GCTGCAGGGGTGGGGGCGGCTGG + Exonic
1062625097 9:137438923-137438945 GCTGGAGCTGTGGCTGCTCCTGG - Intronic
1062656396 9:137606172-137606194 GCAGCGGGAGCGCCTGCGCCGGG - Intronic
1062721775 9:138048247-138048269 GCAGCAGGAGTGACAGAGCCAGG + Intronic
1186680995 X:11874260-11874282 GCTACAGGAGGGGCTGTGGCAGG - Intergenic
1187098306 X:16168846-16168868 GTTGCAAGACTGGCTGCCCCAGG + Intronic
1187496207 X:19798176-19798198 GCTGGAGGATTGACTGAGCCTGG - Intronic
1189670913 X:43407895-43407917 GCACCAGGAGTGGTTGCTCCAGG + Intergenic
1190259936 X:48791257-48791279 GCTGCAGCGGTGGCTGTGCTCGG - Exonic
1192433835 X:71130112-71130134 GCTGCATGAGGCGCTGCGCCTGG - Exonic
1193593531 X:83419333-83419355 GCTGCAGCAGTGGCAGGGCAGGG - Intergenic
1193962163 X:87939726-87939748 GCTGCTGGAGTGCCTGGGCTAGG - Intergenic
1195065398 X:101234529-101234551 GAGGCAGGAGGGGCTGAGCCAGG - Intronic
1197078944 X:122388960-122388982 GCTGCTGGAGTGCCTGGGCTGGG - Intergenic
1199419102 X:147622491-147622513 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1200235443 X:154465819-154465841 GATGCGGGGGTGGCTGCACCGGG - Exonic
1200956913 Y:8958519-8958541 GCTACACGAGAGGCTGAGCCAGG + Intergenic