ID: 1162520291

View in Genome Browser
Species Human (GRCh38)
Location 19:11175680-11175702
Sequence GAACACTCACTGGCCAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162520291_1162520295 5 Left 1162520291 19:11175680-11175702 CCAGGCTTGGCCAGTGAGTGTTC 0: 1
1: 0
2: 3
3: 17
4: 190
Right 1162520295 19:11175708-11175730 CCAGCCTCTCCCCATCTCCCTGG 0: 1
1: 1
2: 10
3: 123
4: 809
1162520291_1162520300 18 Left 1162520291 19:11175680-11175702 CCAGGCTTGGCCAGTGAGTGTTC 0: 1
1: 0
2: 3
3: 17
4: 190
Right 1162520300 19:11175721-11175743 ATCTCCCTGGCCTCTCTCCGAGG 0: 1
1: 0
2: 2
3: 16
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162520291 Original CRISPR GAACACTCACTGGCCAAGCC TGG (reversed) Intronic
904298402 1:29538733-29538755 CAAATCTGACTGGCCAAGCCTGG - Intergenic
904376333 1:30084676-30084698 GTACTCTGATTGGCCAAGCCTGG - Intergenic
904421982 1:30399966-30399988 AAAGTCTCACTGGCCAGGCCAGG - Intergenic
904794037 1:33045394-33045416 GACATCCCACTGGCCAAGCCTGG - Intronic
905026957 1:34857218-34857240 GAAAAATCACTGTACAAGCCCGG + Intronic
905993858 1:42363979-42364001 GAACTCTCAATGGCCAAAGCTGG + Intergenic
907783962 1:57593956-57593978 GTCCTCTAACTGGCCAAGCCTGG + Intronic
909523981 1:76601673-76601695 AACCAGTCAGTGGCCAAGCCAGG + Intronic
910754244 1:90669699-90669721 GCACACTCATTTGCCAAGCCTGG + Intergenic
912540719 1:110412840-110412862 GGATAGTCAGTGGCCAAGCCAGG - Intergenic
912557280 1:110525259-110525281 AGACACTAAGTGGCCAAGCCAGG - Intergenic
916679177 1:167088837-167088859 GGAGAATCACTGGCCCAGCCAGG + Intronic
922555241 1:226527675-226527697 GCACCCTCTCTGGACAAGCCTGG + Intergenic
1063005183 10:1963682-1963704 GAAAACACACAGGCCAGGCCGGG - Intergenic
1063671189 10:8101567-8101589 GAACAGACACAGGCCATGCCTGG + Intergenic
1065454984 10:25897928-25897950 GAACTTCCACTGGCCAAGTCTGG + Intergenic
1068811384 10:61259122-61259144 GAACTTTCAGAGGCCAAGCCCGG + Intergenic
1069659770 10:70116076-70116098 GGAGACTCAGTGGCCAGGCCTGG - Intronic
1069931792 10:71887828-71887850 GAACTCCCACTGCCCACGCCAGG - Intergenic
1070176764 10:73977338-73977360 GGACTCCCACTGGCCAAGCCTGG - Intergenic
1070353881 10:75620145-75620167 GAACATTCACAGACCAGGCCTGG + Intronic
1070464028 10:76701001-76701023 AAACACCCATTGGCCAAGTCTGG - Intergenic
1070670288 10:78372863-78372885 CTAGACTCACTGGACAAGCCAGG + Intergenic
1070775154 10:79105337-79105359 CAGCAGTCAGTGGCCAAGCCCGG - Intronic
1076695729 10:132246437-132246459 TGGCACTCACTGGGCAAGCCTGG + Intronic
1076852902 10:133101754-133101776 CCACACTCAGTGGCCAGGCCGGG + Intronic
1078984970 11:16584825-16584847 CTGCAATCACTGGCCAAGCCAGG + Intronic
1079068318 11:17318682-17318704 AAACTCTCACTGGCCAAATCTGG + Intronic
1079068370 11:17319284-17319306 AAACTCTCACTGGCCAAGTCTGG - Intronic
1081271825 11:41094277-41094299 GAGCACCTACTGGCCAAGACGGG + Intronic
1081643295 11:44773124-44773146 TAAAACTCACTGGCCAGGCGCGG + Intronic
1084933529 11:72575113-72575135 GGGGACCCACTGGCCAAGCCTGG + Intergenic
1085445527 11:76598350-76598372 CAACCCTCACTGGGCAAGCCTGG + Intergenic
1091228082 11:133970091-133970113 GAACAGTCACTGGCCAGGGACGG + Intergenic
1092060303 12:5545476-5545498 GAAGCCTCACAAGCCAAGCCTGG + Intronic
1092464894 12:8722032-8722054 GAACACTCATAGGCCAGGCGCGG - Intronic
1093281853 12:17204472-17204494 GAACACTCACTGGGACATCCTGG + Intergenic
1093405434 12:18798599-18798621 GAACACCCTCTGGCAGAGCCAGG + Intergenic
1093492954 12:19725756-19725778 AAACACTCACTGGGCCACCCTGG - Intergenic
1096295793 12:50382984-50383006 GAACTCTGAATGGCCAAGGCTGG + Intronic
1096600479 12:52725139-52725161 GAACAGTTTCTGGCCAGGCCCGG - Intergenic
1097257235 12:57687946-57687968 GAACACACACTGGGCCAACCTGG + Intergenic
1097469294 12:59968166-59968188 GACCAATCACTGGCCAGGCGTGG - Intergenic
1098951633 12:76645627-76645649 GAACACTCACTGGGACACCCTGG + Intergenic
1100508336 12:95243080-95243102 GAAAACTCCATGGCCAGGCCTGG + Intronic
1100587098 12:95990584-95990606 GGGCACTCACTGGCAAAGCAAGG - Intronic
1100607737 12:96165681-96165703 GAACAGTCTCCGGCCAGGCCAGG - Intergenic
1101973723 12:109336736-109336758 GAACTCTGATTGGCCAGGCCTGG + Intergenic
1102217240 12:111170147-111170169 GAACAATAACTGGCCAGGCGTGG + Intronic
1103309138 12:119990088-119990110 GAACACCCTCAGGCCGAGCCTGG + Exonic
1104221088 12:126785784-126785806 GAACCCTCAGTCTCCAAGCCAGG - Intergenic
1108960007 13:56214944-56214966 GAACACTCATAGGTCAAGTCAGG - Intergenic
1112007189 13:95264046-95264068 GAGCTCCCACTGGCCAAACCTGG + Intronic
1115800282 14:36985896-36985918 GAACTCTCACTGACCAAATCTGG - Intronic
1122106464 14:99460633-99460655 CAGCAGTCACTGGCCATGCCTGG - Intronic
1122233233 14:100317678-100317700 AAACACACACGGGCCAAGCCTGG + Intergenic
1123721863 15:23067620-23067642 GGACATTCAACGGCCAAGCCCGG + Intergenic
1128796542 15:70470557-70470579 CAATACTCAATAGCCAAGCCTGG + Intergenic
1129222396 15:74138920-74138942 GAGCACTCACTGGCCCAGCCAGG - Intergenic
1129402860 15:75294389-75294411 GAACCCTCCCTGGCCACTCCTGG - Exonic
1129655548 15:77522571-77522593 GAGCTCCCACTGGCCAAACCTGG + Intergenic
1130640547 15:85669818-85669840 GTATACTCACTGTCCAATCCAGG - Exonic
1130927065 15:88393493-88393515 GTACTGTCACTGGCCAATCCAGG - Intergenic
1132988336 16:2779633-2779655 GGCCACTCGCTGGCCTAGCCTGG + Intergenic
1134048614 16:11120723-11120745 GACCACTCCCCAGCCAAGCCTGG - Exonic
1135037387 16:19089585-19089607 GAGCTCTCATTGGCCAGGCCTGG + Intergenic
1135072450 16:19363969-19363991 AAAGACTGAATGGCCAAGCCTGG + Intergenic
1136092329 16:27929342-27929364 GAACTCTGATTGGCCAAGCCTGG - Intronic
1137567432 16:49542317-49542339 GGACACTCAGTGGCAGAGCCCGG - Intronic
1137568015 16:49545734-49545756 GAACAGACACTAGCCAAGACTGG + Intronic
1138653707 16:58477462-58477484 GAACTCCCAATGGCCAAGCCTGG + Intronic
1141475640 16:84271449-84271471 GAACAGTCTCTGCTCAAGCCAGG + Intergenic
1143489354 17:7275865-7275887 TAACATTCAATGGCCAAGCACGG + Intergenic
1143873132 17:9971962-9971984 GAACACTCCAGGGCCAAGCAGGG + Intronic
1144165687 17:12608177-12608199 GAACACTGATTGGCCAGGCTTGG + Intergenic
1145031984 17:19511192-19511214 GGACACTGCCTGGCCAGGCCTGG + Intronic
1145217019 17:21060473-21060495 GAACACTCACTGGGACACCCTGG - Intergenic
1148447620 17:47747675-47747697 GAACACTCTCAGGCTAAGACAGG + Intergenic
1150529229 17:65959295-65959317 GAACACTCACTGGGACACCCTGG + Intronic
1151521488 17:74633546-74633568 GAACGCTCACAAGCCAAGCGTGG - Intergenic
1152062937 17:78092587-78092609 AAACAGTCACTGGCCAGGCATGG + Intronic
1152928630 17:83099188-83099210 GACCACTCACTGGGCGAGCATGG + Intergenic
1156067607 18:33163320-33163342 CAACACTCAATGACTAAGCCAGG + Intronic
1162520291 19:11175680-11175702 GAACACTCACTGGCCAAGCCTGG - Intronic
1163499997 19:17670611-17670633 AAACACTCACTGGCCAGGTGCGG + Intronic
1164724085 19:30453485-30453507 GAACAGTCACTGACCAATCCCGG - Intronic
1165116376 19:33531383-33531405 GAAAGCTCACTGGCCTGGCCAGG + Intergenic
1166100509 19:40568788-40568810 CAACACACACTGGCCAACTCTGG - Intronic
1166315658 19:41988163-41988185 GAACCCTCCCTGGGCAACCCTGG + Intronic
1168451064 19:56467058-56467080 CAACACTCACTGGGCAAGAAGGG + Intronic
925842942 2:8009443-8009465 GAACCCTCACAGGCCATGCTTGG + Intergenic
927092843 2:19725565-19725587 GAGCCCTCACTGGCCAAGGCAGG - Intergenic
927226235 2:20768002-20768024 GAACACTCACTGGGACACCCTGG + Intronic
927862265 2:26567577-26567599 GAACCCTCCCTTCCCAAGCCTGG - Intronic
931606665 2:64059685-64059707 GAAGTCTCACTGGCCAAGCCAGG - Intergenic
934564683 2:95331768-95331790 GAATACCCACTGGCCAGGGCAGG + Intronic
936293675 2:111248568-111248590 GGAGATTCAGTGGCCAAGCCTGG - Intergenic
936484726 2:112916259-112916281 TGACAGTCACTGGCCCAGCCTGG + Intronic
937023891 2:118681694-118681716 AAACACTCCCTGGCCAGGCGCGG - Intergenic
939816055 2:146898654-146898676 TAAGACTCAATGGCCAAGGCTGG - Intergenic
940181037 2:150933130-150933152 GAAAACTAATTTGCCAAGCCTGG - Intergenic
945185322 2:207134057-207134079 TTACACTCACTGGCCAAGACGGG + Intronic
945548794 2:211192910-211192932 GAACTCCAACTGGCCAAACCTGG + Intergenic
945598312 2:211824038-211824060 GAACACTCCATGCCCAAGCCTGG - Intronic
947060776 2:226162716-226162738 GAATTCTCATTGGCCAAGCCTGG + Intergenic
948281642 2:236751744-236751766 GAACTCAGACTGCCCAAGCCAGG - Intergenic
1170407833 20:16058045-16058067 GAACACTCACTGGCCTTGAGGGG + Intergenic
1170965284 20:21063271-21063293 AAACACTCCCAGGACAAGCCAGG + Intergenic
1171088994 20:22266606-22266628 AAACACTCAAAGGCCAAGCATGG + Intergenic
1172437809 20:34942412-34942434 GTACAGTCACTGGCTAGGCCAGG - Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173871116 20:46342764-46342786 GAGGGCACACTGGCCAAGCCTGG - Intergenic
1174131877 20:48350786-48350808 AAACACTCACCAGCCAGGCCAGG + Intergenic
1174582329 20:51580690-51580712 GCACACTCAATGGCCCAGCCTGG - Intergenic
1175508650 20:59506058-59506080 GAGCTCTCATTGGTCAAGCCAGG + Intergenic
1178917700 21:36717997-36718019 TAACACCCACTTCCCAAGCCTGG - Intronic
1180021189 21:45128448-45128470 GGAGACACACTGGCCAAGCGCGG + Intronic
1182701397 22:32242386-32242408 GAACTCTCACTGGCCAAATGTGG + Intronic
1183536211 22:38402958-38402980 GAACATTCGCTGGCCAGGCTTGG - Intergenic
1183943262 22:41308731-41308753 AACCACTCACAGGCCATGCCGGG - Intronic
949129321 3:482598-482620 AAAAAGTCAATGGCCAAGCCGGG + Intergenic
949642746 3:6057529-6057551 GAACTGTGACTGGCCAGGCCTGG + Intergenic
952076307 3:29701687-29701709 TAACTCTCACTGCCCAAGGCCGG - Intronic
953576198 3:44114831-44114853 GAACTCTCCCTGGCCAAGAAAGG - Intergenic
955272706 3:57517754-57517776 GAAAACTCCCTGGCCCAGCACGG + Intronic
955327788 3:58022703-58022725 ACACACTCACTGGCCAATCTGGG - Intronic
955798111 3:62658827-62658849 GAACTCTCACTGGCCCAACTTGG - Intronic
956424203 3:69116325-69116347 GATCTGTCACAGGCCAAGCCAGG + Intronic
956936347 3:74106275-74106297 TAACACTTAGTGACCAAGCCAGG + Intergenic
960649775 3:119933943-119933965 GAACTCCCAGTGGCCAAACCTGG + Intronic
960938659 3:122919395-122919417 GATCTCTCTCTGGCCAGGCCAGG + Intronic
961604017 3:128080201-128080223 GAGCTCTCACTGGCCAAAGCTGG + Intronic
961644534 3:128385676-128385698 CACCACTCACTGGCTAAGCTTGG + Intronic
962536422 3:136333298-136333320 GAAAACTCACTAGGCAAGCAAGG - Intronic
963022871 3:140888811-140888833 GAGCACTCACTGGCCAAAGATGG + Intergenic
966417126 3:179701121-179701143 GCACACTCACTGACCAGGGCTGG - Exonic
967170985 3:186823426-186823448 GAACAGTGTCTGGCCAAGGCAGG - Intergenic
968241793 3:197095847-197095869 GGACTCTCACTGGCCAAATCAGG - Intronic
971225538 4:24748211-24748233 CACAAGTCACTGGCCAAGCCTGG - Intergenic
972316032 4:37926647-37926669 GAACTCTTACTGTCCAAACCTGG + Intronic
973970919 4:56213052-56213074 GAGCACTGAATGGCCAAGACAGG - Intronic
975616376 4:76251698-76251720 GCACACACACCGCCCAAGCCCGG + Intronic
975671031 4:76780956-76780978 GAGCCCTCACAAGCCAAGCCAGG + Exonic
977830612 4:101587713-101587735 GACTACTCACTGGCCAATACTGG - Intronic
981508887 4:145533268-145533290 GAACATTTATTGTCCAAGCCAGG + Intronic
982158000 4:152540205-152540227 GAACACTCACTGGGACACCCTGG - Intergenic
984342844 4:178481051-178481073 GAGCCCTCCCTGGCCAAACCTGG - Intergenic
985623482 5:969307-969329 GAAAACACAATTGCCAAGCCAGG + Intergenic
986059053 5:4170819-4170841 GAAGACACACAGGCCAAGCAAGG + Intergenic
986707994 5:10467183-10467205 GAGCCCTCACTTGCCAAGTCAGG - Intronic
991724805 5:69525392-69525414 GTACACTCACAGGCCAGGCACGG - Intronic
998630569 5:143893360-143893382 AAACTCTAAGTGGCCAAGCCAGG - Intergenic
1002414605 5:179113202-179113224 GAACACTGTCTGGCAAGGCCGGG + Exonic
1004304553 6:14488076-14488098 GAACACTCACTGGGACACCCTGG + Intergenic
1004318208 6:14610474-14610496 GAACATTTACTGGCCCAGCATGG + Intergenic
1007484639 6:42172563-42172585 GAAAGCTCCCAGGCCAAGCCTGG - Intronic
1010124903 6:72420492-72420514 GAACAGGCACTTGCCAAGACTGG + Intergenic
1016754366 6:147667429-147667451 GAAGACTTAATGGCAAAGCCTGG + Intronic
1020066121 7:5189990-5190012 TAACACTCAATGGCCAGGCACGG - Intergenic
1020080812 7:5284743-5284765 GGACAGTGGCTGGCCAAGCCGGG + Intronic
1020292106 7:6730067-6730089 GGACACACACGGGCCAGGCCCGG - Intergenic
1021667171 7:22995547-22995569 GAACACCCAATGGCCAAAGCTGG + Intronic
1021936682 7:25638410-25638432 GAACACTCACAGGCCTGGGCAGG + Intergenic
1023664795 7:42511934-42511956 GAACACTCAATGGCAAAGTTTGG - Intergenic
1027187128 7:75979371-75979393 GAACACCCACTGGGCAGGCCTGG - Intronic
1028527365 7:91801076-91801098 GAACACTCACTGGGACACCCTGG - Intronic
1031729888 7:125287165-125287187 CAACACTCACTGTCAAAGCTGGG + Intergenic
1031938271 7:127759397-127759419 GAGCTCTCACTGGCCAAATCAGG - Intronic
1032858572 7:135857774-135857796 GAACACTCACTGGGACACCCTGG - Intergenic
1033283778 7:140023873-140023895 GCGCAATCACAGGCCAAGCCTGG + Exonic
1036775019 8:11605609-11605631 GAACAACCACTCACCAAGCCAGG + Intergenic
1037833653 8:22203635-22203657 GAAGAGTCACTTGCCAAGCATGG - Intronic
1038265553 8:26037288-26037310 GGACACTCTCTGTCCAAGGCTGG - Intronic
1038336367 8:26648926-26648948 CACCACTCACTGGCTCAGCCTGG + Intronic
1038678554 8:29645575-29645597 CAGCAGTCACTGGCCAGGCCAGG - Intergenic
1039167864 8:34706427-34706449 GAACTCTGAGTAGCCAAGCCAGG - Intergenic
1039589361 8:38733815-38733837 AAACGCACACTGGCCAAGCATGG + Intronic
1041730050 8:61053736-61053758 GAACCCTAATTGGCCCAGCCTGG - Intergenic
1043443972 8:80301240-80301262 CCACACTCACTGGGCGAGCCAGG + Intergenic
1044481663 8:92697734-92697756 GCACTTTCACTGGCCGAGCCAGG + Intergenic
1044666566 8:94639559-94639581 GAACCCCCACTGGGAAAGCCAGG + Intergenic
1044774908 8:95677948-95677970 GAACACTCACTGGGACACCCTGG - Intergenic
1047326277 8:123839306-123839328 GATCACACAGTGGCCAAGTCAGG + Intergenic
1047969878 8:130075341-130075363 GAGCACTGACTGGTCAGGCCAGG - Intronic
1048005724 8:130417956-130417978 GAACACTCACTGGACTAGCCAGG + Intronic
1049379128 8:142303308-142303330 GAGCAGTCACTGGCCCTGCCTGG + Intronic
1049385546 8:142341276-142341298 GAAGACTGCCTGGCCAGGCCTGG - Intronic
1052796552 9:32928490-32928512 GCCCTCTCACTGGCGAAGCCTGG + Intergenic
1052976523 9:34414753-34414775 GAAGACTCCCTGGGCCAGCCAGG - Intronic
1053378891 9:37632667-37632689 AAACACTGATTGGCCCAGCCTGG + Intronic
1055463407 9:76540496-76540518 GAGCTCTCACTGGCCAAATCTGG - Intergenic
1056706438 9:88956009-88956031 GAACACTCGCTGCTCTAGCCAGG - Intergenic
1056875376 9:90324431-90324453 AAACACTCAATGGCCAGGCACGG - Intergenic
1057211196 9:93202004-93202026 CAACCCTCACCGGCCCAGCCTGG - Intronic
1058292549 9:103260102-103260124 CACCACTCCCTGGACAAGCCTGG + Intergenic
1060125214 9:121037599-121037621 GAACACCCACTGGCCGGGCGTGG - Intronic
1060803060 9:126556873-126556895 GGGGACTCCCTGGCCAAGCCTGG - Intergenic
1061013513 9:127968906-127968928 GAAGACTCACAGACCAATCCTGG + Intronic
1185480112 X:439437-439459 GAACCCTGAGTGGCCCAGCCTGG - Intergenic
1186099283 X:6138002-6138024 CAACAATCACCAGCCAAGCCAGG - Intronic
1186214308 X:7282489-7282511 AAACATTAACTGGCCAAGCATGG - Intronic
1188334726 X:28916637-28916659 GAAAACTCACTCCCCAAGTCAGG - Intronic
1190155524 X:47988722-47988744 GGACTCTCACTGGCCAACTCAGG + Intronic
1192191117 X:68991738-68991760 AAGCACTGTCTGGCCAAGCCAGG - Intergenic
1193540013 X:82759710-82759732 GACCAATCCTTGGCCAAGCCAGG + Intergenic
1194258000 X:91657867-91657889 GAACATTCACTGGCCAAGGTGGG + Intergenic
1197648580 X:129042007-129042029 CAACACTCAGTGCCCCAGCCAGG - Intergenic
1197770767 X:130087756-130087778 GAAAACACACTGGCCAGGCGCGG - Intronic
1198407124 X:136324678-136324700 AAACTCTCACTGACCAACCCTGG - Intronic
1199457795 X:148048639-148048661 GGACACCCACTGGCCAAGTCTGG + Intergenic
1200576765 Y:4897369-4897391 GAACATTCACTGGCCAAGGTGGG + Intergenic