ID: 1162522589

View in Genome Browser
Species Human (GRCh38)
Location 19:11190712-11190734
Sequence CAGCTGTTCTTCTGGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162522589_1162522592 23 Left 1162522589 19:11190712-11190734 CCATGTTTCCAGAAGAACAGCTG 0: 1
1: 0
2: 0
3: 20
4: 249
Right 1162522592 19:11190758-11190780 TTTCACTCTGTTGCCCAGGCTGG 0: 1235
1: 28092
2: 108625
3: 308144
4: 392602
1162522589_1162522591 19 Left 1162522589 19:11190712-11190734 CCATGTTTCCAGAAGAACAGCTG 0: 1
1: 0
2: 0
3: 20
4: 249
Right 1162522591 19:11190754-11190776 ACAGTTTCACTCTGTTGCCCAGG 0: 98
1: 1654
2: 13297
3: 49619
4: 128035

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162522589 Original CRISPR CAGCTGTTCTTCTGGAAACA TGG (reversed) Intronic
900534801 1:3171567-3171589 CAGCTGTGTTTCTGCAAACTCGG - Intronic
901690306 1:10968985-10969007 CAGCTTTTCTCCTGGAAAAGTGG + Intronic
902037417 1:13467818-13467840 CAGTGTTTCTTCTGGAAACAGGG - Intergenic
903127050 1:21255316-21255338 CAGCTGATGCTCTGGAAAGAAGG + Intronic
903789917 1:25885850-25885872 CAGATGTACTTCTGGACTCACGG - Exonic
904527077 1:31141819-31141841 CAGCTGTTCCTCTGGAATTTAGG + Intergenic
906634484 1:47399601-47399623 CAGCTTTGCTTCTGGAAGTAGGG - Intergenic
907886018 1:58592999-58593021 CATCTGATCTTCTGGAGACCAGG - Intergenic
908845236 1:68317806-68317828 CTGCTTTTCTTCTGGGCACATGG - Intergenic
909034918 1:70586128-70586150 CAGCTGTTCTGCTGGAATTCAGG - Intergenic
909211044 1:72824106-72824128 CACATTTTTTTCTGGAAACAAGG + Intergenic
909837796 1:80279121-80279143 CAGCTGTTCTTAAATAAACAGGG - Intergenic
909884838 1:80928283-80928305 GCTCTGTTCTTCTGGAAAAAAGG + Intergenic
912488907 1:110050430-110050452 CAGCTGTCCTTTTGGCACCAGGG + Intronic
914444165 1:147735671-147735693 CAGCTGTACTTGTGGTGACAGGG + Intergenic
914973368 1:152332346-152332368 CAGTGATTCTTCTGGAAATATGG - Intergenic
916486772 1:165266510-165266532 CAACTTTTCCTCTGGAAACCAGG + Intronic
916532291 1:165668686-165668708 CAACTATTGTTCTGGAAGCAAGG - Intronic
917093708 1:171379662-171379684 CAGCTGTTCTGCTGGAATTCAGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
919071879 1:192766064-192766086 CAGCTGCTATTATGGAAGCATGG + Intergenic
920384180 1:205556421-205556443 CAGCTGTTCTTGAGTAAGCATGG - Intergenic
921541447 1:216421377-216421399 CAGCTCTTCTTGGGGAAACGAGG + Intronic
922126442 1:222730104-222730126 CATCTGTTCTTTAGGAAACTTGG + Exonic
924529422 1:244880770-244880792 CAGCTTTTCTTCTGGTAATGGGG + Intergenic
924685720 1:246287911-246287933 CAGCTGTGCTCATGGAAGCAAGG - Intronic
1063109303 10:3020733-3020755 CAGCTGCTCCTCTGGGAACCAGG + Intergenic
1063559284 10:7111522-7111544 CCCCTGTTCTTCTGGAAGGATGG + Intergenic
1065148205 10:22794574-22794596 CAGTTTTTCTTTTGGAAACATGG - Intergenic
1066266575 10:33781835-33781857 CAGCTGTTCTAATGGAATGAGGG + Intergenic
1067823067 10:49547928-49547950 AAGATGTTTTTCTGGAAAAAAGG - Intergenic
1067968080 10:50936633-50936655 CAGCAATTCTTCTGCAGACAAGG - Intergenic
1068348821 10:55817541-55817563 CAGATGTTTTTCTCAAAACAGGG + Intergenic
1069821101 10:71229284-71229306 CAGCTGGTCTGCTGGAAAAGAGG + Intronic
1071223635 10:83499501-83499523 GAGCTGCACTTCTGGCAACATGG + Intergenic
1072630090 10:97139823-97139845 CAGCTGTTCAGCTGGAGCCAAGG - Intronic
1073399314 10:103243870-103243892 CAGCTATTTTTCTGGAGAGATGG - Intergenic
1074826308 10:117217521-117217543 CAGCTGCTCTTTTGGTGACAAGG - Intergenic
1077251333 11:1561979-1562001 CAGCTGCACTTCTGGAGAAAAGG + Intronic
1078389860 11:10927742-10927764 CAGCCCTTGTTCTGTAAACAAGG - Intergenic
1080605232 11:33859936-33859958 CAGCTGCTCTTCTGAAATGAGGG - Intronic
1081599063 11:44479772-44479794 CAGCTGTATACCTGGAAACAAGG + Intergenic
1083602094 11:63955053-63955075 CAGCTGTTTTTATGGATTCATGG + Exonic
1086403202 11:86477905-86477927 CTGTTGTTCTTCTGAGAACATGG + Intronic
1087803922 11:102534939-102534961 AAGCTGTTAATATGGAAACATGG + Intergenic
1088753264 11:112864025-112864047 CAGCATTTCTCCAGGAAACAGGG + Intergenic
1089331312 11:117690865-117690887 CAGCTGCTCTGATGGAAGCAGGG - Intronic
1092459761 12:8676077-8676099 CAGCTTTTCTTTTTGAGACAGGG + Intergenic
1092666157 12:10801266-10801288 CAACTTTGCATCTGGAAACACGG + Intergenic
1092951504 12:13507781-13507803 CAGCTGTTCTCCTGGGGATAAGG - Intergenic
1094292025 12:28862249-28862271 GAGCTGTACTCCAGGAAACAGGG - Intergenic
1094331719 12:29301428-29301450 AAGCTGTTATTCTGGAAAACTGG - Intronic
1097840976 12:64320840-64320862 AATCTGTTCTTCTGGAAAACTGG - Intronic
1098921298 12:76304571-76304593 ATGCTGTTCTTCTGGAAGAAAGG - Intergenic
1099184801 12:79504933-79504955 CAGCTGTACCTCTGAAAACGTGG - Intergenic
1099406926 12:82274988-82275010 CAGCTCTGCTTCTGAAATCATGG + Intronic
1100082970 12:90875618-90875640 AAGCTGTTCTTCTGGCAAAAAGG - Intergenic
1102447299 12:113013377-113013399 CAGCTGTTCTGCTGGAACTCAGG + Intergenic
1103840569 12:123860576-123860598 CAGCTGTTGTTCTGTAGATAAGG + Intronic
1104350031 12:128037162-128037184 CATCTGTTCTAATGTAAACAGGG + Intergenic
1104467281 12:129000672-129000694 CACATTTTATTCTGGAAACATGG - Intergenic
1105934173 13:25083437-25083459 CAGTTGTTCTTCTGTATACTTGG + Intergenic
1106826720 13:33530599-33530621 CTTCTGTTTTTCTGAAAACAAGG + Intergenic
1109231567 13:59764143-59764165 AAGGTGTTCTACTGCAAACAGGG - Intronic
1109945051 13:69421900-69421922 CAAATGTTCATATGGAAACAAGG + Intergenic
1113828119 13:113272817-113272839 CAGCTGTTCTGCTGGAATTGAGG - Intergenic
1113916599 13:113877605-113877627 CAGCCGTTATCCTGGAAACCAGG - Intergenic
1115706152 14:36000243-36000265 CAGATATTCCTCAGGAAACAAGG - Intergenic
1119053939 14:71399409-71399431 CTGCTGTTGTTTTTGAAACAGGG + Intronic
1120690187 14:87583959-87583981 CAGGTAATCTTCTGGAAAGAAGG + Intergenic
1120816751 14:88868421-88868443 CCTCTGTTCTAATGGAAACATGG + Intronic
1121037781 14:90720729-90720751 CAGCTTTTCTTTTAGAAAGATGG - Intronic
1121275812 14:92666902-92666924 CACGTGAGCTTCTGGAAACAGGG + Intronic
1121797683 14:96748732-96748754 AAGATGTTCTTCTGGAAAGAGGG + Intergenic
1121875236 14:97445448-97445470 CATCTGTTTTTCTGGGAATATGG + Intergenic
1202836695 14_GL000009v2_random:82963-82985 CAGCTACTCACCTGGAAACAAGG - Intergenic
1123997330 15:25728023-25728045 CTGCTGTTGTTCTGGAAACCTGG - Intronic
1124621105 15:31274534-31274556 CAGCTGATGTTGAGGAAACATGG + Intergenic
1127144810 15:56013345-56013367 CAGCTGTTCTGCTGGAATTCAGG + Intergenic
1129266018 15:74393543-74393565 TGTCTCTTCTTCTGGAAACAGGG - Intergenic
1129536295 15:76315970-76315992 CAGCTGGTCTTCTGGAGGAATGG + Intergenic
1129655830 15:77525321-77525343 CAGCAGTTCTCCTGGAAGGAGGG + Intergenic
1131066035 15:89435638-89435660 CAGCCGCTCTTCTGGATAAAGGG - Intergenic
1131280068 15:91013910-91013932 CATCTGTTATGCTAGAAACAGGG + Intronic
1131539774 15:93266442-93266464 AAGCTTTCCTCCTGGAAACAGGG - Intergenic
1131875035 15:96796802-96796824 CAGCTCTTCTTCTGAGAAAACGG + Intergenic
1132746779 16:1439506-1439528 CAGCTGTTGGTGTGGAGACAAGG - Intronic
1133182194 16:4065469-4065491 CACCTGCCCTTCTGGCAACATGG - Intronic
1133492704 16:6286087-6286109 CAGCATTTCTCCTGGAAAGAGGG - Intronic
1136279823 16:29201665-29201687 CAGCTGCTCTTCCGGCAACCAGG - Intergenic
1138165810 16:54800708-54800730 AAGCCTTTCTTCTGGAAGCAAGG + Intergenic
1138174092 16:54880478-54880500 CTGCTGGTGTTCTGGAAGCAGGG - Intergenic
1138811183 16:60152629-60152651 TGGCTGTTCTTCTAGAAAGATGG - Intergenic
1140799200 16:78469765-78469787 AAGCTCTTCTTAGGGAAACAGGG - Intronic
1141133127 16:81448386-81448408 CAGATGTGCTCCTGGAAGCACGG - Intronic
1142084216 16:88167775-88167797 CAGCTGCTCTTCCGGCAACCAGG - Intergenic
1143323782 17:6085022-6085044 CTCTGGTTCTTCTGGAAACAGGG - Intronic
1143649036 17:8251629-8251651 CAGCTGTTCTGCTGGAATTCAGG + Intronic
1143662157 17:8332020-8332042 CATTTCTTCTTCTGGGAACATGG + Intergenic
1146267081 17:31459841-31459863 CCTCTGTTGTTCTGGACACAGGG + Intronic
1148536803 17:48445858-48445880 CAGTTTTTCTTCTGGAGACAAGG - Intergenic
1148621756 17:49039839-49039861 AACCTGCTCTTCTTGAAACAAGG - Intronic
1148694041 17:49548515-49548537 AACCTGTTCTTCAGGAAGCAAGG - Intergenic
1150334919 17:64323758-64323780 TATCTGTTCTTCTCGGAACATGG + Exonic
1151102366 17:71570630-71570652 CAGCTGGTGTTCTGGAAAGTAGG - Intergenic
1151178142 17:72305954-72305976 CAGCTGCCCCTCTGGAAACGGGG - Intergenic
1151254902 17:72869098-72869120 CAGAGGTTCTTCTGGGAATAAGG + Intronic
1151338487 17:73455162-73455184 AAGGTGGTCTTCTGGAAGCAGGG + Intronic
1161193247 19:2971384-2971406 CAGCTGTTCTGCTGGAATTCAGG + Intergenic
1161228158 19:3157566-3157588 CAGCTGTCCATATGGAAACACGG + Intronic
1162522589 19:11190712-11190734 CAGCTGTTCTTCTGGAAACATGG - Intronic
1162880652 19:13656402-13656424 CAGCTGTTTTGCTGGAAATCAGG + Intergenic
1164455927 19:28406578-28406600 CAGCTCTTCTTCTCTAAAAATGG + Intergenic
1164780799 19:30890406-30890428 TAGCTTTTCTCCTGGAAACCTGG - Intergenic
1164864279 19:31590952-31590974 CAGCTGTCCTTCAGGAAAGAGGG + Intergenic
1168486127 19:56763614-56763636 GAGCTGTTCTTGTGTAAACGAGG + Intergenic
929390741 2:41465767-41465789 AAGCTGGTCTTCTGGAAGCCAGG - Intergenic
930278869 2:49345798-49345820 CTGTTGTTCTTCTGGAACAACGG + Intergenic
932005246 2:67921134-67921156 CAGCTGTTCTGCTGGAATTCAGG - Intergenic
932720539 2:74135909-74135931 CAACAGTTCTTTTGGGAACAAGG - Intronic
932837116 2:75048178-75048200 CAGCTGCACTTCTGGGAAGAGGG - Exonic
932851262 2:75189306-75189328 CAGCTGAGGTTCTGGAATCAGGG - Intronic
933393974 2:81708277-81708299 CAGCTGGTCATCTGTAAAAAAGG - Intergenic
934151905 2:89155020-89155042 CAGCTGTTAGTCTGGAAAACTGG - Intergenic
935027455 2:99291012-99291034 CGGATGATATTCTGGAAACACGG + Intronic
937750728 2:125473593-125473615 GAGCTGTTCTGCTGGAAGTAAGG - Intergenic
939999942 2:148957148-148957170 CTGAAGTTCTTTTGGAAACAAGG + Intronic
941960097 2:171244920-171244942 CAGCTGTTCTGCTGGAATTCAGG + Intergenic
943939151 2:193968539-193968561 CATCTTTTCTTATGTAAACATGG + Intergenic
944559259 2:200918875-200918897 TACCTGTTTTTCTGGAGACAGGG + Intronic
949006139 2:241649556-241649578 CAGCTGCTCTTCAGGGAACTGGG - Intronic
1170367297 20:15611712-15611734 CATTTGTTCTTGTGGAAATATGG + Intronic
1170513622 20:17105213-17105235 CAGCAGATCTTCAGGAGACAGGG - Intergenic
1170934037 20:20794539-20794561 CAGCTTTTCTTCTAGAAGAATGG + Intergenic
1171128706 20:22628101-22628123 CAGTTGCTTTGCTGGAAACATGG + Intergenic
1172845932 20:37930036-37930058 CAGCCGCTGTTCTGTAAACAAGG - Intronic
1173231724 20:41203873-41203895 GAGCTGTTCTTCTGGATACTTGG + Exonic
1175837031 20:62002495-62002517 CAGTTATTTTTCTAGAAACAGGG + Intronic
1177996867 21:28111210-28111232 CATCTGTTTTTGTGAAAACATGG - Intergenic
1179599285 21:42465268-42465290 CAGCTGTTCTGCTGGAATTCAGG + Intergenic
1179790411 21:43753026-43753048 CAGCTGTTCTTTTGGGCCCATGG - Intronic
1179978182 21:44882593-44882615 CAGCTGTTCTGCTGGAATTCAGG + Intergenic
1182371575 22:29814882-29814904 CAGCTTATATCCTGGAAACATGG - Intronic
1182609296 22:31533150-31533172 CAGTTATTCTTCAGGAAACCTGG - Intronic
1182810686 22:33113844-33113866 CAGCTCCTCTTCTGAAAACTAGG + Intergenic
1182981358 22:34674435-34674457 CTGCTGTTCTTCTAAAAAAATGG - Intergenic
1184204579 22:42993925-42993947 GAGCAGCTCTTGTGGAAACAAGG - Intronic
1185110639 22:48898303-48898325 CTGCCGTTCTTCTGGACACGGGG - Intergenic
952134647 3:30403543-30403565 CAGATTTTCATCAGGAAACAAGG + Intergenic
952822715 3:37498835-37498857 CAGCTGAACTTCCAGAAACAAGG - Intronic
952848148 3:37705904-37705926 CATTTGTTCATCTGGAAAGAAGG + Intronic
953054978 3:39380861-39380883 GAGCTGGTCTGCTGGAAACATGG + Intergenic
953251848 3:41251283-41251305 CAGCTGTTGTTCTGTATATAAGG + Intronic
953420222 3:42748469-42748491 CAGCTGAACTTCAGGAAGCAGGG + Intronic
953585767 3:44199844-44199866 CTGCAGGTCATCTGGAAACAGGG + Intergenic
955113705 3:55975472-55975494 GCCTTGTTCTTCTGGAAACAAGG + Intronic
955745833 3:62139654-62139676 AAGCTTTTCTTGTCGAAACACGG + Intronic
955902075 3:63767247-63767269 CAGCTGTTCCTCAGTATACACGG + Intergenic
955980024 3:64515450-64515472 AAGTGGTTCTTCTGGAAACTGGG - Intergenic
957799665 3:85059888-85059910 CAGCTATTATTCTATAAACAGGG + Intronic
959328859 3:104976387-104976409 AAGCTGTTCTCCTGCATACATGG - Intergenic
960004221 3:112765572-112765594 CTACTCTTCTTCTTGAAACAGGG + Intronic
961965295 3:130894928-130894950 CAGCTTTTATTTTGGTAACATGG + Intronic
962259048 3:133891520-133891542 CAGCTGTTCTTCTCTCATCATGG + Intronic
964418139 3:156471607-156471629 CAGCTGCCCTTCTGGAGCCAAGG + Intronic
964772040 3:160234405-160234427 CAGCTGTACTTCTGGAATTTAGG + Intronic
965679629 3:171236638-171236660 CAACTGTTCTTGGAGAAACAGGG + Intronic
967975493 3:195032087-195032109 CAACTGCTCTTCTGGGAACTTGG + Intergenic
968795123 4:2698213-2698235 CAGCCGTTCTGCTGGAGACCAGG + Intronic
970090714 4:12404523-12404545 CAGCAGTTTTTCTGGAGGCAAGG - Intergenic
971104495 4:23508137-23508159 CAGGTGTTCCCCTGGAACCAAGG + Intergenic
971803880 4:31329102-31329124 CAGATGCTCTTCTGGGAACGAGG - Intergenic
972970454 4:44568541-44568563 CCGTTGTTCTTTTGGAAGCAAGG - Intergenic
973067338 4:45812385-45812407 CAGCTTTTCATTTGGAAACTTGG + Intergenic
976337790 4:83910894-83910916 CAGCTGTTCTTGTGCATACAGGG + Intergenic
983243761 4:165263694-165263716 CAGCTATTCTTCTTGAACCCTGG - Intronic
983951891 4:173652447-173652469 CTGATGTTCTCCTGTAAACAAGG + Intergenic
986944173 5:12994847-12994869 CAGCTGTTGTTCTGGTTACTGGG - Intergenic
988102495 5:26699533-26699555 GAGCTGCTCTTCTGGATACCTGG + Intergenic
988568791 5:32343679-32343701 CAGATGTTTTTCTCAAAACAGGG - Intergenic
992948668 5:81834594-81834616 CATCAGTCCTTCTGGAATCATGG - Intergenic
994543349 5:101129123-101129145 CTACTATTCATCTGGAAACATGG + Intergenic
994604473 5:101949980-101950002 CAGTTGTTCTTATGGAAGTAAGG - Intergenic
994743262 5:103647380-103647402 CAGCTGTTCTGCTGGAATTCAGG - Intergenic
995447909 5:112266814-112266836 CAGGTTTTCTTTTGGCAACATGG - Intronic
996062737 5:119049951-119049973 CAGCTGTTCTGCTGGAATTCAGG - Intronic
997665415 5:135626286-135626308 CAGCTGTTTTTCTGCAAAGTGGG + Intergenic
997833575 5:137174196-137174218 AAGCTTTCCTTCTGGAAAGAGGG + Intronic
998076273 5:139239302-139239324 CAGCTGTTCTGCTGGAATTCAGG - Intronic
998477348 5:142432860-142432882 GAGATGTTCTTCTGCAAACTGGG - Intergenic
1002812604 6:647254-647276 CTACTGTTTTTCTGGAAACAAGG - Intronic
1005316014 6:24603601-24603623 CTGCAGTGCTTCTGGAAACAGGG - Intronic
1005361657 6:25036802-25036824 CTCCTGTTCTTCTGGGAAAATGG - Intronic
1005462573 6:26083123-26083145 CAGCTCTTTTTTTGGAGACAGGG + Intergenic
1005483408 6:26276169-26276191 CAGAAGTTCATCTGAAAACAGGG - Intergenic
1006900552 6:37497950-37497972 CAGCTGTCCTACTGTAAACAAGG - Intronic
1009033815 6:58092847-58092869 CACCTGTTCTTCTGGAGCCTTGG - Intergenic
1009587886 6:65629496-65629518 CAGCTGTTCTGCTGGAATTCAGG - Intronic
1009909307 6:69905477-69905499 CCGCTGTTCATCTGCAAAGATGG + Intronic
1010052694 6:71526503-71526525 GAGCTGGGTTTCTGGAAACAGGG - Intergenic
1012578608 6:100834557-100834579 AAGCTGCTTTTCTGAAAACAAGG + Intronic
1013781448 6:113732891-113732913 CAGCAGTCCTGCTGGACACAGGG + Intergenic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1014738497 6:125122281-125122303 CAGATGTTCTTCCAAAAACAGGG - Intronic
1015051540 6:128846913-128846935 TACCTTTTCATCTGGAAACATGG + Intergenic
1018745484 6:166758412-166758434 GGGCTGATGTTCTGGAAACATGG - Intronic
1019056938 6:169230736-169230758 CAGCTGACCTTCTGAAATCAGGG + Intronic
1020014301 7:4821948-4821970 CATCTGTCCTTCTGGAATAACGG + Intronic
1024019989 7:45359935-45359957 CAGCTGCTCCTCTGGCCACAGGG - Intergenic
1024334208 7:48188787-48188809 CAGCTGTGCTGATGGAAACATGG + Intronic
1025854815 7:65267552-65267574 CATCCATTCTTCTTGAAACAAGG - Intergenic
1028913489 7:96233480-96233502 CATCTGATCTTCTAGAAACCGGG + Intronic
1029126201 7:98296742-98296764 CAGCACTCCTTCTGGATACAAGG + Intronic
1029808398 7:103020537-103020559 CATCTGGTCATCTGCAAACAGGG - Intronic
1030334626 7:108311361-108311383 CAGGTGTTCTTTATGAAACAAGG + Intronic
1032129791 7:129218669-129218691 CAGCTGTTTTTTTGGAGACAGGG - Intergenic
1032691468 7:134291553-134291575 CTTCTCTTCTTCTGGAAAGATGG - Exonic
1032801942 7:135323965-135323987 CTGCTGTTCCTCAGGAAAGAAGG + Intergenic
1034544189 7:151779211-151779233 GAGCTGTTCTTTTAGAAACTGGG - Intronic
1035182480 7:157099444-157099466 CAGCTTTTCTGCTGGAATCCAGG - Intergenic
1037158743 8:15740492-15740514 CAACTGTGCTTTTGGAAAAACGG + Intronic
1042078706 8:65025584-65025606 CAACTCTTCTCCTAGAAACATGG + Intergenic
1042246851 8:66716712-66716734 CAGCTGTGCTTCTCCTAACAGGG + Intronic
1043356330 8:79416981-79417003 CTTCTTTTTTTCTGGAAACAAGG - Intergenic
1043403541 8:79907495-79907517 CAGCTGTGTTTCTGAAAATAAGG + Intergenic
1044154827 8:88831885-88831907 CAGTGGTTCTTCTTGATACAAGG - Intergenic
1044535313 8:93350848-93350870 AAGCTATTCATCTGTAAACAAGG - Intergenic
1046200067 8:110914309-110914331 CAGGTTTTTTTGTGGAAACAGGG - Intergenic
1047601609 8:126431378-126431400 CAGCTGTTTTTCTGGAATTCAGG - Intergenic
1047958802 8:129995988-129996010 CAGCTGGTCCTCAGGAAACTGGG + Intronic
1048379890 8:133856185-133856207 CAGCTGCTCTGTTGGAAATAGGG - Intergenic
1048635017 8:136286193-136286215 AAGCTGTTCAGCTGAAAACATGG + Intergenic
1049025039 8:139982499-139982521 CAGCTGCTCGACTGGAAACAGGG + Intronic
1050316421 9:4406287-4406309 CATCTGCTCATCTGCAAACAAGG - Intergenic
1050927469 9:11283110-11283132 CATCTGCTTTTCTGGAATCAGGG - Intergenic
1051711812 9:19938777-19938799 CAACTTTTTTTCTGGAAACTTGG - Intergenic
1052132536 9:24866116-24866138 AACCTGGTCTTCTGGAACCATGG - Intergenic
1055430685 9:76240308-76240330 CAGCTCTGCTTCTGGGAAAATGG - Intronic
1055656444 9:78454349-78454371 CAGCTGTTCTTCTAAAAAATGGG - Intergenic
1056280413 9:85036355-85036377 CAACTGTTCTTCTGGCATAATGG - Intergenic
1056980032 9:91301291-91301313 GAGCTGTGTGTCTGGAAACAGGG - Intronic
1057249561 9:93489472-93489494 CAGCTGTCCTACTGGAACCTGGG - Intronic
1058073436 9:100625417-100625439 CAGTTCTTCTTCTGCAAATATGG + Intergenic
1058239920 9:102544380-102544402 CTGCTCTTCTTCTGGAATGAGGG - Intergenic
1058831508 9:108821847-108821869 CAGCTTTTCTTCTGGAAATTGGG - Intergenic
1059055948 9:110979743-110979765 CAGATGTTCTTCTGCAAAACAGG + Intronic
1061187559 9:129063569-129063591 CAGCTTTTCTTCGGGAAAGTGGG + Exonic
1061348618 9:130046101-130046123 GAGCTATACTTCAGGAAACAAGG - Intergenic
1061605770 9:131709619-131709641 CATCTGTACCCCTGGAAACAAGG - Intronic
1061811819 9:133166731-133166753 CAGCTTTTCATCTGGAAAATGGG + Intergenic
1061820773 9:133226203-133226225 CTGCTGTCCTTCTGCAGACAGGG - Intergenic
1186196223 X:7112680-7112702 CAGCTTTTCTTTTTGAGACAAGG + Intronic
1193121378 X:77825954-77825976 CAGCAGCTCTTTTGCAAACATGG - Intergenic
1193776439 X:85648479-85648501 CAGCTTTTCTTTTGGATTCAGGG - Intergenic
1195424579 X:104713926-104713948 CTCCTCTCCTTCTGGAAACATGG - Intronic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1196401555 X:115322458-115322480 CAGCTGTTCTTTTGGTCAAAAGG - Intergenic
1196784079 X:119407158-119407180 CACCCCTTCTTCTGGAAACTTGG + Intronic
1198040585 X:132847708-132847730 CATCTGTTCCTCTGATAACATGG - Intronic
1199185676 X:144912205-144912227 CACCAGTTGTTCTAGAAACAGGG - Intergenic
1199576013 X:149314693-149314715 CAGCTGTTCTTCTGAGAAAAAGG + Intergenic
1199730896 X:150631095-150631117 CTGCTTTTCTTCTGGAAGCCTGG - Intronic
1199867921 X:151870953-151870975 CAGCAGTTCTTCAGAGAACAAGG + Intergenic
1201712360 Y:17006784-17006806 CAGATGTTCTTCTGGGGAGATGG + Intergenic
1201857107 Y:18556845-18556867 CAAGAGATCTTCTGGAAACATGG - Intronic
1201876214 Y:18763535-18763557 CAAGAGATCTTCTGGAAACATGG + Intronic
1202170150 Y:22034826-22034848 CAAGAGTTCCTCTGGAAACATGG + Intergenic
1202221216 Y:22551547-22551569 CAAGAGTTCCTCTGGAAACATGG - Intergenic
1202321899 Y:23644115-23644137 CAAGAGTTCCTCTGGAAACATGG + Intergenic
1202548868 Y:26025941-26025963 CAAGAGTTCCTCTGGAAACATGG - Intergenic