ID: 1162524144

View in Genome Browser
Species Human (GRCh38)
Location 19:11197643-11197665
Sequence CCGGGCGCCCCGGCCGCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 222}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162524128_1162524144 4 Left 1162524128 19:11197616-11197638 CCAGCCGGCACCGCCCCCTCCAG 0: 1
1: 0
2: 6
3: 65
4: 666
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1162524126_1162524144 6 Left 1162524126 19:11197614-11197636 CCCCAGCCGGCACCGCCCCCTCC 0: 1
1: 0
2: 6
3: 127
4: 1277
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1162524129_1162524144 0 Left 1162524129 19:11197620-11197642 CCGGCACCGCCCCCTCCAGCCGC 0: 1
1: 0
2: 21
3: 111
4: 965
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1162524115_1162524144 28 Left 1162524115 19:11197592-11197614 CCCCCTCCGGCTGGTCCCGCCCC 0: 1
1: 0
2: 6
3: 52
4: 432
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1162524133_1162524144 -9 Left 1162524133 19:11197629-11197651 CCCCCTCCAGCCGCCCGGGCGCC 0: 1
1: 0
2: 6
3: 76
4: 581
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1162524121_1162524144 13 Left 1162524121 19:11197607-11197629 CCCGCCCCCCCAGCCGGCACCGC 0: 1
1: 1
2: 3
3: 56
4: 669
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1162524117_1162524144 26 Left 1162524117 19:11197594-11197616 CCCTCCGGCTGGTCCCGCCCCCC 0: 1
1: 0
2: 0
3: 18
4: 259
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1162524127_1162524144 5 Left 1162524127 19:11197615-11197637 CCCAGCCGGCACCGCCCCCTCCA 0: 1
1: 0
2: 1
3: 36
4: 405
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1162524118_1162524144 25 Left 1162524118 19:11197595-11197617 CCTCCGGCTGGTCCCGCCCCCCC 0: 1
1: 0
2: 2
3: 49
4: 480
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1162524132_1162524144 -6 Left 1162524132 19:11197626-11197648 CCGCCCCCTCCAGCCGCCCGGGC 0: 1
1: 1
2: 14
3: 92
4: 1092
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1162524123_1162524144 9 Left 1162524123 19:11197611-11197633 CCCCCCCAGCCGGCACCGCCCCC 0: 1
1: 4
2: 16
3: 166
4: 1424
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1162524125_1162524144 7 Left 1162524125 19:11197613-11197635 CCCCCAGCCGGCACCGCCCCCTC 0: 1
1: 0
2: 3
3: 60
4: 591
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1162524124_1162524144 8 Left 1162524124 19:11197612-11197634 CCCCCCAGCCGGCACCGCCCCCT 0: 1
1: 0
2: 3
3: 46
4: 534
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1162524116_1162524144 27 Left 1162524116 19:11197593-11197615 CCCCTCCGGCTGGTCCCGCCCCC 0: 1
1: 0
2: 4
3: 40
4: 343
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1162524134_1162524144 -10 Left 1162524134 19:11197630-11197652 CCCCTCCAGCCGCCCGGGCGCCC 0: 1
1: 0
2: 4
3: 46
4: 482
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1162524122_1162524144 12 Left 1162524122 19:11197608-11197630 CCGCCCCCCCAGCCGGCACCGCC 0: 1
1: 0
2: 3
3: 110
4: 1256
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222
1162524119_1162524144 22 Left 1162524119 19:11197598-11197620 CCGGCTGGTCCCGCCCCCCCAGC 0: 1
1: 0
2: 1
3: 40
4: 513
Right 1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162524144 Original CRISPR CCGGGCGCCCCGGCCGCGGT GGG Intronic
900427434 1:2586997-2587019 CCGGGCGTCCTGGCAGCGATGGG + Intronic
901109859 1:6785696-6785718 GCGGGCGACCCGGCCGGGGAGGG + Intronic
901551317 1:9997724-9997746 CCGGGCGCCCCCTCCCCGGCCGG - Intronic
904037924 1:27568697-27568719 CCGGGCACCCGCGCCGCGGCCGG - Intronic
904468017 1:30719325-30719347 CCGGGAGGCCCGGCCGGGGCTGG + Intronic
905202155 1:36322606-36322628 CCGGGCCCCGGGGCCGCGGGCGG + Exonic
914490009 1:148146137-148146159 CCGGGGGCGCGGGCCGGGGTGGG + Intronic
914677872 1:149917777-149917799 ACGGGGGTCCCGGCCGCGGGCGG + Exonic
915932750 1:160070171-160070193 CCGGGGGCCGGGGCCGGGGTCGG + Exonic
922250593 1:223845857-223845879 CCGGGCTCCCCCGCCCCGGCCGG + Exonic
922703322 1:227775042-227775064 CAGGACGCCCCCGCGGCGGTGGG - Intronic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
923191769 1:231626886-231626908 CAGGGCGCCCCAGCCGCCGCCGG + Exonic
1062836632 10:640202-640224 CCGGGAGCCCCGCCAGCCGTGGG - Intronic
1063395703 10:5685182-5685204 CCGGGCGCCCAGGCCGAGGAGGG - Intronic
1064552848 10:16520740-16520762 CCGGGCGCCCCGGGCGGGCCCGG + Exonic
1066022836 10:31319811-31319833 CCGCGCGCCGCGGCCCCGGCCGG + Intronic
1066464233 10:35639511-35639533 GCGGGCGCCACGGCCGCGGGGGG - Exonic
1069662477 10:70132677-70132699 CCGGGCGCCCCGGGCGGGACCGG - Intronic
1072982976 10:100115226-100115248 GCGGGCGCCCCGGACCCGGCCGG + Intergenic
1076657927 10:132036814-132036836 GCGGGCGCCCTGGCGGCCGTGGG + Intergenic
1076721970 10:132396833-132396855 CCCGGGGCTCCGGCCGCGGCGGG + Intergenic
1076793622 10:132788719-132788741 CCGGACAGCCCGGGCGCGGTAGG - Intergenic
1077192661 11:1261919-1261941 GCGGGCGCTCCGGCCGTGGCAGG - Exonic
1077204803 11:1337072-1337094 CAGCCCGCCCCGCCCGCGGTGGG + Intergenic
1087027285 11:93661927-93661949 CCGTGGGCCCTGCCCGCGGTCGG + Intronic
1089499819 11:118925506-118925528 CCCCGCGCCCCGGCCCCGGCGGG - Intronic
1089557170 11:119320967-119320989 CCAGGGGACCCGGCCGCGGCGGG + Intronic
1090076638 11:123584081-123584103 CCTGCCACCCCGCCCGCGGTGGG + Intronic
1090780380 11:130002191-130002213 GCGGGCGCTCCGGGCGCGGCGGG - Intronic
1091550308 12:1531037-1531059 CCCGGCCCCGCGGCCGCGCTGGG + Intronic
1092108939 12:5945398-5945420 CCGGGCGCCCAGGGCGCAGCGGG - Intronic
1094624037 12:32106523-32106545 CCGGGCGCCCACGCCGCTCTCGG + Intergenic
1094753560 12:33440049-33440071 CCCGGCGCCCCTGCCGAGGCCGG + Intergenic
1095476243 12:42589789-42589811 CCGGGCCCCGCGGCCGAGGGCGG - Intronic
1096622679 12:52874317-52874339 CTGGGGCCCCCGGCCGCCGTGGG - Intergenic
1096675062 12:53221749-53221771 CCGGGCGGCCCGGCGGCTGAGGG - Intronic
1097165992 12:57087188-57087210 CCGGGCGCCCCGCGCCCAGTAGG + Intronic
1097938410 12:65278591-65278613 CGGAGCGCGCCGGCCGCGGACGG - Intergenic
1098255379 12:68610841-68610863 CCGCGCGCCCCGCCCGCGGGCGG + Exonic
1098595831 12:72272584-72272606 CCGGGTGGCCCGCCCGCGGGGGG + Intronic
1099365122 12:81758860-81758882 CCGGGTGGCCCGGGCGCGGAGGG - Intronic
1103091936 12:118103883-118103905 CCGAGCGCCCTGGCCGGGGAGGG + Exonic
1103188635 12:118981854-118981876 CCGGACGCCCCGGCCCCTTTGGG + Exonic
1103364064 12:120369456-120369478 CCGGGCCCCCGCGCCGGGGTGGG - Intergenic
1103562517 12:121800073-121800095 CCGGCCGCCCGGGCCGCTGGGGG - Intronic
1103719585 12:122966183-122966205 CTGGGCACCCCTGCCTCGGTGGG - Intronic
1103764656 12:123271630-123271652 GCGGGCGCGCCGGGCGCGGCGGG + Exonic
1104961246 12:132489663-132489685 CTGGGGTCCCCGGCCGCGGGCGG - Exonic
1106157380 13:27171442-27171464 CCGGGCGGCCCGGGCGGGGGCGG - Intronic
1107086286 13:36431409-36431431 GCGGGCGGCCCGGCCGCGTGGGG - Intergenic
1113656124 13:112068580-112068602 TCGGGCGCCCTGGGCGCGCTGGG + Exonic
1115545598 14:34462509-34462531 CCGGCCGGCCCGGGCGGGGTGGG - Intronic
1118809008 14:69260391-69260413 CTGCGCGCCCCGGCCGCCGGAGG - Exonic
1118925769 14:70188732-70188754 CCCGGAGTCCCGGCCGCGGGCGG + Exonic
1122220978 14:100239072-100239094 GCGGGCGCCGCGGCGGCGGCGGG - Exonic
1125721010 15:41845154-41845176 CTGGGCACCCAGGCCGCTGTGGG + Intronic
1126137164 15:45403096-45403118 CCGCGCGCCCTGACCGCGCTGGG + Exonic
1128528991 15:68431527-68431549 CCGGGCGCGGCGGCCCCGGAGGG - Intronic
1129162115 15:73752851-73752873 CCGGGGGCCCCGGCCGGGCTGGG + Intergenic
1129710750 15:77819275-77819297 CCGGGCGCGCCGTCCGCGCGCGG + Intronic
1131055286 15:89371299-89371321 CCGGGAGGTCCGGCCGCGGCCGG - Intergenic
1131517605 15:93089309-93089331 CCGGGCGCCCGGGCCGCGGGCGG + Intergenic
1132105357 15:99059121-99059143 GCGTGCGCGCCGGCCGCGGCGGG + Intergenic
1132365082 15:101251430-101251452 CCAGGCGCGCCGGCCGCGCGCGG + Exonic
1132547538 16:540262-540284 CCGGGTCCCCCGGCAGCGGCTGG + Intronic
1132551185 16:554405-554427 CCGGAAGCCCCTGCCGGGGTAGG - Exonic
1132567292 16:629396-629418 CCGGGCTGACCTGCCGCGGTTGG + Intronic
1132570616 16:642370-642392 GCGGGCGCTCCGGGCGCGGGGGG + Intronic
1132719686 16:1309616-1309638 CCGCGCGCCCCGCCCGCGCCAGG + Intronic
1132843533 16:1989934-1989956 CCGCGCGTCCCCGCCGCGGCCGG + Exonic
1132947237 16:2538259-2538281 CCGGGCGGCCGGGCCGGGGATGG + Intronic
1132968478 16:2673197-2673219 CCGGGCGGCCGGGCCGGGGATGG - Intergenic
1133049000 16:3106274-3106296 CCGGGCGCCCGGGCGGGGGTTGG + Intergenic
1133784521 16:8963838-8963860 CCGGGCGCCGCGTCCGCTGCCGG - Intronic
1136891520 16:33975573-33975595 CCGCGGGCCCCGGCCGGGGCCGG + Intergenic
1138655247 16:58487708-58487730 CCGGGCGTCCCCGCCGCAGCAGG + Intronic
1141972355 16:87492477-87492499 CCGGCCGCCCCGGCCGCCCCGGG - Intergenic
1203081512 16_KI270728v1_random:1148033-1148055 CCGCGGGCCCCGGCCGGGGCCGG - Intergenic
1142631536 17:1229302-1229324 CCGGCCGCCCCGGGCCCGGCGGG + Intergenic
1142670700 17:1486194-1486216 CCGGGCGCGCCGGCCGTATTTGG - Intronic
1142688000 17:1588868-1588890 CCGGGAGCCTCTGCCGCGGGTGG + Intronic
1142694833 17:1628018-1628040 CCGGCCGCCGCGGCCGGGGAGGG - Intronic
1142752758 17:1998394-1998416 CGGGGAGCCGCGGCCGCGCTGGG + Intronic
1142757508 17:2024764-2024786 CCGGGAGCCCCGGCGCCGGGCGG + Intronic
1142762424 17:2050234-2050256 CCGGGCGCGGCGGCGGCGGCCGG + Intergenic
1143183528 17:4998020-4998042 CCGGGTGCCCGGGCGGCGGGCGG - Exonic
1143894879 17:10128086-10128108 TCGGGGGCCCCAGCCGGGGTAGG - Intronic
1145190615 17:20840788-20840810 CCGGGGGCGCGGGCCGGGGTGGG + Intronic
1145214765 17:21043090-21043112 CGGGGCGCCGCGGCCGCGGACGG + Intronic
1145243594 17:21253290-21253312 CCGCGCGCCCCGGCCCCCGCCGG - Exonic
1145912899 17:28552642-28552664 CCTGGGGCCCCGGCCGGGGGCGG - Exonic
1146339564 17:32007540-32007562 CCGGGCGCAGTGGCGGCGGTGGG - Intergenic
1147139700 17:38454113-38454135 CCGCGCGCCCGGGCCGCGCCGGG + Intronic
1147311606 17:39599124-39599146 CCGGGCTCCCAGGCCGAGGCTGG - Intergenic
1147684214 17:42276991-42277013 CCAGGCGCCCCGTCCCCCGTAGG - Intergenic
1147705498 17:42422503-42422525 CCGGGCGCCCGGGCCAGGCTGGG + Intronic
1147819713 17:43234459-43234481 CCGGTCTCCCCGCCCGCGGGCGG - Intergenic
1147821025 17:43241857-43241879 CCGGTCTCCCCGCCCGCGGGCGG - Intergenic
1147821831 17:43246346-43246368 CCGGTCTCCCCGCCCGCGGGCGG - Intergenic
1147826564 17:43273772-43273794 CCGGTCTCCCCGCCCGCGGGCGG - Intergenic
1147827453 17:43278650-43278672 CCGGTCTCCCCGCCCGCGGGCGG - Intergenic
1147828561 17:43284811-43284833 CCGGTCTCCCCGCCCGCGGGCGG - Intergenic
1147829669 17:43290962-43290984 CCGGTCTCCCCGCCCGCGGGCGG - Intergenic
1147831447 17:43300713-43300735 CCGGTCTCCCCGCCCGCGGGCGG - Intergenic
1148090344 17:45019426-45019448 CCGGGCGCCCGGCCCGCGGGAGG + Intergenic
1148685163 17:49496763-49496785 CCGGGCGCCCCCGTCTCGTTAGG - Intronic
1151555314 17:74843490-74843512 CCGGGCTGGCCTGCCGCGGTGGG + Exonic
1152610534 17:81313125-81313147 CCGGGAGCTCCGGCCCCGGTGGG + Exonic
1152756792 17:82090374-82090396 CCGGGCGCCATGGCAGCCGTGGG - Exonic
1153794343 18:8609320-8609342 CCGCGCGCCCGGGCCTCGGTTGG - Intergenic
1155199353 18:23503595-23503617 GCGGGCGCCGCGCCCGCGGCGGG - Exonic
1155519805 18:26656796-26656818 CTGGGCGCCCCCGCGGCGCTGGG + Intronic
1160025062 18:75209650-75209672 CCCGCCGCCCGGGCCGCGCTCGG - Intergenic
1160157014 18:76441940-76441962 ACGCGCGCCCCGGCCGAGGAGGG - Exonic
1160164088 18:76495246-76495268 CCGGGCGCAGCTGGCGCGGTCGG - Intergenic
1160404810 18:78638128-78638150 CAGGGCGCCCCGGCCGGCCTGGG + Intergenic
1160853404 19:1205603-1205625 CCGGGCGCCCGAGCGGCGATTGG - Intronic
1160889699 19:1370774-1370796 CCGGGCGGCCCGCGAGCGGTCGG - Exonic
1160909219 19:1467206-1467228 CCCGGCGCCCCCGCCGCGCTCGG - Exonic
1160927917 19:1555903-1555925 CGTGGCGCCCCGGACCCGGTGGG - Exonic
1160990136 19:1857074-1857096 CCGGGCCCCCTGGCCCCGGCGGG - Intronic
1161172516 19:2820085-2820107 CCGCGCGCGCCGGCCCAGGTGGG - Exonic
1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG + Intronic
1162959464 19:14117543-14117565 CCGGCCGCCGCCGCCGCGATGGG - Exonic
1163607142 19:18281578-18281600 CCGGGCGCTGCGGCCGCGGCCGG - Exonic
1165639422 19:37371275-37371297 CCGGGTGGCCCGGCCGCGCCAGG + Intronic
1167613483 19:50518309-50518331 CCGGGGGCACCGGCAGCGGCGGG - Exonic
925928345 2:8685903-8685925 CCGGGCTCCACGGCCGGAGTCGG - Intergenic
926422870 2:12716653-12716675 CCGGGGCCCCGGGCCGCGGAAGG + Intergenic
928093766 2:28392156-28392178 GCGGGCGCCCCGGGCGCGCAGGG - Intergenic
928303518 2:30147297-30147319 CCTGGCGCGGCGGCCGCCGTCGG + Intronic
929604526 2:43226040-43226062 CCGGGCAGCGTGGCCGCGGTCGG + Intronic
930156415 2:48111735-48111757 CCGGGGGCGCCGGCCGGGGAGGG - Intergenic
934079012 2:88452156-88452178 CCGGGCCCCGCGGGCGCGGCGGG + Exonic
935692758 2:105745288-105745310 GGGGGCGCCCAGGCCGCGGCAGG - Intronic
937208627 2:120252996-120253018 CCGCGGGCCCCGGGCGGGGTGGG + Intronic
938368782 2:130756116-130756138 GGGGGCGCGCCGGCCGCGGTGGG - Intronic
942928128 2:181457470-181457492 CCGAACGCTCCGCCCGCGGTGGG + Exonic
945234813 2:207624761-207624783 CCGGGCGCCCGGGTCTGGGTTGG - Intronic
948115995 2:235494562-235494584 CCGGGCCCGCCGGCGGCGGGCGG - Exonic
1172618729 20:36306485-36306507 CCGGGCGCCTCGGCCGCCTCCGG - Exonic
1175931467 20:62495806-62495828 CCGGGAGCCCGGGCCGGGGCTGG - Intergenic
1176110556 20:63408798-63408820 CCGGGCGACTCGGCCCTGGTGGG - Intronic
1176380863 21:6111511-6111533 CCGGTCTCTCCGCCCGCGGTCGG - Intronic
1176574481 21:8435809-8435831 GCGTGTGTCCCGGCCGCGGTCGG + Intergenic
1180110175 21:45643802-45643824 CCGGGAGGCCCGGGCGGGGTCGG - Exonic
1180843765 22:18970820-18970842 AAGGGCGCCCCGGCCCCGGGAGG + Intergenic
1181057708 22:20267886-20267908 GCTGGCGCCCCGGCCCCGGGAGG - Intronic
1183821057 22:40346416-40346438 CCGGGCGCCCTGGGCGCTGCCGG - Intergenic
1183931308 22:41237654-41237676 GCGGGCGCCCTGGCCGGGCTGGG - Exonic
1184679302 22:46061750-46061772 CCGGGGTCCCAGGCCGGGGTCGG - Intronic
1203252529 22_KI270733v1_random:124860-124882 GCGTGCGTCCCGGCTGCGGTCGG + Intergenic
952816435 3:37451935-37451957 CCGAGCGCCCCGTGCGCGGCGGG + Intergenic
953657079 3:44862267-44862289 CCGGGGCCCCGGGCCGCGGGCGG + Intronic
953694385 3:45146293-45146315 CGGGACGCCTCGGCCTCGGTGGG + Exonic
954392197 3:50273698-50273720 CCGGGAGCCCCCGCCGCAGCGGG + Intronic
954912353 3:54121215-54121237 CCGGGAGCCCCGGCGACGTTAGG + Intergenic
961674282 3:128555418-128555440 CCGGGTGCCCCGGCCTCCGCCGG - Intergenic
962498388 3:135965639-135965661 CCGGGCGGGCCGGCCGCCGAGGG + Intergenic
964482807 3:157159644-157159666 CGGCACGCCCCGGCCGCGGCTGG + Intronic
966362875 3:179148673-179148695 CCGGGCGCGCCCGCCGTGTTGGG + Intronic
967055344 3:185825109-185825131 CGGGCCGGGCCGGCCGCGGTGGG - Intergenic
968148239 3:196317855-196317877 CCGGGCGCCCCTCCCGCTGCAGG - Intronic
969032787 4:4227356-4227378 CCGGGCGCCCCGGAAACGCTGGG + Intergenic
970195180 4:13544784-13544806 CTGTGCGCCCCGGCGGCGCTCGG - Exonic
973531856 4:51843402-51843424 CCGCCCGCCCCGGCCCCGGGAGG - Intronic
974420258 4:61663454-61663476 CCAGGCACACCGGCTGCGGTGGG - Intronic
976601453 4:86941369-86941391 CCAGGCGGGCCGGCCGCAGTGGG + Intronic
981044485 4:140252899-140252921 CCGGGCTCCGCGGCCGGGATGGG + Intergenic
981516779 4:145618973-145618995 CCGGGGGTCCCGGCCGCCGCAGG + Exonic
983077518 4:163343976-163343998 CGGGGCGCCCCGGCCGCTGCAGG - Intronic
985669854 5:1201670-1201692 CCGGGCGTCTAGGCCGGGGTTGG - Exonic
985995935 5:3596704-3596726 CCGGGCGCCCTGGCCGAGCCAGG - Intronic
986184509 5:5423011-5423033 CCCGGGGCCCCGGGCGCGGGGGG + Intronic
989475771 5:41870744-41870766 CAGGGCCCTCCGGCCGCGGGAGG + Intergenic
990955325 5:61333378-61333400 CCGAGCGGCCGGGCCGCGGCCGG - Intronic
995759130 5:115544892-115544914 CGGGGCGTCGCGGCCGGGGTGGG + Exonic
996379056 5:122845549-122845571 CGGGGCGGCCCGGCCGTGGGCGG + Exonic
997560970 5:134846016-134846038 CCGTGCGCGGCGGCCGCGGCGGG + Exonic
1000305060 5:159987279-159987301 CTGGGCGCCCCCGCCGCAGGAGG - Intergenic
1002185864 5:177454610-177454632 CCGGGCTCCGCGGCGGCGGCCGG + Intronic
1002189889 5:177472899-177472921 CCGGGCGCCCCGCCCACCGGGGG - Exonic
1002715140 5:181222561-181222583 CCGGGGACCCCTGCCGCGGCCGG + Intronic
1002898610 6:1393071-1393093 CCGGGCCCCCAGGCCTCAGTGGG - Intronic
1003139156 6:3456749-3456771 CCGGGCGCTGCGGCCCCGCTCGG + Intronic
1007557902 6:42782435-42782457 CCCGGGGCCCCGGCAGCGCTGGG - Intronic
1012939668 6:105403214-105403236 CCGGGCGGCGCGGGCGCGGCCGG - Intergenic
1013170748 6:107634735-107634757 CCGGGCCCCCCGGGCGCGGGCGG + Exonic
1013242770 6:108261160-108261182 CCGGGAGGCCCGGCCGAGGCTGG + Exonic
1015328508 6:131951077-131951099 CCGGGAGCCCCCGCTGCGGCCGG - Intronic
1017672044 6:156777942-156777964 GCGGGCGCCGCGGCCGCCGCCGG + Exonic
1017672512 6:156779622-156779644 CGGGGCGCCCCGACCGCGGCGGG - Intronic
1019343756 7:519998-520020 CCGGGCGCCGCCGCCGCGGCAGG + Intronic
1019534944 7:1523930-1523952 CGGGGCGCCCCGGGAGGGGTGGG - Intergenic
1019711460 7:2519965-2519987 CAGCGCGCGCCGGCCGCGCTCGG - Exonic
1020003226 7:4767359-4767381 GCGGGCGGCCTGGCTGCGGTAGG + Exonic
1022103867 7:27184834-27184856 CCAGGCACGCCGGCCGCGCTGGG + Exonic
1024065275 7:45727128-45727150 CCGGGCGCCCCTTCCCCTGTGGG - Intergenic
1024965369 7:55019083-55019105 CCGGCCGCCTCGGCCGCGTCGGG - Exonic
1026004694 7:66591769-66591791 CCCGGCGCCCCTGCCGCGGCCGG + Intergenic
1026025597 7:66741253-66741275 CCCCGCGCCCCTGCCGCGGCCGG - Intronic
1031484407 7:122310598-122310620 CCGGGCGCCGCTGCCGGGCTGGG + Intronic
1032074567 7:128830335-128830357 CCGGGGGCCGCGGGCGCGGCGGG + Intergenic
1033186620 7:139232041-139232063 CGGGGCGACCCGGACGCGCTCGG - Intronic
1033794987 7:144835928-144835950 CCGGGCGCGCGGGCCGCGGAAGG - Intronic
1034128905 7:148698561-148698583 GCGGGGGCCTCGGCCGCGGAAGG + Intronic
1034147135 7:148883838-148883860 CGGGGCGCCGGGGCCGGGGTCGG - Intronic
1034392921 7:150800434-150800456 CCGGGCCCCCGGGCCGCAGCTGG - Exonic
1034455500 7:151167815-151167837 CCGGGCGCGGCGGCGGCGGGCGG - Intronic
1037788874 8:21919587-21919609 CCGGCGGCCCGGGCCGTGGTTGG - Intergenic
1037903832 8:22703774-22703796 CCCGCCGCCCGGGCCGCGGGCGG + Intergenic
1039454401 8:37697671-37697693 CCGTGAGCCGCGGCGGCGGTGGG + Exonic
1039608392 8:38901114-38901136 CCGGGCGCCGGGGCCGCGCGGGG - Intergenic
1039903168 8:41767293-41767315 CCCCGCGCCCCGGCCCCGGCCGG + Intronic
1039949011 8:42153266-42153288 CCCGGCGCCGCGGCTGCGGGCGG + Intronic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1049109791 8:140635639-140635661 CCCGCCGCCCCGGCCGCGTCGGG - Intergenic
1050094251 9:2047327-2047349 CCGGGCACTGCGGCCGCGGGCGG - Exonic
1052048316 9:23820736-23820758 CCGTGCACCCCGGCCGCCGCTGG + Intronic
1053142533 9:35690520-35690542 CCCAGAGCCCCGGTCGCGGTGGG + Exonic
1053435010 9:38068729-38068751 CTCGGCGCCCCGGCCCCGGCGGG + Exonic
1055574671 9:77648764-77648786 CCGGACGCCCCGGCCCAGCTCGG + Intergenic
1056154006 9:83817412-83817434 CTCGGCGCCCCGGCCTCGGGTGG - Intronic
1056992304 9:91423605-91423627 CCGGGCCCCCGGCCGGCGGTGGG + Intronic
1057259774 9:93577001-93577023 CCGGGCGCCCCGGTCGGGGCTGG + Intronic
1057619171 9:96619634-96619656 CTGGGGGCGCCGGCCGCGGCAGG - Exonic
1060114374 9:120928914-120928936 GCGGGCGCCCCGGCCCCGCAGGG - Intronic
1060208962 9:121699026-121699048 CGGGCAGCCTCGGCCGCGGTCGG + Intronic
1060700860 9:125747782-125747804 CCGCCCGCCCCGGCCTCGGGGGG + Intronic
1060814187 9:126626189-126626211 CCGTGCGCCCTGGCAGAGGTCGG + Intronic
1060945604 9:127568257-127568279 TGGGGCGCCCCGGAGGCGGTGGG - Intronic
1061975711 9:134067355-134067377 CCGCGCGCCGCGGCCGGGGCGGG - Intronic
1062230636 9:135479889-135479911 CCCCGCGCCCCGGCCGAGGGCGG + Exonic
1203468932 Un_GL000220v1:108011-108033 GCGTGTGTCCCGGCCGCGGTCGG + Intergenic
1203476753 Un_GL000220v1:151983-152005 GCGTGTGTCCCGGCCGCGGTCGG + Intergenic
1187419629 X:19122769-19122791 GCGGGGCCCCCGGCTGCGGTGGG - Intergenic
1187826283 X:23335256-23335278 GCCAGCGCCGCGGCCGCGGTCGG + Intronic
1189001942 X:36957510-36957532 CCGCGGGCCAGGGCCGCGGTAGG + Intergenic
1190265719 X:48826459-48826481 CGGGGCACCCCGGCGGCGGTTGG - Intergenic
1190730886 X:53224844-53224866 CCGGGCACTCCGGTGGCGGTAGG + Exonic
1199772708 X:150984312-150984334 CCGGGCGGCCCGGGCGGGGCGGG + Intronic
1200100693 X:153688103-153688125 CCGCGGGCCCCGGCCGGGGCGGG + Exonic
1200787551 Y:7273752-7273774 GGGGGCGCCCCGGGCGCGGAGGG + Intergenic