ID: 1162524829

View in Genome Browser
Species Human (GRCh38)
Location 19:11201200-11201222
Sequence ACTCTGGGGGGGTCCAGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162524812_1162524829 24 Left 1162524812 19:11201153-11201175 CCAAGAACCCAGGCAATGAACAG 0: 1
1: 0
2: 1
3: 19
4: 231
Right 1162524829 19:11201200-11201222 ACTCTGGGGGGGTCCAGCCTTGG 0: 1
1: 0
2: 1
3: 13
4: 174
1162524813_1162524829 17 Left 1162524813 19:11201160-11201182 CCCAGGCAATGAACAGAATCTGG 0: 1
1: 0
2: 0
3: 24
4: 301
Right 1162524829 19:11201200-11201222 ACTCTGGGGGGGTCCAGCCTTGG 0: 1
1: 0
2: 1
3: 13
4: 174
1162524815_1162524829 16 Left 1162524815 19:11201161-11201183 CCAGGCAATGAACAGAATCTGGG 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1162524829 19:11201200-11201222 ACTCTGGGGGGGTCCAGCCTTGG 0: 1
1: 0
2: 1
3: 13
4: 174
1162524823_1162524829 -9 Left 1162524823 19:11201186-11201208 CCTTCCTGGGTCTGACTCTGGGG 0: 1
1: 1
2: 1
3: 34
4: 355
Right 1162524829 19:11201200-11201222 ACTCTGGGGGGGTCCAGCCTTGG 0: 1
1: 0
2: 1
3: 13
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162524829 Original CRISPR ACTCTGGGGGGGTCCAGCCT TGG Intronic