ID: 1162525148

View in Genome Browser
Species Human (GRCh38)
Location 19:11202523-11202545
Sequence CTGCCTTGGGGCTGGAGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 415}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162525148_1162525168 25 Left 1162525148 19:11202523-11202545 CCCCTACTCCAGCCCCAAGGCAG 0: 1
1: 0
2: 3
3: 39
4: 415
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79
1162525148_1162525161 9 Left 1162525148 19:11202523-11202545 CCCCTACTCCAGCCCCAAGGCAG 0: 1
1: 0
2: 3
3: 39
4: 415
Right 1162525161 19:11202555-11202577 CCGTTCCACCCCCAACCACAAGG 0: 1
1: 0
2: 2
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162525148 Original CRISPR CTGCCTTGGGGCTGGAGTAG GGG (reversed) Intronic
900287996 1:1910955-1910977 CTCCCTTGGGCCTGGAGCACGGG - Intergenic
900306740 1:2013625-2013647 CTGTCTTGGGGGTGGTGGAGGGG + Intergenic
900871068 1:5303704-5303726 CTTACCTGGGGCTGGAGGAGGGG + Intergenic
901135211 1:6988604-6988626 CTGCCGTGGCGCAGGGGTAGGGG - Intronic
901140437 1:7025728-7025750 CAGCTTTGGGGATGGAGTGGGGG + Intronic
901508529 1:9701868-9701890 CTGCCTTGGGGTGAGAGTAGGGG + Intronic
901571105 1:10161351-10161373 CTGCTTTGGGGCTGCATTTGTGG + Intronic
904164233 1:28543347-28543369 TTTTTTTGGGGCTGGAGTAGCGG - Intergenic
904466555 1:30711577-30711599 CTGCCCGGTGGGTGGAGTAGTGG - Exonic
905162147 1:36045970-36045992 CTGATTTGGAGATGGAGTAGTGG - Intronic
906515807 1:46438265-46438287 CTGCCTGGGGGATGGAGAAGGGG - Intergenic
906710440 1:47925851-47925873 CTGCCATGGTGCAGGAGGAGAGG + Intronic
907732243 1:57078120-57078142 TTGCCTGGGGGCTGGTGCAGAGG - Intronic
910253725 1:85225222-85225244 CTGCCTTGGAGCTGGAGGCCAGG - Intergenic
912883491 1:113444136-113444158 CTGCCATGGGGCTGGGGTAGTGG - Intronic
913530683 1:119732337-119732359 CTGCCCTGGGGCTGGGATTGAGG + Intronic
913545562 1:119865624-119865646 ATTGCTTGGGGCTGGAGTAGAGG - Intergenic
914237697 1:145827151-145827173 CTGCCATGGGGCTTTAGTATAGG + Intronic
915108752 1:153549814-153549836 CTGCCTTGGGGTGGGAGCACTGG - Intronic
915206103 1:154271583-154271605 CTGGCTTGGGGATGGGGTACAGG + Intergenic
916170181 1:161995976-161995998 CTGCCTTGGGGTCAGAGAAGAGG - Intronic
918175465 1:182040591-182040613 CTGCCTTGGGGCCTGGGCAGCGG + Intergenic
918223863 1:182460877-182460899 GTGCCATGGGGCTGGGGTTGAGG - Intronic
920195860 1:204226644-204226666 CTGTCTTTAGGCTGGAGTTGAGG - Intronic
920338552 1:205260688-205260710 CTGCCAGGGGGCTGGGGTGGGGG - Intronic
922254311 1:223879234-223879256 CTACCTGGGGGATGGAGTTGGGG - Intergenic
924070829 1:240276477-240276499 CTACCTTGGGGGTTAAGTAGAGG + Intronic
1062769005 10:85222-85244 CTGCCTGGGGGCTGGGGTCAGGG - Intergenic
1063300663 10:4846252-4846274 CTGTCTTGCGGCGGGAGGAGGGG - Intronic
1064310546 10:14208519-14208541 CTGCCTTGGGGAAGGAGGAGGGG + Intronic
1064727774 10:18298635-18298657 CTGCACTAAGGCTGGAGTAGTGG - Intronic
1065900978 10:30207692-30207714 TAGCCTTGGGGCTGGAACAGAGG + Intergenic
1066408475 10:35142952-35142974 CTGCCTTGGTGCAGGCATAGAGG + Intronic
1069526375 10:69175676-69175698 CTGGCTGGGGGCTGGGGTTGGGG - Intergenic
1069581525 10:69570011-69570033 CCACCTTGGGGCTGGAGTGCCGG - Intergenic
1069792316 10:71030621-71030643 CGGCCTTGGGTCTGGGGTAATGG + Intergenic
1070839149 10:79471121-79471143 CTGCCTTGGAGCAGGTGGAGTGG - Intergenic
1071051752 10:81458934-81458956 ATGCCTTGGGACAGGAGTACAGG - Intergenic
1071364029 10:84880599-84880621 TTTCCTGGGGGCTGGAGAAGAGG - Intergenic
1071510815 10:86261549-86261571 CTGGCTTGGGGCAGGAATATGGG - Intronic
1071525242 10:86354539-86354561 CTGCCTTGGGGTTGTGGTGGTGG - Intronic
1071601332 10:86959951-86959973 CTGCCTTGGGGCTGGGGCTGGGG + Intronic
1071746469 10:88425322-88425344 ATGCTTTGGGGCAGGGGTAGTGG - Intronic
1072640077 10:97205216-97205238 GTGCCTTGGGGCAGGGGTAGGGG - Intronic
1073095856 10:100979310-100979332 CAGCATAGGGGCTGGAGCAGAGG + Intronic
1073147055 10:101288005-101288027 CTCCCTTGGGGTGGGAGTGGGGG - Intergenic
1073281209 10:102355563-102355585 CAGCCTGCTGGCTGGAGTAGGGG - Intronic
1073763702 10:106658599-106658621 AAGCCTTGGGGATGGAGAAGGGG + Intronic
1075082224 10:119391668-119391690 CTGCTGTGGGGGTGGAGTGGTGG - Intronic
1075175269 10:120154527-120154549 CTGGCTTGGGGATGGGGCAGGGG - Intergenic
1075777397 10:124997587-124997609 CAGGCTTGGGGCTCGTGTAGGGG - Intronic
1077001730 11:326789-326811 CTGCTGTGGGGCAGGAGCAGTGG - Intronic
1077035035 11:490367-490389 CTGCAGTGGGGCTGGTGTGGGGG + Intronic
1077536750 11:3128266-3128288 CTGCTTTGGGGCTGAGGAAGTGG - Intronic
1078568984 11:12441159-12441181 CAGCCTTGGGGGTGGAGGTGGGG + Intronic
1079248520 11:18770923-18770945 CTGCCTGGGGGGTAGAGTGGGGG + Intronic
1080518930 11:33049687-33049709 CTGCCTTAGGGCTGGAGGTGAGG - Intronic
1081368966 11:42274679-42274701 TGGCCTTGTGGCTGGAGAAGTGG - Intergenic
1081620029 11:44613937-44613959 CTGGCTTGGGGCTTGGGAAGGGG + Intronic
1081716194 11:45252287-45252309 CTGGCTTGGGGCTGGAAGGGAGG - Intronic
1082865692 11:57898253-57898275 CTTCCTTGGGCCTGGAGTCTGGG + Intergenic
1083255817 11:61494870-61494892 CTGCCCTGATGCTGGAGCAGAGG + Intergenic
1083719752 11:64598409-64598431 AAGCCTTGGGCCTGGAGCAGTGG + Intronic
1084987632 11:72890412-72890434 CTGCCTTGGGGCAGGGGGAGGGG - Intronic
1085281679 11:75335097-75335119 CCGCCTCGGGGCTGGAGGAAGGG + Intronic
1085397257 11:76212880-76212902 CTGCCTGGGGAGGGGAGTAGGGG + Intergenic
1087803570 11:102531297-102531319 CTGCTGTGTGGCTGGATTAGTGG + Intergenic
1089367671 11:117931148-117931170 CTGCCTGGGGGATGAAGTGGAGG - Intergenic
1089528678 11:119112916-119112938 CTGCCTTGGGTCTGCAGTCCCGG - Intronic
1090228378 11:125085001-125085023 CTGCCTTGGGGTTGGGGCTGCGG + Intronic
1090359948 11:126165327-126165349 CAGGCTGGGGGGTGGAGTAGGGG + Intergenic
1090659917 11:128874539-128874561 CTCCCTTGGAGCTGGAGTCAAGG - Intergenic
1090900933 11:131030507-131030529 CTTCCTTGGGGCTGACTTAGAGG + Intergenic
1091776709 12:3189428-3189450 CTGCCTTGGGCCAGTACTAGTGG + Intronic
1091919175 12:4290584-4290606 ATGCCTGGGGGCAGGAGGAGGGG - Intronic
1092477044 12:8828378-8828400 CTCCTGTGGGCCTGGAGTAGTGG - Intronic
1092795391 12:12106165-12106187 TTGCCATGGGACTGGAGTTGGGG - Intronic
1094784760 12:33834889-33834911 CTGCTTTGAGGTGGGAGTAGTGG - Intergenic
1095938885 12:47712865-47712887 CTGGCTTGCTGCTGGAGTAATGG - Intronic
1096100176 12:48966063-48966085 TTACCTTGGGGCTGGGGAAGAGG - Exonic
1096110007 12:49023009-49023031 CAGCCTTGGGAAAGGAGTAGAGG + Intronic
1096614552 12:52824393-52824415 CTTCCTGGGGCCTGGAGCAGGGG - Intronic
1096750086 12:53752978-53753000 CTGCCTTGGTGCAGGAGTCTTGG - Intergenic
1097052281 12:56230701-56230723 CTGCCTTGGGGCGGGGTCAGGGG - Exonic
1098046797 12:66408896-66408918 TTGCCATGGGCCTGGAGCAGTGG + Intronic
1099876303 12:88410244-88410266 CTGTCTTGGGGTTGGGGGAGTGG - Intergenic
1100764218 12:97845859-97845881 CTACCCTGGGGATGGAGTTGGGG - Intergenic
1101230682 12:102737962-102737984 CTGCCACGGGGCTGGAGATGAGG - Intergenic
1101769203 12:107732975-107732997 CAACCTCTGGGCTGGAGTAGAGG - Exonic
1102454993 12:113065640-113065662 AAGCGTGGGGGCTGGAGTAGGGG + Intronic
1102823325 12:115926467-115926489 GTGAGTGGGGGCTGGAGTAGAGG + Intergenic
1104044367 12:125151487-125151509 CTGCCCTGCGGCAGGAGGAGAGG + Intergenic
1104716237 12:131018210-131018232 CTTCCTGGGAGCTGGAGGAGTGG - Intronic
1104891039 12:132140299-132140321 CTGCCATGGGGCTGGGGCACAGG + Intronic
1105650025 13:22367138-22367160 CTGCCTTGAGGCAGGAGTATTGG + Intergenic
1105789650 13:23785469-23785491 CTGTCTTGGGGTTGGGGGAGGGG + Intronic
1105975308 13:25468056-25468078 CTGCCTTGGAGTTGGAGATGAGG + Intronic
1107370161 13:39737193-39737215 CTGCCTCGGAGCTGGGGGAGTGG + Intronic
1111342106 13:86899864-86899886 CTGTCTTGGGGTTGGAGGAAGGG + Intergenic
1112245649 13:97730831-97730853 CGGCCTCGAGGCTGGGGTAGGGG + Intergenic
1114555056 14:23557054-23557076 CGGCCTGGGGGCTGGAGATGTGG + Exonic
1115429669 14:33301366-33301388 AAGGCTTGGGGCTGGAGCAGGGG + Intronic
1115430253 14:33309260-33309282 CTGCCTTGGAGGTGGAGTGTGGG + Intronic
1115771379 14:36666475-36666497 CCACCTTGGGGCTGTGGTAGGGG - Exonic
1115795768 14:36933712-36933734 CTATCCTGGGGCTGGAGGAGGGG - Intronic
1115928920 14:38468194-38468216 CTTCCTTGGTGCAGGGGTAGGGG + Intergenic
1118259505 14:64234307-64234329 TTGCCCTGGAGCTGGAGGAGGGG - Intronic
1118952414 14:70446664-70446686 GTGCCTTGGGGCCTGGGTAGTGG + Intergenic
1119897611 14:78233046-78233068 CTACCTTGGGGATGGAGTATAGG + Intergenic
1121019811 14:90573026-90573048 CTTCCTTGGGGCGGGGGTTGGGG + Intronic
1121232944 14:92371875-92371897 CTGCCTTGGTGCTTGAGAAAGGG - Intronic
1121454002 14:94026967-94026989 CTCCCTTGGGGTTGGGGCAGGGG - Intronic
1121785936 14:96661066-96661088 CTGCCTTAGGGCTAGAGCAGGGG - Intergenic
1122317558 14:100835055-100835077 TTGCCCAGGGGCTGGAGCAGTGG + Intergenic
1122889184 14:104724676-104724698 CTGCCGGGGTGGTGGAGTAGGGG - Intronic
1122973638 14:105162377-105162399 CTGCCTGGGGACAGGAGGAGGGG - Intronic
1124666318 15:31595899-31595921 CTGGCTTGGGGATGGAGAAAGGG - Intronic
1125333645 15:38606249-38606271 CAGCCTTGGGGCCAGAGGAGAGG + Intergenic
1125673250 15:41488333-41488355 CTGCCCTGGGGATGGGGTAGAGG + Intergenic
1125928707 15:43584435-43584457 CTTCCTTGGAGCTGGAGATGAGG - Exonic
1125941873 15:43684270-43684292 CTTCCTTGGAGCTGGAGATGAGG - Intergenic
1127223505 15:56905513-56905535 CTGTCGTGGGGCTGGGGGAGTGG + Intronic
1128389593 15:67174129-67174151 CTGAGTGGGGGCTGGAGGAGAGG - Intronic
1128835554 15:70806550-70806572 CTGCACTGTGGCTGGAATAGAGG + Intergenic
1129641333 15:77381776-77381798 GTGCTTTGGGGTTGGGGTAGAGG - Intronic
1129895850 15:79105317-79105339 TTGCCTTGGGGCTGCTGTGGTGG + Intergenic
1131131842 15:89905384-89905406 CTGGCTTGAGGCAGGAGGAGAGG - Intronic
1133018532 16:2955805-2955827 CTGCCATGGTGCTGGGGGAGGGG + Intergenic
1135527196 16:23222916-23222938 CTGGCCTGGGGCTGGGGTAGTGG + Intergenic
1136379395 16:29885397-29885419 CTGCCTGGGGGAAGGAGAAGGGG + Intronic
1138715031 16:59010846-59010868 TTGCCTTGGGGCTTGAGTTAAGG + Intergenic
1139429931 16:66905560-66905582 TTGCTTTGGGGCTGGAGCTGGGG + Intergenic
1139577568 16:67851654-67851676 CTGTCCTGGGGCGGGGGTAGCGG - Intronic
1139963691 16:70732934-70732956 CTGCCTTGGGCCGGGTGTGGTGG - Intronic
1140295117 16:73702302-73702324 CTGCCTGGGGGCTGCAGGTGTGG + Intergenic
1140395997 16:74627406-74627428 CTCCCTTAGGGGTGGGGTAGGGG - Intronic
1140401413 16:74674874-74674896 CTGCCTTGGAGCTGGTGAAAAGG + Intronic
1140544042 16:75789146-75789168 CTGCCTTGAGGCAGGCGTGGTGG - Intergenic
1140961116 16:79914122-79914144 CGGCCTGGGAACTGGAGTAGAGG + Intergenic
1141675484 16:85515262-85515284 CTGCCTCCGGGCTGGAGTGCAGG - Intergenic
1141814536 16:86400665-86400687 CTACCTTGGGGCTGGAGGTGAGG - Intergenic
1141996900 16:87641571-87641593 CTTATTTGGGGCTGGAGAAGGGG - Intronic
1142160285 16:88554025-88554047 CTGACTTGAGCCTGGGGTAGGGG + Intergenic
1142258836 16:89032748-89032770 CTGAATTGGGGCTGAAGCAGTGG + Intergenic
1142817187 17:2435754-2435776 GCGGCTTGGGGCTGGGGTAGTGG + Intronic
1143258194 17:5579105-5579127 CTGTCGTGGGGTTGGAGGAGGGG + Intronic
1143405246 17:6673110-6673132 CTACCTGGGGACTGGAGTGGGGG + Intergenic
1143482804 17:7237344-7237366 CTGACTTGAGGCTGGTGTGGTGG - Intronic
1143654899 17:8288517-8288539 CTGCCTTGGGGTTGGACTTAGGG - Exonic
1144176535 17:12713011-12713033 CTGCCATGGGCCTGGGGTTGAGG - Intronic
1144779740 17:17801786-17801808 CTGCCTCCAGGCTGGAGTAGGGG - Intronic
1145907788 17:28525746-28525768 GTGGCTTGGGGCTGGAATGGGGG - Intronic
1146432562 17:32811424-32811446 AAGGATTGGGGCTGGAGTAGCGG - Intronic
1146671449 17:34740869-34740891 CTGCCTTGGGATTGGGGTTGGGG - Intergenic
1146906166 17:36619378-36619400 CTGCCTTGGGCCAGGTGCAGTGG + Intergenic
1147241368 17:39092806-39092828 CTGCCTGGGGGCTGGGGTGCAGG + Intronic
1147391563 17:40112482-40112504 CTGACTTGGGGAAGGAGTTGTGG - Intergenic
1147442162 17:40453916-40453938 GAGCCCTGGGGCTGGAGGAGGGG - Exonic
1147652665 17:42071298-42071320 CTCCCTTGGAGCTGGAGTGTTGG - Intergenic
1147689705 17:42307740-42307762 GGGCCTTGGGGCTGGAGTGTGGG - Intronic
1147989459 17:44324265-44324287 GGGCCTTGGTGCTGGAGTGGGGG - Intronic
1148324174 17:46773642-46773664 CTGCCTTGGGGCTGAGGGGGGGG - Intronic
1148778140 17:50107180-50107202 CTGTCTTGGGGCTGGGGACGTGG + Intronic
1148796054 17:50197278-50197300 CCGCCTAGGGGCTGGAAAAGTGG + Intronic
1149308091 17:55368803-55368825 CTGCCGTGGGGTTGGGGGAGGGG - Intergenic
1149325824 17:55528836-55528858 CTTCCTTGAGGCTGGTGCAGTGG - Intergenic
1149336771 17:55643765-55643787 CTCCCTTGTTGCTGGACTAGGGG - Intergenic
1149932422 17:60769504-60769526 CTCCCCTGGGGCTGGAGGTGGGG - Intronic
1149941392 17:60871414-60871436 CTGCCTTGGGCTGGGATTAGAGG + Intronic
1150332911 17:64308788-64308810 AGGCCAAGGGGCTGGAGTAGAGG - Intergenic
1151536739 17:74743218-74743240 CTACCAAGGGGCTGGGGTAGGGG - Intronic
1151573186 17:74937448-74937470 CTGCTTGGGGGCTGGAGGAGAGG + Intronic
1152279849 17:79378916-79378938 GGGCCCTGGGGCTGGAGCAGAGG - Intronic
1152525795 17:80887600-80887622 CTGCTGTGGGGCTGGGGTTGGGG + Intronic
1152567870 17:81108157-81108179 CTCCCTGGGGGCAGGAGGAGGGG + Intronic
1153691736 18:7601052-7601074 CTGCATTGGGGCTGCAGAAGCGG + Intronic
1154155887 18:11943832-11943854 CTGCCGTGGGGCTGGAGCCCAGG - Intergenic
1154401035 18:14037742-14037764 CTGCCGTGGGGTTGGGGGAGTGG - Intergenic
1156221588 18:35058008-35058030 CTTCTTTGGGGCTGGAGCATGGG + Intronic
1156389079 18:36633986-36634008 CTACCTTGGCGATGGAGTAAGGG + Intronic
1157711313 18:49851693-49851715 ATGGCTTGAGGCTGGAGTGGTGG - Intronic
1160742879 19:695413-695435 CTGCCATGGGGCTCGGGTTGAGG - Exonic
1160761502 19:787726-787748 GGGCCCTGGGGCTGGAGTGGAGG - Intergenic
1160861624 19:1239636-1239658 CAGGTTTGGGGCTGGAGTAATGG + Intergenic
1160865326 19:1253572-1253594 CCGCCCTGGGGCTGGAGTCCCGG - Intronic
1161448270 19:4329822-4329844 CTGCCTTGGGGCTGGGGGTGGGG - Intronic
1161451707 19:4350047-4350069 CTGCCTTTGGGTGGGAGTTGTGG + Intronic
1161627093 19:5333611-5333633 CTGCTTTGTGGCTGGAGGTGAGG - Intronic
1161849409 19:6730936-6730958 CGGCTCTGGGGGTGGAGTAGGGG - Intronic
1162135315 19:8551706-8551728 CTGGCCGGGGACTGGAGTAGAGG + Intronic
1162463398 19:10826596-10826618 CAGCTTTGGGGCCGGAGCAGTGG + Intronic
1162525148 19:11202523-11202545 CTGCCTTGGGGCTGGAGTAGGGG - Intronic
1162732476 19:12727131-12727153 TGGCCTTGGGGGTGGAGTATGGG - Intergenic
1163112634 19:15170640-15170662 CTGCCTTGGGGAGGGGGTGGCGG - Intronic
1163276795 19:16289857-16289879 CTGGGTTGGGGGTGGGGTAGGGG - Intergenic
1163826325 19:19526774-19526796 CTGCGTTGGGGTTGGGGGAGGGG - Intronic
1165081065 19:33306197-33306219 TTGGCTTGTGGCTGGAGAAGTGG + Intergenic
1165157373 19:33796581-33796603 CTGGCTAGGGGCTGGAGTGGGGG + Intronic
1165959287 19:39520877-39520899 GTGACCTGGGGCTGGAGGAGAGG + Intergenic
1166119886 19:40679798-40679820 TTGCCAGGGGGCTGGGGTAGTGG + Intronic
1166757493 19:45202425-45202447 CTGCCATGGGCCTGGAGCAGTGG - Exonic
1166770621 19:45279913-45279935 CTGCCTTAGGGTTGGAGCAGGGG + Intronic
1166782538 19:45350027-45350049 CTGCCCTGGGGATGGAGGACAGG - Exonic
1166809939 19:45508699-45508721 GAGCCTTGGGGTTGGAGGAGGGG + Intronic
1167051488 19:47081671-47081693 CTGCCTTGGGTCTGTGGTGGGGG - Intronic
1167121789 19:47521552-47521574 CTGCATTTGGGCTGGAGCTGAGG + Exonic
1168200161 19:54809184-54809206 ATGCCTGGGGGCTTGAGAAGGGG + Intronic
926231320 2:11006202-11006224 CGGCCTTGAGGCTGGAGGAAGGG + Intergenic
926274129 2:11390760-11390782 GTGACATGGGGCAGGAGTAGGGG + Intergenic
926692611 2:15747900-15747922 ATGCCTTGGGGCGGGGGGAGGGG + Intergenic
927455628 2:23246888-23246910 TGGCATTGGGGCTGGAGTAGGGG - Intergenic
927518831 2:23687356-23687378 CCTCCCTGGGGCTGGAGTGGTGG - Intronic
927577098 2:24208945-24208967 CTACCATGGGACTGGAGCAGAGG + Intronic
927961545 2:27243317-27243339 CTGCCTCGGGGCTGGTGGACGGG + Intronic
928100133 2:28432029-28432051 CTGCCTTGGGGCAGAACTGGTGG + Intergenic
929007977 2:37413930-37413952 TTGTCTTGGGGCTGGAGATGGGG + Intergenic
929234081 2:39588367-39588389 CTGCCATAGGGTTGGAGTCGGGG + Intergenic
929243480 2:39676614-39676636 CAGCCCTGGGGCTGGAGAAAGGG + Intronic
929410589 2:41694202-41694224 CTGAGTTGGGGATGGAGTGGCGG - Intergenic
930210871 2:48635433-48635455 CTGCTTGGGGGGTGGAGCAGAGG + Intronic
930691674 2:54371534-54371556 CTGCCTTTGGTGTGGAGTGGGGG - Intronic
932019626 2:68069729-68069751 CTGTCTTGGGGCGGGGGGAGGGG + Intronic
932454463 2:71838840-71838862 TTGCTTTGGGGGTGGAGGAGGGG + Intergenic
932515611 2:72345074-72345096 CTGCCATGGGACTGGGGTTGAGG + Intronic
933722830 2:85409300-85409322 CTGCCATGGGGCTGGGGGAGGGG + Intronic
935060303 2:99601431-99601453 TTACCTCGGGGCTGGAGAAGTGG + Exonic
936224617 2:110636641-110636663 CTGCCGTGGGGTGGGAGGAGGGG + Intergenic
938077471 2:128347313-128347335 CTGGCTTGGGGCAGGTGGAGAGG - Intergenic
940909358 2:159196589-159196611 CCACCTGGGGGCAGGAGTAGGGG - Exonic
942813369 2:180022773-180022795 CTGGTTTGGGGTTGGAGTGGGGG - Intergenic
944126482 2:196299640-196299662 CAGCCTTGGGCCTGGCGCAGTGG + Intronic
944242510 2:197499889-197499911 GTGCCGCGGGGCGGGAGTAGAGG - Exonic
944842439 2:203637268-203637290 TTGCCTTGGGGATGGTGTCGGGG + Intergenic
946513149 2:220382363-220382385 CTGCCATGGGGTTGGGGGAGTGG - Intergenic
947575034 2:231266611-231266633 TTGCCAGGGGCCTGGAGTAGGGG - Intronic
947915625 2:233830210-233830232 TTGCTTTGGGGCAGGAGGAGAGG + Intronic
948324331 2:237100682-237100704 CTGCCTTGGGGCGGGGATCGGGG + Intergenic
948426082 2:237887215-237887237 CAGCCTGGGGGCTGGAGTGAAGG - Intronic
948761050 2:240191220-240191242 CCGCCTTGGCGCTGGAGCAGTGG + Intergenic
949041474 2:241851807-241851829 CTGCCTGGGGGCTGGGGAGGTGG + Intronic
1169659061 20:7958240-7958262 CTGCAGTGAGGCTGGGGTAGGGG - Intergenic
1170201858 20:13752869-13752891 ATTCCTTGGGCATGGAGTAGGGG - Intronic
1170641256 20:18155371-18155393 CTTCCTAGTGGCTGGAGAAGGGG - Intronic
1171118532 20:22548264-22548286 CTTCCCTGGGGCAGGAGTAAAGG + Intergenic
1172058046 20:32167834-32167856 ATGCCGGGGGGCTGGGGTAGGGG + Intergenic
1172850858 20:37963035-37963057 GTTACTTGGGGCTGGAGAAGGGG - Intergenic
1173648166 20:44646514-44646536 CTTCCTGGGGACTGGAGTGGGGG - Intronic
1173851399 20:46220633-46220655 CTGAGTGGGGGCTGGAGCAGGGG + Intronic
1175062666 20:56257912-56257934 TTGCCTTGGGGCTGGTGTTGAGG - Intergenic
1175521675 20:59605734-59605756 CTGCCATGGGGGTGGAAGAGTGG - Intronic
1175569998 20:60011122-60011144 TGGCCATGGGGCTGGAGGAGAGG + Intronic
1176052914 20:63130058-63130080 ATTCCTTGGGGCTGGAGTGCAGG + Intergenic
1176151978 20:63596075-63596097 CTCCCTTGGGGCTGGGGTAGTGG - Intronic
1179139447 21:38711523-38711545 CAGCTTTGGGGCTGGTTTAGTGG - Intergenic
1179422203 21:41245626-41245648 CTGCCCTGGGGCAGGAGTGCAGG + Intronic
1179477894 21:41659631-41659653 CTGTCTTGGGGCTGAAGTCAAGG - Intergenic
1179597023 21:42449848-42449870 CTGCCTTGGGGGTGGAATGAGGG - Intergenic
1180009789 21:45041664-45041686 GTCCCTTGGGGCTGGGGCAGGGG - Intergenic
1180032547 21:45222285-45222307 ATACCTTGGGGAGGGAGTAGGGG + Exonic
1180765895 22:18345734-18345756 CTGCCTGGGGGTGGGAGGAGAGG - Intergenic
1180780418 22:18516644-18516666 CTGCCTGGGGGTGGGAGGAGAGG + Exonic
1180813134 22:18773965-18773987 CTGCCTGGGGGTGGGAGGAGAGG + Intergenic
1180825501 22:18858224-18858246 CTGCCTTGGGGTTGGACAGGAGG - Intronic
1181167349 22:20990925-20990947 CTGCAATGGGGCTGCAGGAGAGG + Intronic
1181187231 22:21116323-21116345 CTGCCTTGGGGTTGGACAGGAGG + Intergenic
1181199311 22:21208281-21208303 CTGCCTGGGGGTGGGAGGAGAGG + Exonic
1181211967 22:21294170-21294192 CTGCCTTGGGGTTGGACAGGAGG - Intergenic
1181282755 22:21731515-21731537 CTGTCTTGGGGCAAGAGAAGGGG + Intronic
1181397530 22:22632716-22632738 CTGCCTTGGGGGTGGACAGGAGG + Intergenic
1181400450 22:22647576-22647598 CTGCCTGGGGGTGGGAGGAGAGG - Exonic
1181500280 22:23312091-23312113 CTGCCTTGGGGTTGGACAGGAGG + Intronic
1181648918 22:24248215-24248237 CTGCCTGGGGGTGGGAGGAGAGG + Intergenic
1181651876 22:24263342-24263364 CTGCCTTGGGGGTGGACAGGAGG - Intergenic
1181702429 22:24628674-24628696 CTGCCTGGGGGTGGGAGGAGAGG - Exonic
1181705501 22:24647397-24647419 CTGCCTTGGGGGTGGACAGGAGG + Intergenic
1183945841 22:41325243-41325265 CTGGGTTGGGGCTGGAGCTGGGG + Intronic
1184479740 22:44739307-44739329 CTGCCCTGGGGCAGGAGGGGAGG + Intronic
1184538738 22:45105795-45105817 TTTGCTTGGGGCTGGAGTGGAGG + Intergenic
1185137988 22:49084195-49084217 CTGCCTGGGGGATGGAGAAGAGG - Intergenic
1185220740 22:49628004-49628026 CTGCCTGGGGCCTGGAGTCATGG - Intronic
1185253072 22:49815878-49815900 CTGCATCGGGTCTGGAGTGGCGG - Intronic
1203214987 22_KI270731v1_random:1262-1284 CTGCCTTGGGGTTGGACAGGAGG + Intergenic
1203227514 22_KI270731v1_random:86625-86647 CTGCCTGGGGGTGGGAGGAGAGG - Intergenic
1203275649 22_KI270734v1_random:84127-84149 CTGCCTTGGGGGTGGACAGGAGG - Intergenic
949437937 3:4049610-4049632 CTGCCCTGGGGCTGGAGCCCAGG - Intronic
951886278 3:27527706-27527728 CTGCCTGGGCTCTGGATTAGAGG - Intergenic
951897269 3:27622079-27622101 CTTCCTTGGAGCTAGAGCAGTGG - Intergenic
952237134 3:31491825-31491847 CCGCCTCTGGGCTGTAGTAGAGG - Intergenic
952369330 3:32705372-32705394 CTGGCTTGGGGCTTGAATTGGGG + Intronic
952520259 3:34149837-34149859 CTGAAGTGGGGCGGGAGTAGAGG + Intergenic
952825854 3:37524212-37524234 TTGCCTGGGTGGTGGAGTAGTGG + Intronic
953061274 3:39430266-39430288 GAGCCTTGGAGCTGGAGGAGAGG + Intergenic
953874941 3:46661321-46661343 CTGTGTTGGGGGTGGAGTGGGGG - Intergenic
953975385 3:47378231-47378253 CTCCCTAGTGGCTGGAGTACAGG - Intergenic
954363283 3:50133621-50133643 CTGCCTCCTGGCTGGAGAAGAGG + Intergenic
954363415 3:50134193-50134215 CTGCCTTGGGCAAGGAGGAGTGG - Intergenic
954653149 3:52177536-52177558 CTGCCCTTGGGCTAGAGTAGAGG + Intergenic
954715843 3:52526382-52526404 AGGCCTTGGGGCTGGAGGAGGGG - Intronic
954962116 3:54575871-54575893 CTTCTTAGGGGCTGGGGTAGGGG - Intronic
958443166 3:94180842-94180864 CTGTCTTGGGGTGGGAGGAGGGG - Intergenic
960175978 3:114518137-114518159 CTGCTTTAGGGCTGGGGTATGGG + Intronic
961507958 3:127383862-127383884 CTGCCTCCAGGCTGGAGCAGCGG - Intergenic
961630562 3:128295617-128295639 CTTCCTTGGGGCTGGAACTGTGG + Intronic
962434066 3:135348143-135348165 CTGCCTTGGGGGTGGACTGAAGG + Intergenic
962856213 3:139347361-139347383 CTGCCTTGGGGCTGAAGCTTTGG + Intronic
963102890 3:141622978-141623000 CTGCCCTGGGGCTGGAGCCCAGG + Intergenic
966378853 3:179323442-179323464 CTGCCTTCGGGATGGGGGAGGGG - Intronic
967854260 3:194104556-194104578 CTCCCCTGGGGCTGCAGTGGAGG - Intergenic
968151241 3:196338336-196338358 CAGCCCTGGAGCTGGAGGAGTGG - Exonic
968187512 3:196643448-196643470 TTGGGTTGGGGCTGGAGGAGGGG - Intronic
968385687 4:135200-135222 CTGTCTCCAGGCTGGAGTAGTGG - Intronic
969213299 4:5704431-5704453 CTGCCTTGGTGCATGAGTTGTGG + Intronic
969319903 4:6405470-6405492 CTGCCTTTGAGCTGGAAGAGAGG - Intronic
969519920 4:7670740-7670762 CTGCCATGGGGCCGGGGTGGGGG - Intronic
969870410 4:10101105-10101127 CTGCCTTGGCGCTGGGGCCGTGG - Intronic
973903038 4:55497245-55497267 CTGGCTTGAAGATGGAGTAGAGG - Intronic
974671702 4:65038415-65038437 CTGCCTTGGGGTTGGGGGAGGGG + Intergenic
974674900 4:65076715-65076737 CTGCCTATGGGGTGGAGAAGGGG - Intergenic
975348395 4:73319830-73319852 CAGCAGTGGGGCTGGGGTAGGGG + Intergenic
975488318 4:74960030-74960052 CTGCCATGGGGCTGGAAAATGGG - Intronic
976652358 4:87449649-87449671 CTACCTTGGGCTTGGAGTGGAGG - Intronic
977642281 4:99370475-99370497 CTGCTTTTGAGCTGAAGTAGAGG - Intergenic
981250809 4:142598565-142598587 CTTCCTGTGGGCTGGAGTACTGG - Intronic
982402018 4:154978699-154978721 CTGTCATGGGGCTGGGGGAGGGG - Intergenic
984149026 4:176102866-176102888 CTGCCCTGGGGCTTGAGGTGAGG - Intronic
984603609 4:181757991-181758013 GTGGCTTAGGGCTGGAGAAGGGG - Intergenic
985941254 5:3138294-3138316 CTTCCTTGGGGCTGGGGCTGGGG - Intergenic
986018019 5:3775017-3775039 CTGCCATGGGGCAGGATCAGTGG - Intergenic
986152383 5:5139918-5139940 CTGCCTTGGGGCTGGGGACTCGG - Intergenic
986898248 5:12397367-12397389 CTGTCTTGGGGCAGGGGGAGCGG + Intergenic
990761677 5:59137033-59137055 CTGCCTTGGGGCTGCTGCAGAGG + Intronic
990870842 5:60430374-60430396 AGGCCAAGGGGCTGGAGTAGAGG - Intronic
990872307 5:60445626-60445648 CTGCCCAGGGGCTGGGGAAGGGG + Intronic
992091843 5:73324480-73324502 CTGCCCTGGAGCTGCAGGAGAGG + Intergenic
992958308 5:81933182-81933204 CTGTCTTGGGGTGGGCGTAGGGG - Intergenic
993001669 5:82387327-82387349 ATGCCTTGGGGGTGGGGTGGGGG + Intergenic
993372151 5:87105975-87105997 CTGTCATGGGGCTGGGGGAGGGG + Intergenic
995412524 5:111874639-111874661 ATTGCTTGGGGCTGGAGTAGAGG + Intronic
996601855 5:125273528-125273550 CTGCTTTGGGGCAGGAGTTCAGG - Intergenic
996669502 5:126100707-126100729 CTGCCATGGGGCCGGAGTCCAGG - Intergenic
996738490 5:126777943-126777965 CTGCCGTGGGGAGGGAGCAGAGG + Intronic
998157345 5:139794681-139794703 CCCCCCAGGGGCTGGAGTAGGGG + Intergenic
998287932 5:140882361-140882383 CTTCCTCGGGGACGGAGTAGTGG - Exonic
998806491 5:145922143-145922165 AGGCTTTGGGGCTGGAGTATGGG - Intergenic
999622855 5:153490302-153490324 CAGCCTGGGGGCTGGGGGAGCGG + Intronic
999657265 5:153822740-153822762 CCTCCTAGGGGCTGGAGCAGGGG + Intergenic
1000017954 5:157294912-157294934 CTGGTTTGGGGATGAAGTAGGGG - Intronic
1000353963 5:160375427-160375449 CAGGCTGGGGGCTGGGGTAGAGG - Intergenic
1001029338 5:168250491-168250513 CTGCCTTGGGGATGGACAAGTGG - Intronic
1001532017 5:172469920-172469942 CTGCCCTGGTGGTGCAGTAGGGG + Intergenic
1002457991 5:179356554-179356576 CTGCAGAGGGGCTGGAGAAGCGG - Intergenic
1002902691 6:1423419-1423441 CTGCCTTGGGGCAGGACTGTAGG - Intergenic
1003298999 6:4859827-4859849 CTGCCTCGTGGCTAGACTAGTGG + Intronic
1003708475 6:8562110-8562132 CACCCATGTGGCTGGAGTAGAGG - Intergenic
1003718189 6:8670691-8670713 TGGCCTTGGGGCTGGAGAATTGG + Intergenic
1004727459 6:18325194-18325216 CTGGCCTGGGGATGGAATAGAGG + Intergenic
1004784977 6:18958111-18958133 CTGCCTTGGGGCTGAAATGGTGG + Intergenic
1004854783 6:19738044-19738066 GTGGTTTGGGGCTGAAGTAGAGG - Intergenic
1006448459 6:34092625-34092647 CATCCTTGGGGTTGGAGTGGGGG - Intronic
1007387967 6:41532090-41532112 CTGCCGTGGGGCTGCCGGAGGGG + Intergenic
1009226118 6:61021527-61021549 CTGTTTTGGGGTGGGAGTAGGGG - Intergenic
1010688490 6:78879194-78879216 CTGTCTTGGGGTGGGGGTAGGGG + Intronic
1011112592 6:83854190-83854212 CCTCCCTGGGGCTGGAGGAGCGG - Intronic
1011745779 6:90406658-90406680 CTTCCCTGGGGCTGGAGTCCTGG + Intergenic
1013178505 6:107698480-107698502 ATGCCTTGGGGATGGAGACGGGG - Intergenic
1015874433 6:137808807-137808829 CTGCCGTGGGGCTGTCGTGGGGG - Intergenic
1017529586 6:155275498-155275520 CTGCTTGGGGGCTGGAGAAGGGG + Intronic
1017760352 6:157563317-157563339 CTGGCTTGGAGCTGGGGAAGAGG - Intronic
1019862073 7:3668486-3668508 TTGCCTTGGGCCTGGTGCAGTGG + Intronic
1021420224 7:20438695-20438717 CTGTGTTGTGGCTGGAGTAGGGG - Intergenic
1021861717 7:24912619-24912641 CTGCCTTGGGTCTGGAGACTGGG - Intronic
1023117526 7:36876767-36876789 CTGCTTTGGGGCAGGAGTTAGGG - Intronic
1023296655 7:38721842-38721864 CTCCCATGGGACTGGAGAAGGGG + Intergenic
1023362401 7:39430322-39430344 CTGCCTTGGAGGTGGAGGTGGGG - Intronic
1023640431 7:42251450-42251472 CTGCTGTGCAGCTGGAGTAGGGG + Intergenic
1023852410 7:44157801-44157823 CTGCACTGAGGCTGGAGCAGAGG + Intronic
1024177325 7:46854292-46854314 CTGCCTGGGGCCTGGGGCAGAGG - Intergenic
1024581915 7:50807470-50807492 CTGCCCTGGGGCTGGGGCTGGGG + Intergenic
1024637966 7:51306032-51306054 CTGTCTTGGGGCGGGGGTGGGGG + Intronic
1025060000 7:55797952-55797974 GTGGCTTGGGCCTGGAGAAGGGG - Intronic
1025100442 7:56130434-56130456 CTGGCTTTGGGCTGCAGTTGAGG - Intergenic
1025147791 7:56519950-56519972 CTGGCTTTGGGCTGCAGTTGAGG - Intergenic
1026117218 7:67506081-67506103 CTGCCTGGGGGCAGGTGTGGTGG + Intergenic
1026197220 7:68183640-68183662 CTGCCTTGAAGCTGGAATGGTGG - Intergenic
1026318607 7:69249371-69249393 CTGGCTTTGGGCTGCAGTTGAGG + Intergenic
1027129831 7:75582972-75582994 CTGGAGTGGGGATGGAGTAGAGG - Intronic
1027267837 7:76503903-76503925 CTGCGGAGGGGCTGGAGAAGCGG + Intronic
1027319648 7:77003765-77003787 CTGCGGAGGGGCTGGAGAAGCGG + Intergenic
1028556748 7:92133999-92134021 CGCGCTGGGGGCTGGAGTAGTGG - Intronic
1029344814 7:99970885-99970907 CTGCCTTGGGGCTGGCAGTGTGG + Intronic
1029346766 7:99984242-99984264 CTGCCTTGGGGCTGGCAGTGTGG - Intergenic
1029558449 7:101286623-101286645 CTGCCTTGGGGCTGGCAGTGTGG + Intergenic
1029710392 7:102296035-102296057 CTGCCTTGGTACTGGGGGAGGGG - Intronic
1032081043 7:128858645-128858667 CTGCCTTGGGGGTGAAGTGAAGG + Exonic
1032091206 7:128912512-128912534 CTGCCTTGGGGGTGAAGTGAAGG - Intergenic
1032335131 7:131018065-131018087 ATGACCAGGGGCTGGAGTAGAGG - Intergenic
1033815558 7:145068674-145068696 CTGCCTTGGGGTTGGGGGAAGGG - Intergenic
1034950442 7:155293059-155293081 CAGCCCTGAGGCTGGAGCAGAGG - Intergenic
1035187674 7:157139081-157139103 CTGCCCTGGGGCGGGAGGGGCGG - Exonic
1035215202 7:157360845-157360867 CTTCCTTGGTGCTGAAGTACTGG + Intronic
1035468354 7:159094151-159094173 CTCCCATGGGGATGGAGCAGAGG - Intronic
1035616113 8:1003080-1003102 CTGCATTTGGGATGGAGCAGGGG - Intergenic
1036165221 8:6426350-6426372 CTGCCCTGGGGTGGGAGGAGGGG - Intronic
1036407445 8:8467967-8467989 CTTCCCTGGGGCTGGAGCTGAGG + Intergenic
1037214647 8:16434094-16434116 TTGCTGTGTGGCTGGAGTAGAGG - Intronic
1038093575 8:24282461-24282483 CTGCCTTTGGGTTGAAGGAGTGG + Intergenic
1038617919 8:29112600-29112622 CTTCCTCGGGGTTGGAGAAGTGG - Intronic
1040023451 8:42761090-42761112 CAGCAGTGGGGATGGAGTAGGGG - Intronic
1040637185 8:49288753-49288775 CAGCCATGGGGCTGGGATAGAGG + Intergenic
1040923172 8:52647423-52647445 CTCCTTTGGGGCTGAAGAAGAGG + Intronic
1041056312 8:53990086-53990108 CTACTTGGGGGCTGAAGTAGGGG + Intronic
1041180050 8:55237886-55237908 CTACCCTGGGGATGGAGGAGGGG - Intronic
1041480615 8:58316024-58316046 CTGCCTTGCCGCTGCAGTGGAGG - Intergenic
1042010297 8:64236691-64236713 CTGTCTTGGGGTGGGAGGAGGGG + Intergenic
1043472694 8:80578337-80578359 CTGCCTGGGGGAGGGAGTCGCGG - Intergenic
1044808508 8:96033278-96033300 CTGTCATGGGGTTGGAGGAGCGG - Intergenic
1047288247 8:123506657-123506679 CTGCCTTGAGGGTGGAGGACGGG - Intronic
1047353044 8:124094320-124094342 CAGTCTTGGTCCTGGAGTAGGGG - Intronic
1048472645 8:134717320-134717342 CAGCCTTGGGCCTGGACTGGTGG - Intergenic
1049131561 8:140849242-140849264 CTGCTTTGGGGCTTGAGGGGAGG - Intronic
1049433529 8:142576036-142576058 CAGCCATGGGGCGGGGGTAGGGG - Intergenic
1049508470 8:143016029-143016051 CTGCCTTGGGGCAGGTGAAAGGG - Intergenic
1049583843 8:143424087-143424109 CTACCTTGGGCCTGGAGGAAGGG - Intronic
1049673665 8:143880391-143880413 AGGCCTGGGGGCTGGAGGAGTGG - Intergenic
1057130048 9:92648747-92648769 CTGCCTTAGAGTTGGAGGAGGGG + Intronic
1057310770 9:93941718-93941740 CTACTCTGGGGCTGGAGGAGGGG - Intergenic
1057705608 9:97392936-97392958 CTCCCTGGGGGCTGGTGGAGGGG - Intergenic
1058910808 9:109518380-109518402 CTGCACTGGAGGTGGAGTAGAGG + Intergenic
1059130204 9:111740097-111740119 CTACCTTGGAGCTGGAAGAGAGG - Intronic
1059157252 9:112001191-112001213 CGGCCTTGGTGCAGGAGAAGGGG + Intergenic
1059816755 9:117925016-117925038 GTGCCTTTGGCCTTGAGTAGGGG - Intergenic
1060528616 9:124334571-124334593 CTGCCTTGGAGCTCCAGCAGAGG + Intronic
1061158853 9:128881985-128882007 CTGCTTCGGGGCGGAAGTAGCGG - Exonic
1061235721 9:129341589-129341611 CTCCCCTGGGGCTGGAGGCGGGG - Intergenic
1061238029 9:129353245-129353267 CGGGCTGGGGGCTGGAGTGGAGG + Intergenic
1061450525 9:130664815-130664837 CTGTCTTGGGGCTGGCGTGGTGG - Exonic
1062444364 9:136587515-136587537 CTGCCTGGAGGCTGGGGTGGAGG - Intergenic
1185532167 X:830683-830705 CTGCCTTGAGGTTGGAGGAAGGG - Intergenic
1187845678 X:23533745-23533767 CTGCCGTGGGGTTGGGGGAGGGG + Intergenic
1188078646 X:25808626-25808648 CTGCCATGGGGCTGGGGGAGGGG + Intergenic
1188999059 X:36923288-36923310 TTGCCATGGGCCTGGAGCAGTGG - Intergenic
1189234737 X:39478278-39478300 CTCACTTGGGACTGGAGTTGTGG - Intergenic
1190687388 X:52887353-52887375 CTGCCCTAGGGCTGGTCTAGAGG + Intergenic
1190698594 X:52968439-52968461 CTGCCCTAGGGCTGGTCTAGAGG - Intronic
1191729951 X:64322863-64322885 TTGCCTTTGTGCTGGAGCAGTGG - Intronic
1191934737 X:66414625-66414647 TTGGCTAGGGGCTGGAGTATGGG - Intergenic
1192237200 X:69303489-69303511 TTGCCCTGGGACTAGAGTAGAGG - Intergenic
1192491572 X:71580132-71580154 CTTCCTTGGGGCAGGAGTAGGGG + Intronic
1192788372 X:74355429-74355451 CTGACCTGGTGCTGGAGTGGTGG - Intergenic
1193808818 X:86026416-86026438 CTGCCTTGGGCCAGGTGTGGTGG - Intronic
1194699251 X:97093393-97093415 CTGTCTTCGGCCTGGAGTTGGGG + Intronic
1195673833 X:107491671-107491693 CTGGATAGGGGCTGGAGTGGCGG + Intergenic
1196871188 X:120115333-120115355 CTGCCTTTGTGCTGGTGTGGAGG - Intronic
1198383343 X:136104800-136104822 CTGACTTGGGGGTGGAGTGGGGG + Intergenic
1199691655 X:150313299-150313321 CTGCCATGGTGCTGGTGTGGTGG + Intergenic
1199716211 X:150508827-150508849 CTGCCTTGGTGGTTGAGAAGGGG + Intronic
1200121476 X:153793133-153793155 GTGCGTTGGGGTGGGAGTAGGGG - Intronic
1200208380 X:154333816-154333838 CTGCCTTTGGGCTGGAGTGCAGG - Intergenic