ID: 1162525153

View in Genome Browser
Species Human (GRCh38)
Location 19:11202536-11202558
Sequence ACGGGGCATGGGGCTGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162525153_1162525161 -4 Left 1162525153 19:11202536-11202558 CCCAAGGCAGCCCCATGCCCCGT 0: 1
1: 0
2: 0
3: 18
4: 238
Right 1162525161 19:11202555-11202577 CCGTTCCACCCCCAACCACAAGG 0: 1
1: 0
2: 2
3: 9
4: 151
1162525153_1162525168 12 Left 1162525153 19:11202536-11202558 CCCAAGGCAGCCCCATGCCCCGT 0: 1
1: 0
2: 0
3: 18
4: 238
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162525153 Original CRISPR ACGGGGCATGGGGCTGCCTT GGG (reversed) Intronic
900189638 1:1347938-1347960 ACTGGACCTGGGGCTGCCTGAGG + Intronic
900896537 1:5486887-5486909 TGTAGGCATGGGGCTGCCTTTGG - Intergenic
901638913 1:10683422-10683444 AGAGGTGATGGGGCTGCCTTGGG - Intronic
902585316 1:17435561-17435583 AAGGGGCAGAGGGCTGCCCTAGG + Intronic
903320117 1:22538146-22538168 GCCTGGCATGGGGCTGCCATGGG + Intergenic
903415965 1:23183311-23183333 ACAGGGTAAGGGGCTGCCCTGGG - Intergenic
905025627 1:34847454-34847476 AGGGGGCATGGGGCCGCCACAGG + Intronic
907302720 1:53498647-53498669 ACGGGGCCTGGGGTTTCCTGGGG - Intergenic
911156194 1:94639319-94639341 AGAGGGCATGGGGGAGCCTTCGG + Intergenic
912643366 1:111368768-111368790 ATAGGTCATGGGGGTGCCTTGGG - Intergenic
912659404 1:111515002-111515024 GCTGGGCATGGGACTGCCTGAGG - Intronic
913196552 1:116461028-116461050 TCAGGGCAAGGGGCTCCCTTTGG + Intergenic
913958370 1:143322222-143322244 ACAGGGCCAGGGGCTGCGTTAGG + Intergenic
914052685 1:144147597-144147619 ACAGGGCCAGGGGCTGCGTTAGG + Intergenic
914126512 1:144818944-144818966 ACAGGGCCAGGGGCTGCGTTAGG - Intergenic
914921056 1:151847704-151847726 ACGGGGCCTGGGGCTGGGCTGGG + Intronic
916416884 1:164600630-164600652 AACAGGCATGGGGCTGCCTCAGG - Intronic
916575639 1:166064118-166064140 ATGGGGAATGGGGCTGCCTCGGG + Intronic
918422343 1:184376813-184376835 ACAGGGCCTGGCACTGCCTTGGG + Intergenic
919224832 1:194683411-194683433 ACGTGTCATGGGGCAGACTTTGG + Intergenic
921055402 1:211538943-211538965 ACTGGGCATGGTGCTGCGGTAGG + Intergenic
921070968 1:211657085-211657107 ACATGCCATGGGGCTGCCATGGG - Intergenic
923825548 1:237495757-237495779 ATGGGGCATGGGGCTGAGGTAGG - Intronic
924855110 1:247868138-247868160 ACTGGGAATGAGGCTGCCTGGGG + Intronic
1062969137 10:1632830-1632852 ACTGGGCTTGGGGCTGCCCAGGG + Intronic
1063127589 10:3149292-3149314 GTGTGGCCTGGGGCTGCCTTAGG - Intronic
1064143227 10:12807484-12807506 ACCAGGGATGGGGCTGCCTCAGG + Intronic
1065044527 10:21735431-21735453 ACGTGGCATGGTGCTGCCATAGG + Intronic
1066759297 10:38738345-38738367 ACAGGGCCAGGGGCTGCGTTAGG - Intergenic
1070722782 10:78768251-78768273 AGGGAGCAGGGGGCTGCTTTGGG - Intergenic
1071827657 10:89341183-89341205 ACTGGGCATGGGGCTTAGTTGGG - Intronic
1073254131 10:102140247-102140269 AACTGGCATGGGGCTGGCTTGGG - Exonic
1075781301 10:125018886-125018908 ATGGGACATGGGGCAGCCTGTGG - Intronic
1076500539 10:130932984-130933006 ATGCGGCACGGGGCTGCCTGGGG + Intergenic
1076808748 10:132875559-132875581 CCTGTGCATGGGGCTGCTTTGGG - Intronic
1076884271 10:133254469-133254491 CCGGGGCTGGGGGCTGCCTATGG - Intergenic
1077268902 11:1666019-1666041 ATGGGGCCTGCGGCTGCCATGGG - Intergenic
1077271850 11:1685161-1685183 ATGGGGCCTGCGGCTGCCATGGG + Intergenic
1081436600 11:43034006-43034028 ACAGGGCAGGGGGCTGCATGAGG + Intergenic
1081747555 11:45483612-45483634 AAGGAGGCTGGGGCTGCCTTGGG + Intergenic
1081762364 11:45585206-45585228 ACGAGGCAGGGGGCTGCCTCTGG - Intergenic
1083557924 11:63646999-63647021 ACGGGGCACACCGCTGCCTTAGG + Intronic
1083880197 11:65544625-65544647 CCAGGGCATGGGGCTGCCTAGGG - Intronic
1084949609 11:72657444-72657466 CCGGGGCATGGGGCTGCATCTGG - Intronic
1084957322 11:72698226-72698248 ACTGGGCTTGGTTCTGCCTTGGG - Intronic
1085053337 11:73390823-73390845 AACGGGCATGGGGCTGGCATGGG - Exonic
1085203263 11:74714500-74714522 ATGGGGCAAGAGGCTGCCTCTGG - Intronic
1085303206 11:75470897-75470919 AAGGGGGAAAGGGCTGCCTTGGG - Intronic
1085725889 11:78954199-78954221 AGAGGGCAGGGGGCTGCCTGGGG + Intronic
1086953735 11:92915506-92915528 AGGGGGCATCGGACTGACTTTGG - Intergenic
1088490274 11:110380036-110380058 ATGGGGCATGTGGCTGTCTGGGG + Intergenic
1088590215 11:111396374-111396396 AAGGGAAATGGGGCTGACTTGGG - Intronic
1089572216 11:119418391-119418413 GCGGGGCAGGGGGCTGTCTGAGG + Exonic
1089830114 11:121320003-121320025 ATGGGGCATGGGTCTTCCTGGGG - Intergenic
1090026049 11:123168492-123168514 ACGGGGAATGAGGAAGCCTTGGG + Intronic
1090868145 11:130720385-130720407 CCGGGGCTCGGGGCTGCCCTGGG + Intergenic
1090881032 11:130831509-130831531 ACTGGGCATGGGCCAGCCTCTGG - Intergenic
1092142491 12:6193540-6193562 ACAGGGCAGGGGGCTGGCTGAGG + Intergenic
1092330665 12:7583985-7584007 TCTGGCCATGGGGCTCCCTTGGG - Intergenic
1095954619 12:47798956-47798978 ACAGGGCCTGGGGCAGCCTAGGG + Exonic
1096477655 12:51918096-51918118 ATGGGGCACGGGGCTGTCTGCGG + Intronic
1097731573 12:63134137-63134159 ACGGGGCAAGGTTCTGCATTAGG - Intergenic
1098066813 12:66627613-66627635 AAATGGCATGGGGCTGACTTGGG - Intronic
1101414806 12:104499743-104499765 TCTGGGCCTGGGGCTGCCTCCGG + Intronic
1102059662 12:109923081-109923103 ACTGGCCATGGCTCTGCCTTTGG + Intronic
1102817496 12:115879584-115879606 CCGGGGCCTGGGCCTGCCTGGGG + Intergenic
1104226290 12:126837805-126837827 TCAGGCCATGGGGCTCCCTTTGG + Intergenic
1104973547 12:132542059-132542081 ACGTGGCATGTGGGTGCCTCAGG - Intronic
1107479124 13:40770956-40770978 ACGGGGCACGGGGTTGCCTGAGG + Intronic
1108622013 13:52194198-52194220 ACGGGGCACGGGGATGCCCGAGG + Intergenic
1111213226 13:85108451-85108473 ACTGGGCATGGTGCTTCCTGTGG - Intergenic
1112435818 13:99390603-99390625 ACTGGGCCTGGGTCTGTCTTTGG - Intergenic
1113924325 13:113931927-113931949 ACGGGGCAGGGGCCAGCCTGGGG - Intergenic
1115649799 14:35394863-35394885 ACGTGGCAAGGTCCTGCCTTGGG + Intergenic
1115757393 14:36543162-36543184 ACGGTGAATGGGGCAGCCTAGGG - Intergenic
1118810634 14:69270772-69270794 GCGGGGCATGTGGCAGGCTTGGG + Intronic
1119436160 14:74599334-74599356 ACAGGGGCTGGGGCTGCTTTGGG - Intronic
1119858410 14:77918481-77918503 ACAGGGCATGGGGCAGTGTTAGG + Intronic
1121215525 14:92244727-92244749 CTAGGGAATGGGGCTGCCTTGGG - Intergenic
1121762238 14:96455607-96455629 ACAGGGCATTGTGCTACCTTTGG - Intronic
1122384352 14:101333812-101333834 GCCGGGCATGGTGCTGACTTGGG - Intergenic
1122906873 14:104805630-104805652 AGGGCGCATGGGGCTTCCTGGGG + Intergenic
1123039159 14:105483372-105483394 ACCTGGCATGGGGCTGGCATGGG - Intergenic
1123065886 14:105618998-105619020 ACGGGGCAGGGGTCGGCCTAGGG - Intergenic
1123070043 14:105638244-105638266 ACGGGGCAGGGGTCGGCCTAGGG - Intergenic
1123074635 14:105661906-105661928 ACGGGGCAGGGGTCGGCCTAGGG - Intergenic
1123089282 14:105735031-105735053 ACGGGGCAGGGGTCGGCCTAGGG - Intergenic
1123095069 14:105763188-105763210 ACGGGGCAGGGGTCGGCCTAGGG - Intergenic
1123422263 15:20143270-20143292 ACAGGGCCAGGGGCTGCGTTAGG + Intergenic
1123442737 15:20303071-20303093 ACAGGGCCAGGGGCTGCGTTAGG - Intergenic
1123531491 15:21149810-21149832 ACAGGGCCAGGGGCTGCGTTAGG + Intergenic
1123763035 15:23447045-23447067 AGGGGGCCTGGGGCTGGGTTGGG + Intronic
1123995188 15:25713292-25713314 ACAGTTTATGGGGCTGCCTTGGG - Intronic
1128244405 15:66123367-66123389 TCAGGGCAGGGGGCTGTCTTAGG + Intronic
1128563178 15:68682034-68682056 ACGGGGCATGGGACTGGGTTTGG - Intronic
1128766097 15:70252123-70252145 AGGAGGCATGGTTCTGCCTTGGG + Intergenic
1128785230 15:70391394-70391416 AAGGGGCATGGGGAAGCTTTGGG + Intergenic
1129252920 15:74318623-74318645 ATGAGGCCTGGGGCAGCCTTGGG - Intronic
1131171224 15:90179654-90179676 GAGGGGCATGGGGATGCCTCAGG + Intronic
1131718053 15:95135105-95135127 GGTGGGCCTGGGGCTGCCTTTGG - Intergenic
1132636431 16:952108-952130 AGGAGGCCTGGGGATGCCTTGGG - Intronic
1132873272 16:2124876-2124898 AGGGGGCATGGGGCCTCCCTGGG - Intronic
1133149810 16:3819099-3819121 AAGAGGCATTGGGCTGCCTTTGG - Intronic
1133368821 16:5232627-5232649 ACGGGGCCTAGGGCAGCCATAGG - Intergenic
1134217361 16:12326601-12326623 ACGGGCACTGGGGCTGGCTTTGG + Intronic
1134552359 16:15144055-15144077 AGGGGGCATGGGGCCTCCCTGGG - Intergenic
1136454376 16:30372026-30372048 ACAGGACATGGGGCTGAGTTGGG - Intronic
1136707425 16:32201578-32201600 ACTGGGCATGAGGAGGCCTTGGG + Intergenic
1136760487 16:32727839-32727861 ACTGGGCATGAGGAGGCCTTGGG - Intergenic
1136773444 16:32859495-32859517 ACAGGGCCAGGGGCTGCGTTAGG - Intergenic
1136807616 16:33142547-33142569 ACTGGGCATGAGGAGGCCTTGGG + Intergenic
1136897168 16:34002024-34002046 ACAGGGCCAGGGGCTGCGTTAGG + Intergenic
1137505834 16:49052980-49053002 TCGGGGCAAGGGCCTGCTTTAGG - Intergenic
1138111654 16:54329087-54329109 GCTGGCCATGGGACTGCCTTTGG - Intergenic
1139171627 16:64637418-64637440 ATGGGGAATGGGGCAGCCTTGGG + Intergenic
1141099300 16:81185402-81185424 ACTGAGGCTGGGGCTGCCTTGGG - Intergenic
1141767488 16:86068091-86068113 TCGGGGCCTGGAGCTGCCCTGGG + Intergenic
1142174155 16:88637263-88637285 GCGGGGCCGGGAGCTGCCTTTGG - Intergenic
1142245406 16:88968055-88968077 ACGGGTCATGGGGCTGAGTTGGG + Intronic
1142306203 16:89287297-89287319 AGGGCCCATGGGGCTGCCCTGGG + Intronic
1203062640 16_KI270728v1_random:988154-988176 ACTGGGCATGAGGAGGCCTTGGG - Intergenic
1203075860 16_KI270728v1_random:1121605-1121627 ACAGGGCCAGGGGCTGCATTAGG - Intergenic
1142626465 17:1195452-1195474 GCAGGGCTGGGGGCTGCCTTTGG - Intronic
1143106475 17:4532905-4532927 CCAGTGCATGGGGCTGCCTAGGG + Intronic
1143387979 17:6543418-6543440 CCTGGGGCTGGGGCTGCCTTGGG - Intronic
1143919614 17:10320572-10320594 ACGTGGCCTGGGGCTTCCTGGGG + Intronic
1143958875 17:10697743-10697765 GCCGGGAAGGGGGCTGCCTTAGG + Intronic
1144057278 17:11554428-11554450 CCGGTGCTTGGGGCTGCCCTTGG + Intronic
1144826424 17:18108082-18108104 ACAAGGCCTGGGTCTGCCTTGGG - Intergenic
1146994115 17:37303118-37303140 ACTGGGCATGGGGTTTCTTTTGG - Intronic
1148213484 17:45821723-45821745 ACTGGGCATGGGACTGTCCTGGG + Intronic
1149446196 17:56715082-56715104 AGGAGGCATGGGAATGCCTTAGG - Intergenic
1151497329 17:74466697-74466719 AGGGACCATGTGGCTGCCTTGGG + Exonic
1151696839 17:75722179-75722201 AAGGCGCCTGGGGCTGACTTTGG - Intronic
1152143304 17:78551478-78551500 TGGGGGCCTGGGGCTGCCCTGGG - Intronic
1153688247 18:7567386-7567408 GCTGGGCTTGGGGCTGCCTGTGG + Exonic
1153777298 18:8465318-8465340 AAGGGGCATGAGGCAGCTTTTGG + Intergenic
1155249857 18:23944220-23944242 AAGGGGCATGAGGCAGCCTGGGG - Intronic
1155267056 18:24104370-24104392 ACAGGGCACAGGGCTGCCTCGGG + Intronic
1159447915 18:68563007-68563029 ATGGTGAATGTGGCTGCCTTGGG + Intergenic
1160420014 18:78737553-78737575 ACGTGGCGTGGGGCTGCCGTGGG + Intergenic
1160975631 19:1790925-1790947 GTGGGGCATGTGGCTGCCATTGG - Intronic
1161124838 19:2550056-2550078 AAGGGAAATGTGGCTGCCTTGGG + Intronic
1161404702 19:4084754-4084776 TCGGGAGGTGGGGCTGCCTTGGG + Intergenic
1161778433 19:6276565-6276587 ACGGGGACTGGGGCTGCCTAGGG - Intronic
1162525153 19:11202536-11202558 ACGGGGCATGGGGCTGCCTTGGG - Intronic
1163008939 19:14412853-14412875 GCGGGGCCTGTGGCTGCCCTCGG - Intronic
1163497413 19:17654971-17654993 ACGGGCCATGGGGATACCCTGGG + Intronic
1163541264 19:17912173-17912195 ACAGGGCATGGGGCTGGGTGTGG - Intergenic
1164576336 19:29407457-29407479 CAGGGCCATGGGGCTGCCTGGGG - Intergenic
1167631302 19:50627868-50627890 CCCTGGCATGGGGCTGCCATGGG + Intronic
1168679260 19:58301674-58301696 AGGGGGCATGGGGTTGGCTGAGG + Exonic
1202692082 1_KI270712v1_random:100021-100043 ACAGGGCCAGGGGCTGCGTTAGG + Intergenic
927480670 2:23451544-23451566 TGGGGCCATGAGGCTGCCTTGGG - Intronic
932298875 2:70649690-70649712 AAGGGGCACGGGGAAGCCTTTGG - Intronic
933954316 2:87353951-87353973 ACAGGGCCAGGGGCTGCGTTAGG - Intergenic
934238513 2:90250171-90250193 ACAGGGCCAGGGGCTGCGTTAGG - Intergenic
936449764 2:112625467-112625489 AGGGGGAATGGGGCTCCCTCAGG - Intergenic
936855571 2:116953473-116953495 AATGGGCATGGGGCTGACTGGGG - Intergenic
938971786 2:136439469-136439491 CTGGAGCAAGGGGCTGCCTTTGG + Intergenic
939353054 2:141065910-141065932 ATGGGGCATAGGGCTGAATTGGG - Intronic
940829449 2:158452238-158452260 AGGGGGTATGGGGCTTCCTGTGG + Intronic
941155730 2:161975811-161975833 AATGGGCATGGTGCTGCCTGGGG - Intronic
942607820 2:177710430-177710452 ATGGGGAATGGGGCTGGCTAGGG + Intronic
946412103 2:219520575-219520597 ACGGGGCAAGGGGCAGCCCTTGG - Intronic
947490999 2:230594240-230594262 CTGGGCCATGGGGCTCCCTTGGG - Intergenic
947635772 2:231680223-231680245 ACTGGGGATGGGGCTGCATGAGG + Intergenic
948930666 2:241129814-241129836 ACGGTCCCTGGGGCTGCCCTGGG - Intronic
1172701477 20:36856055-36856077 AAGGGGCGTTGGGCTGGCTTGGG - Intronic
1175240880 20:57547708-57547730 ACCTGGCAAGGGGCTGCCTTTGG - Intergenic
1175289857 20:57868452-57868474 CCAGGGCTTGGGGCTGCCTGTGG + Intergenic
1176108581 20:63400906-63400928 AGGGGGCATGGGGCGACCTCAGG + Intergenic
1176172220 20:63701165-63701187 ACGGGGCAGGGGTCTCCCCTCGG - Intronic
1177120577 21:17132732-17132754 CCATGCCATGGGGCTGCCTTGGG - Intergenic
1178440472 21:32594047-32594069 ACAGGACATGGGGCTGGTTTTGG - Intronic
1180324772 22:11360738-11360760 ACGTGGCTTGGGTCTGTCTTAGG - Intergenic
1180549377 22:16528600-16528622 ACAGGGCCAGGGGCTGCGTTAGG - Intergenic
1181455594 22:23058640-23058662 ATGGGGCATGGGGCTGAGGTTGG - Intergenic
1181591212 22:23885964-23885986 AATGGGCATGTGGGTGCCTTGGG - Intronic
1182801921 22:33038623-33038645 ACTGGGGATGGGGCAGTCTTGGG - Intronic
1183369246 22:37423183-37423205 AGGGAGCAAAGGGCTGCCTTTGG + Intronic
1183708681 22:39489943-39489965 AGGGGCCATGAGGCTGTCTTGGG + Exonic
1184208941 22:43023880-43023902 ACAGGGCAGGGGGCAGCCTGTGG + Intergenic
1184959412 22:47918151-47918173 ACTGTCCATGGGGCTGCCTGAGG - Intergenic
1185381044 22:50507725-50507747 GCGGGGCCTGGGGCTGCCGCGGG - Intergenic
1185381099 22:50507862-50507884 GCGGGGCTTGGGGCTGCCACGGG - Intergenic
1185417881 22:50720121-50720143 GCGGGGGGTGGTGCTGCCTTCGG - Intergenic
950421229 3:12901036-12901058 GCGGGGCAGGGGGCTGCCCATGG + Intronic
950964620 3:17137710-17137732 ATGGGGCAGGAGGCTGCCCTGGG - Intergenic
952445589 3:33377890-33377912 ACTGGGAATAGGGCTGCCTCTGG - Intronic
954696541 3:52430346-52430368 AAGGGATATGGGGCTGTCTTTGG - Intergenic
956352486 3:68352912-68352934 CCAGGGTATAGGGCTGCCTTTGG + Intronic
958762926 3:98329497-98329519 TCAGGCCATGGGGCTCCCTTAGG - Intergenic
961509170 3:127390742-127390764 ACTGGGACTTGGGCTGCCTTGGG + Intergenic
961722732 3:128907300-128907322 ACGGGGCAAGGGCCAGCCTGAGG + Intronic
962376877 3:134866050-134866072 CTCTGGCATGGGGCTGCCTTTGG - Intronic
962820399 3:139043528-139043550 AGGGGGAATGGAGCTGCCTAGGG + Exonic
962989328 3:140564217-140564239 AGGGGGTATGGGGCTGCTTTAGG - Intronic
966567096 3:181395909-181395931 CCAGGACATGGGGCTGCTTTTGG + Intergenic
968648527 4:1751431-1751453 AGAGGGCATGGGGCCGCCTGCGG - Intergenic
968702947 4:2065315-2065337 GAGGGGCAGGGCGCTGCCTTGGG + Exonic
969875395 4:10132363-10132385 ATGTGGGATGGAGCTGCCTTGGG + Intergenic
982113152 4:152074388-152074410 CCTGAGAATGGGGCTGCCTTGGG + Intergenic
982435925 4:155383461-155383483 CCGGGGTCTGGGGCTGCCTAGGG - Intergenic
991444165 5:66681865-66681887 AAGGGGCATTGGGCTCCCCTAGG + Intronic
991528251 5:67587661-67587683 AATGGGCATGGGGCTTCTTTTGG + Intergenic
995210343 5:109530627-109530649 AAGGGGCCTGGGGCTGTCTGTGG - Intergenic
996063630 5:119058094-119058116 ACGGGGAATGAGGCTGGCTACGG + Intronic
997286160 5:132680211-132680233 ATGGGGGAGGGGGCTGACTTAGG + Intronic
1000022534 5:157331016-157331038 AAGAGGCATTGGGCTTCCTTTGG + Intronic
1001009730 5:168086728-168086750 TCGGGACATGGGGATGCTTTGGG - Intronic
1002363782 5:178694737-178694759 AGGGGGCCTGGGGCTGCCGGAGG + Intergenic
1002596828 5:180329187-180329209 CCGGGGCCTGGGGCTGCCCGTGG - Intronic
1002788675 6:423412-423434 AGGGGCCATGGGGCTTCCATGGG + Intergenic
1004171685 6:13300154-13300176 CCTGGGCTTGGGGCTGCCTGTGG - Intronic
1007390331 6:41546799-41546821 GCGGGGCATGGGGCTCGCTCCGG - Exonic
1013034227 6:106364583-106364605 ACAGGGGATGGGGCTGACTCAGG - Intergenic
1014477245 6:121888748-121888770 ACAGGGCATGGGGCGGGCGTGGG - Intergenic
1015558041 6:134483064-134483086 GCAGGTCATGGGGCTGCCTTGGG - Intergenic
1015705500 6:136083328-136083350 ACATAGTATGGGGCTGCCTTTGG + Intronic
1017813119 6:157998326-157998348 GCCAGGCATGGGGCTTCCTTAGG - Intronic
1018078710 6:160239979-160240001 GTGGGGCATTGGGCAGCCTTAGG + Intronic
1018170176 6:161138142-161138164 GCGGGGCATGGGGGTGCCCCTGG + Intronic
1018303443 6:162428738-162428760 ACGGAGCATGGGGCTTCGCTAGG - Intronic
1019291506 7:252718-252740 GTGGGGCAGGGGGCTGCCTGGGG - Intronic
1023939197 7:44759349-44759371 AGGGGGCAGGGGGCTGCCCAGGG - Exonic
1024089610 7:45924328-45924350 ACTGGGCTTGGGGATGCATTGGG + Intergenic
1034329601 7:150270824-150270846 AGGGAGCATGAGGCTGTCTTGGG - Intronic
1034668455 7:152839038-152839060 AGGGAGCATGAGGCTGTCTTGGG + Intronic
1036588594 8:10147607-10147629 AGGGGCCATGGGGCTGTCCTGGG + Intronic
1037590912 8:20311295-20311317 CTGGGGCAAGGGGCTGCCCTGGG + Intergenic
1038616605 8:29101493-29101515 TCGGGGCCTGGGTGTGCCTTGGG - Intronic
1039837690 8:41269786-41269808 AGGTGGCATGGGGTTGCATTAGG + Intronic
1040617187 8:49048394-49048416 ACAGGCCATGGGGCTGGTTTGGG + Intergenic
1042608955 8:70577115-70577137 AGGGAGCAGGGAGCTGCCTTGGG - Intronic
1045220172 8:100191144-100191166 GCGGGGCCTGGGGCTGCCAGAGG + Intronic
1048519227 8:135138476-135138498 AGTGGGTATGGGGCTGCCTGGGG - Intergenic
1049435024 8:142582514-142582536 GCGGGGGATGCGGCTGCCCTCGG + Intergenic
1049498674 8:142949139-142949161 ACTGGGGATTGGGCAGCCTTGGG - Intergenic
1053417569 9:37956334-37956356 GGGGGGCATGGCACTGCCTTCGG + Intronic
1053691427 9:40589200-40589222 ACAGGGCCAGGGGCTGCATTAGG - Intergenic
1054273376 9:63048285-63048307 ACAGGGCCAGGGGCTGCATTAGG + Intergenic
1054302685 9:63390166-63390188 ACAGGGCCAGGGGCTGCATTAGG - Intergenic
1054401459 9:64716671-64716693 ACAGGGCCAGGGGCTGCATTAGG - Intergenic
1054435067 9:65200991-65201013 ACAGGGCCAGGGGCTGCATTAGG - Intergenic
1054495323 9:65820690-65820712 ACAGGGCCAGGGGCTGCATTAGG + Intergenic
1055362090 9:75502832-75502854 AAGCAGCATGGGGCTGCCTTGGG + Intergenic
1055924470 9:81495602-81495624 ACGGGTCCTGGGGCTGGCTCTGG - Intergenic
1060106181 9:120874974-120874996 ATGGGCCATGGCTCTGCCTTTGG - Intronic
1060370026 9:123059933-123059955 ATGAAGCATGGGTCTGCCTTTGG + Intronic
1061361827 9:130148320-130148342 ACGGGGCATGAGGTTTCTTTAGG + Intergenic
1061578752 9:131523950-131523972 ACGGGGGCTGGGGCTGCCCATGG + Exonic
1062121502 9:134836373-134836395 ACGGGGCTTGGTGCTGCCCTCGG - Intronic
1062146722 9:134993551-134993573 ACTGGGGATGGGGGTGGCTTTGG + Intergenic
1185449634 X:275495-275517 ACGGCTCAAAGGGCTGCCTTGGG - Intergenic
1192173517 X:68871811-68871833 CCTGGGCATGGGACTGCCTCGGG - Intergenic
1200326005 X:155240036-155240058 AAGGGGCAAGGAGCTCCCTTGGG + Intergenic