ID: 1162525154

View in Genome Browser
Species Human (GRCh38)
Location 19:11202537-11202559
Sequence AACGGGGCATGGGGCTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162525154_1162525161 -5 Left 1162525154 19:11202537-11202559 CCAAGGCAGCCCCATGCCCCGTT 0: 1
1: 0
2: 0
3: 17
4: 183
Right 1162525161 19:11202555-11202577 CCGTTCCACCCCCAACCACAAGG 0: 1
1: 0
2: 2
3: 9
4: 151
1162525154_1162525168 11 Left 1162525154 19:11202537-11202559 CCAAGGCAGCCCCATGCCCCGTT 0: 1
1: 0
2: 0
3: 17
4: 183
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162525154 Original CRISPR AACGGGGCATGGGGCTGCCT TGG (reversed) Intronic
902298331 1:15483489-15483511 TCCTGGGCATGTGGCTGCCTTGG + Intronic
903215822 1:21842813-21842835 ACCTGGGCATGGGCCTGCCCGGG + Exonic
903216546 1:21846491-21846513 ACCTGGGCATGGGCCTGCCCGGG + Exonic
903217515 1:21851589-21851611 ACCTGGGCATGGGACTGCCCGGG + Exonic
903320116 1:22538145-22538167 AGCCTGGCATGGGGCTGCCATGG + Intergenic
907302721 1:53498648-53498670 CACGGGGCCTGGGGTTTCCTGGG - Intergenic
907791201 1:57666409-57666431 AACTGGCCATGGAGCTTCCTAGG + Intronic
911700107 1:100942860-100942882 AAGAGAGAATGGGGCTGCCTAGG + Intronic
911935254 1:103961146-103961168 GAGGGGGCAAGGGGCTTCCTGGG + Intergenic
912950794 1:114118873-114118895 AAAGGGGCCTGGGTATGCCTGGG - Intronic
913069398 1:115285549-115285571 CACTGGGCATGGGGCTGCCCTGG - Intergenic
914510424 1:148327875-148327897 AACAGGACATGGGACTTCCTGGG - Intergenic
916167826 1:161979063-161979085 AAAGGGGCAAGGGGCCTCCTTGG + Intergenic
916575638 1:166064117-166064139 CATGGGGAATGGGGCTGCCTCGG + Intronic
920279856 1:204834580-204834602 AACGGGGAGAGGGGCTGCCAGGG - Intronic
920296258 1:204958976-204958998 AATGGAGCATGGGGCTGTGTTGG - Intronic
923536319 1:234854849-234854871 GTGGGGGCTTGGGGCTGCCTTGG - Intergenic
924855109 1:247868137-247868159 GACTGGGAATGAGGCTGCCTGGG + Intronic
1062969136 10:1632829-1632851 GACTGGGCTTGGGGCTGCCCAGG + Intronic
1063002731 10:1939892-1939914 ATCGGGGCCTGGGCCTGCGTGGG - Intergenic
1064790994 10:18958092-18958114 AAGGGGACAAGGGGCTGCCAGGG - Intergenic
1064891178 10:20175539-20175561 AACTAGGCATGGGGGTGCATTGG + Intronic
1067842934 10:49696472-49696494 AGGAGGGCATGGGGCTGCCGAGG - Intronic
1069634536 10:69917355-69917377 GAGGGGCCTTGGGGCTGCCTGGG - Intronic
1069862625 10:71481093-71481115 AACGGGAAATGGGGCTCCCCAGG - Intronic
1070728790 10:78810641-78810663 AAGGTGGCTAGGGGCTGCCTTGG + Intergenic
1070848255 10:79541431-79541453 AACTGTGAATGGGCCTGCCTTGG + Intergenic
1071571138 10:86698035-86698057 AAGGCGGCATGGGGCATCCTGGG - Intronic
1071827658 10:89341184-89341206 AACTGGGCATGGGGCTTAGTTGG - Intronic
1076500538 10:130932983-130933005 GATGCGGCACGGGGCTGCCTGGG + Intergenic
1076808750 10:132875560-132875582 ACCTGTGCATGGGGCTGCTTTGG - Intronic
1077819499 11:5722918-5722940 AAAGGGGCTTAGGGCTTCCTTGG - Intronic
1078428043 11:11267261-11267283 AACTGGCCCTGGAGCTGCCTGGG - Intergenic
1079172918 11:18113164-18113186 AAGGGGGCTTGGGGCTGTCTGGG - Intronic
1079186877 11:18245926-18245948 AAGGGGACCTGGGGGTGCCTGGG - Exonic
1079189970 11:18269295-18269317 AAGGGGACCTGGGGGTGCCTGGG + Exonic
1083880199 11:65544626-65544648 CCCAGGGCATGGGGCTGCCTAGG - Intronic
1083909436 11:65697410-65697432 ATAGGGCCATGGGGCTGGCTGGG + Intergenic
1084149903 11:67283200-67283222 AACCGGAGATTGGGCTGCCTGGG + Exonic
1085725888 11:78954198-78954220 CAGAGGGCAGGGGGCTGCCTGGG + Intronic
1088490273 11:110380035-110380057 AATGGGGCATGTGGCTGTCTGGG + Intergenic
1089830115 11:121320004-121320026 CATGGGGCATGGGTCTTCCTGGG - Intergenic
1092312481 12:7373547-7373569 AACGGGACCTGGGGCAGCGTCGG - Exonic
1095954618 12:47798955-47798977 CACAGGGCCTGGGGCAGCCTAGG + Exonic
1097357799 12:58621235-58621257 AACAGGGGCTGGGGCTCCCTGGG - Intronic
1098851914 12:75605751-75605773 ATGGGTCCATGGGGCTGCCTAGG - Intergenic
1101941968 12:109105967-109105989 AAAGGGGAATGGGTCAGCCTAGG - Intronic
1102082476 12:110109631-110109653 GAAGGGGCAGGGGGCTGCCAAGG + Intergenic
1102817494 12:115879583-115879605 GCCGGGGCCTGGGCCTGCCTGGG + Intergenic
1104821804 12:131681747-131681769 AGAAGGGCATGTGGCTGCCTCGG - Intergenic
1113924326 13:113931928-113931950 GACGGGGCAGGGGCCAGCCTGGG - Intergenic
1115757394 14:36543163-36543185 CACGGTGAATGGGGCAGCCTAGG - Intergenic
1122048265 14:99038543-99038565 AGCTGGGGATGGGGCAGCCTTGG - Intergenic
1122384353 14:101333813-101333835 AGCCGGGCATGGTGCTGACTTGG - Intergenic
1122906872 14:104805629-104805651 TAGGGCGCATGGGGCTTCCTGGG + Intergenic
1122981268 14:105193303-105193325 AACGGGGGCTGGGGCTCACTTGG - Intergenic
1123065887 14:105618999-105619021 GACGGGGCAGGGGTCGGCCTAGG - Intergenic
1123070044 14:105638245-105638267 GACGGGGCAGGGGTCGGCCTAGG - Intergenic
1123074636 14:105661907-105661929 GACGGGGCAGGGGTCGGCCTAGG - Intergenic
1123089283 14:105735032-105735054 GACGGGGCAGGGGTCGGCCTAGG - Intergenic
1123095070 14:105763189-105763211 GACGGGGCAGGGGTCGGCCTAGG - Intergenic
1124121444 15:26892370-26892392 AAGGGAGCCTGGGGCTGCCACGG - Intronic
1127465497 15:59240669-59240691 AATGGGGGATGGGGGTGCATTGG - Intronic
1128785229 15:70391393-70391415 AAAGGGGCATGGGGAAGCTTTGG + Intergenic
1129016171 15:72471054-72471076 AACGGGGCAGGGGGGTGCATAGG + Intergenic
1129252921 15:74318624-74318646 AATGAGGCCTGGGGCAGCCTTGG - Intronic
1135645814 16:24160835-24160857 AGCGGGGCATGTGGCTATCTGGG + Intronic
1139171626 16:64637417-64637439 CATGGGGAATGGGGCAGCCTTGG + Intergenic
1141464179 16:84195719-84195741 GGCGGGGGATGGGGCTCCCTCGG + Intronic
1141752484 16:85968077-85968099 AACGGGGCATGGGGGTGGGTAGG + Intergenic
1142245405 16:88968054-88968076 GACGGGTCATGGGGCTGAGTTGG + Intronic
1142306202 16:89287296-89287318 AAGGGCCCATGGGGCTGCCCTGG + Intronic
1142876525 17:2854435-2854457 ACCGGCGCATGGAGCCGCCTGGG - Intronic
1143106473 17:4532904-4532926 CCCAGTGCATGGGGCTGCCTAGG + Intronic
1143919613 17:10320571-10320593 CACGTGGCCTGGGGCTTCCTGGG + Intronic
1144021193 17:11241144-11241166 GGCGGGGGATGGGGCTGCCCAGG + Intergenic
1147135566 17:38432071-38432093 AGCTGGGCATGGGGCGCCCTGGG - Intronic
1148166876 17:45490180-45490202 GACGGGGGATGGGGGTGACTGGG + Intronic
1149850437 17:60030615-60030637 ATCGGGGGATGGAGCTGCCAGGG - Intergenic
1149859729 17:60115909-60115931 ATCGGGGGATGGAGCTGCCAGGG + Intergenic
1151497328 17:74466696-74466718 AAGGGACCATGTGGCTGCCTTGG + Exonic
1151554389 17:74839273-74839295 TACGGGGCAGGGAGCAGCCTCGG + Exonic
1151979961 17:77502889-77502911 TAGGGGGCAGGGGGCTGGCTGGG - Intergenic
1152073706 17:78146400-78146422 ACCGAGGCATGGGGCTCCCTGGG + Exonic
1152134755 17:78497367-78497389 GACTGGGCATGGGGGTGTCTGGG - Intronic
1152332708 17:79682358-79682380 ATCAGTGCATGGGGCTGCCCTGG - Intergenic
1152643962 17:81460413-81460435 CACGGGGCAGGGCCCTGCCTGGG + Intronic
1155249858 18:23944221-23944243 CAAGGGGCATGAGGCAGCCTGGG - Intronic
1155267055 18:24104369-24104391 CACAGGGCACAGGGCTGCCTCGG + Intronic
1156398492 18:36720207-36720229 AACGGGGCATGTGGATGGCTCGG - Intronic
1157591770 18:48840597-48840619 AAAAGGGCCTGGGGCTGCCCAGG - Intronic
1160398988 18:78595163-78595185 AAAGGCAGATGGGGCTGCCTAGG + Intergenic
1160420013 18:78737552-78737574 CACGTGGCGTGGGGCTGCCGTGG + Intergenic
1160673107 19:375634-375656 ACCGGGGAACGGGCCTGCCTGGG - Intronic
1160849566 19:1183851-1183873 CACGTGGCAGGGGCCTGCCTGGG - Intronic
1161124837 19:2550055-2550077 AAAGGGAAATGTGGCTGCCTTGG + Intronic
1161349331 19:3783573-3783595 ATGGGGGCCTGGGGGTGCCTGGG + Intronic
1161778434 19:6276566-6276588 CACGGGGACTGGGGCTGCCTAGG - Intronic
1162525154 19:11202537-11202559 AACGGGGCATGGGGCTGCCTTGG - Intronic
1162812096 19:13170347-13170369 GAGGGGGCTTGGGGCTGCCTGGG - Intergenic
1164576337 19:29407458-29407480 TCAGGGCCATGGGGCTGCCTGGG - Intergenic
1165060957 19:33205002-33205024 GACTGGGCATGCGGATGCCTTGG + Intronic
1165095597 19:33408128-33408150 AGCGGGGTTTGGGGCTGGCTAGG - Intronic
1166677524 19:44748778-44748800 ATCGGGGCATGGGGCCGCCGGGG - Exonic
1166861047 19:45811392-45811414 AATGGGGCCTGGGGGTGCCAGGG + Intronic
1166876640 19:45901835-45901857 AAGGGCGCACGGGGCTGGCTGGG + Intronic
1167166686 19:47803707-47803729 AGGGGGGCTGGGGGCTGCCTGGG - Intronic
1167175151 19:47860057-47860079 AGGGGGGCTGGGGGCTGCCTGGG + Intergenic
1168316522 19:55486897-55486919 GAGGGGGGCTGGGGCTGCCTGGG + Exonic
925131728 2:1498435-1498457 AACGGCACAAGGAGCTGCCTGGG + Intronic
925182678 2:1827186-1827208 ATGGGGGCATGGGGCTTCGTAGG + Intronic
927552355 2:24010771-24010793 CAAGGGGCCTGGGGCTTCCTGGG + Intronic
928206801 2:29290313-29290335 AAGGGGGCACAGGGCTGCCGTGG + Intronic
932382496 2:71298136-71298158 AACAGGGCAGGGGACTGCATTGG + Intronic
932413458 2:71560408-71560430 AGCGGGGCGGGGGCCTGCCTGGG - Intronic
934135561 2:88992981-88993003 AGCAGGGGATGGGGCTGACTGGG + Intergenic
934234747 2:90220789-90220811 AGCAGGGGATGGGGCTGACTGGG - Intergenic
934551780 2:95267234-95267256 AGGGGGGCCTGGGGCTGCCCTGG + Intergenic
936855572 2:116953474-116953496 CAATGGGCATGGGGCTGACTGGG - Intergenic
939353055 2:141065911-141065933 AATGGGGCATAGGGCTGAATTGG - Intronic
941155731 2:161975812-161975834 CAATGGGCATGGTGCTGCCTGGG - Intronic
942607819 2:177710429-177710451 AATGGGGAATGGGGCTGGCTAGG + Intronic
944222043 2:197311960-197311982 AGGGGCACATGGGGCTGCCTGGG - Intergenic
945198274 2:207257400-207257422 AATAGGCCATGGGGCTCCCTAGG - Intergenic
948427413 2:237896479-237896501 AACGGTCCAGGGGTCTGCCTGGG - Intronic
948478881 2:238238645-238238667 AACGGGGCTGGGGCCTGACTGGG + Exonic
1173184434 20:40829838-40829860 AAATGGGCATGGGGATGACTGGG - Intergenic
1176521049 21:7824740-7824762 CACGGGGCATGTGGGTGCTTTGG - Intronic
1178655069 21:34454752-34454774 CACGGGGCATGTGGGTGCTTTGG - Intergenic
1179428840 21:41304563-41304585 GACAGGGGATGGGGCTGCCTGGG + Intronic
1181260337 22:21592691-21592713 AAGGAGGCATGGAGCTGCCATGG - Intronic
1181591213 22:23885965-23885987 AAATGGGCATGTGGGTGCCTTGG - Intronic
1183354269 22:37350038-37350060 GACGGGGTGTGAGGCTGCCTGGG + Intergenic
1183708680 22:39489942-39489964 AAGGGGCCATGAGGCTGTCTTGG + Exonic
1184646305 22:45897245-45897267 AATGGAGCACTGGGCTGCCTGGG + Intergenic
1184991628 22:48174086-48174108 AAAGGGGCAAGGGGCTGCTGGGG + Intergenic
1185235730 22:49711851-49711873 AACCTGGCCTTGGGCTGCCTTGG - Intergenic
1185381045 22:50507726-50507748 GGCGGGGCCTGGGGCTGCCGCGG - Intergenic
1185381063 22:50507773-50507795 GGCGGGGCTTGGGGCTGCCACGG - Intergenic
1185381100 22:50507863-50507885 GGCGGGGCTTGGGGCTGCCACGG - Intergenic
950689382 3:14643569-14643591 AAGGTGGCATTGGGGTGCCTGGG + Intergenic
952211434 3:31232401-31232423 ACCTGGGCATGGGGCTGTCCTGG - Intergenic
953004663 3:38967176-38967198 TACGGATCATTGGGCTGCCTTGG - Intergenic
960698361 3:120417131-120417153 ATGGGGTCATGGGGCTGGCTGGG + Intronic
962820398 3:139043527-139043549 CAGGGGGAATGGAGCTGCCTAGG + Exonic
966937287 3:184719263-184719285 AAAGGGCCTGGGGGCTGCCTGGG + Intergenic
969465831 4:7355860-7355882 CAAGGGCCATGGGGCTTCCTGGG + Intronic
969875394 4:10132362-10132384 AATGTGGGATGGAGCTGCCTTGG + Intergenic
973745914 4:53963291-53963313 AACCGGTCATTGGGATGCCTGGG + Intronic
974171250 4:58270019-58270041 AAAGGGGCAAGGTACTGCCTGGG + Intergenic
982435927 4:155383462-155383484 GCCGGGGTCTGGGGCTGCCTAGG - Intergenic
986385378 5:7228042-7228064 CCCTGGGCAGGGGGCTGCCTTGG + Intergenic
991403546 5:66278810-66278832 GAAGGGGCAAGGGGCTTCCTGGG + Intergenic
994095415 5:95843262-95843284 AACTGGGACTGGGTCTGCCTGGG - Intergenic
995145922 5:108787102-108787124 ACAGGGGCAGGGGGCTTCCTGGG - Intronic
997398057 5:133580434-133580456 GACTGGGGCTGGGGCTGCCTTGG - Intronic
997750636 5:136342190-136342212 AACAGGACATGAAGCTGCCTGGG + Intronic
998506160 5:142674439-142674461 CACAGGAAATGGGGCTGCCTTGG - Intronic
999267787 5:150278252-150278274 GATGGAGCCTGGGGCTGCCTAGG - Intronic
1000285848 5:159825690-159825712 AGTGGGGGATGAGGCTGCCTTGG + Intergenic
1004470692 6:15926565-15926587 AACCAGCCATGTGGCTGCCTGGG + Intergenic
1013349255 6:109290757-109290779 AACGGGGCCTGGGTCTGGCCGGG - Intergenic
1015558042 6:134483065-134483087 AGCAGGTCATGGGGCTGCCTTGG - Intergenic
1019291507 7:252719-252741 CGTGGGGCAGGGGGCTGCCTGGG - Intronic
1019352624 7:562100-562122 AAAGGGGCATGTGGCTGCCCGGG + Intronic
1019570522 7:1709478-1709500 AAAGGAGCCTGGGGCTGCCGGGG + Intronic
1023139101 7:37083259-37083281 AGGGGGCCATCGGGCTGCCTAGG + Intronic
1023939198 7:44759350-44759372 GAGGGGGCAGGGGGCTGCCCAGG - Exonic
1025261775 7:57424992-57425014 CACGGGGCAGGGCGCCGCCTCGG - Intergenic
1025615665 7:63114271-63114293 CACGGGGCAGGGCGCCGCCTCGG + Intergenic
1027007470 7:74707424-74707446 AGCGGGGCAGGTGGCTGCCCAGG - Intronic
1027051121 7:75021772-75021794 AGCGAGGCATGGGGCTGGCCAGG - Intronic
1028963530 7:96776368-96776390 AGCTGGGCATGGTGCTGCTTGGG - Intergenic
1030876171 7:114816296-114816318 AAGGAGCCATGGGGATGCCTGGG - Intergenic
1032230955 7:130073589-130073611 AATGGAACATGGGGCTGGCTGGG - Intronic
1032973324 7:137191486-137191508 AATGGTGCATGGGACTTCCTTGG - Intergenic
1035280295 7:157774308-157774330 AACAGGGCAAGGGAATGCCTAGG + Intronic
1037804892 8:22053671-22053693 AACGGGGCGTCGGGGGGCCTGGG + Intronic
1038616606 8:29101494-29101516 ATCGGGGCCTGGGTGTGCCTTGG - Intronic
1039597811 8:38806544-38806566 AAAGAGGGATGGGGCTGGCTAGG + Intronic
1040817675 8:51526193-51526215 AGCTGGGCATGGGGCTGGCGAGG + Intronic
1042608956 8:70577116-70577138 AAGGGAGCAGGGAGCTGCCTTGG - Intronic
1044252655 8:90022198-90022220 AAGAGGGCATGGAGCTGGCTAGG + Intronic
1044416614 8:91947233-91947255 AACCGGGCATGGTGGTGTCTGGG + Intergenic
1048519228 8:135138477-135138499 CAGTGGGTATGGGGCTGCCTGGG - Intergenic
1049299415 8:141861784-141861806 AGGGAGGCCTGGGGCTGCCTGGG + Intergenic
1049300701 8:141867907-141867929 CAGGGGGCATGGGGCTGCTGCGG + Intergenic
1049336068 8:142086392-142086414 CAGGAGGCAGGGGGCTGCCTGGG + Intergenic
1055362089 9:75502831-75502853 AAAGCAGCATGGGGCTGCCTTGG + Intergenic
1057454090 9:95191646-95191668 AAAGGGGCTTGGGGATGGCTGGG - Intronic
1057487074 9:95494091-95494113 CACGGGGCATGTGGCAGGCTGGG + Intronic
1057840841 9:98484562-98484584 AACGGGGGATGAGGCTGGATGGG + Intronic
1057912191 9:99028063-99028085 AACGGTGCAAGGCACTGCCTGGG - Intronic
1058923471 9:109640191-109640213 AAAGGGGCATGGGGTCGCCAAGG + Intergenic
1061375408 9:130220992-130221014 GATGGGGCATTGGGCTGCCAGGG - Intronic
1061589309 9:131588563-131588585 AGCAGGGCATGGGGCTTCATAGG - Intronic
1061942459 9:133891157-133891179 AAGGGTGCAGGGGGCTGCCAGGG + Intronic
1062337782 9:136079985-136080007 TGCTGGCCATGGGGCTGCCTGGG + Intronic
1192173519 X:68871812-68871834 GCCTGGGCATGGGACTGCCTCGG - Intergenic
1192325604 X:70129347-70129369 ATAGGGGCTTGGGGCTTCCTGGG + Intergenic
1200037302 X:153340234-153340256 AGATGGGAATGGGGCTGCCTTGG + Intronic