ID: 1162525155

View in Genome Browser
Species Human (GRCh38)
Location 19:11202546-11202568
Sequence TGGGGGTGGAACGGGGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 445}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162525155_1162525168 2 Left 1162525155 19:11202546-11202568 CCCCATGCCCCGTTCCACCCCCA 0: 1
1: 0
2: 2
3: 37
4: 445
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162525155 Original CRISPR TGGGGGTGGAACGGGGCATG GGG (reversed) Intronic
900507082 1:3035066-3035088 TGAGGGTGGAGGTGGGCATGGGG + Intergenic
900654147 1:3746897-3746919 GGGGGAGGGAACGGGGCAGGCGG + Intergenic
900689288 1:3970376-3970398 TGGGGGTGGAATAGGGCAGGAGG + Intergenic
900695619 1:4008036-4008058 TGGGGAAGGAACTGGGCAGGAGG + Intergenic
900848578 1:5123657-5123679 TGGGGGATGAACAGAGCATGAGG + Intergenic
900902185 1:5524736-5524758 TGGGGGTGGAGTGGGGCGTGGGG - Intergenic
901493245 1:9607317-9607339 AGGGGGTAGGAGGGGGCATGTGG + Intronic
902040738 1:13490570-13490592 TGGGGGTGGAGGTGGACATGGGG - Intronic
902231767 1:15032092-15032114 TGGGGGTGGATCGGGGAGGGAGG - Intronic
906126170 1:43428213-43428235 TGGAAGTGGAAGGGGCCATGAGG - Intronic
907274798 1:53311177-53311199 TGGGGGTGGGCAGGGGCCTGGGG - Intronic
907364089 1:53945721-53945743 TGAGGGTGGGACGGGGCTTGTGG - Exonic
907920490 1:58906728-58906750 TGGGAGTGGAGCTGGGAATGTGG - Intergenic
909169526 1:72277223-72277245 TGGGGGTGGAGGGGGGTCTGCGG - Intronic
910239931 1:85075488-85075510 TGGGGGTAGAAAGAGGCTTGAGG - Intronic
911947988 1:104136481-104136503 TGGGGGTGGAAAGGATCTTGGGG + Intergenic
912465040 1:109866554-109866576 TGGGGGTGGGACAGGGTATATGG + Intergenic
912595263 1:110869563-110869585 TGAGGGTGGAGCGGGGAAGGAGG + Intergenic
912908155 1:113729276-113729298 TGGGGGTGGAGTAGGGGATGTGG + Intronic
913184939 1:116362285-116362307 TGGTGGTGAGACAGGGCATGTGG - Intergenic
913474132 1:119220291-119220313 AGGGGGTGGAAGTGGGGATGGGG + Intergenic
914232662 1:145778674-145778696 TGGGGATGGGAAGGGGCAGGAGG - Intronic
914902163 1:151716664-151716686 TGGGGGTGGGAGGGGGGCTGAGG - Exonic
914921052 1:151847694-151847716 TGGTGGTGGGACGGGGCCTGGGG + Intronic
915117685 1:153610835-153610857 TGGTGGGGGAATGGGGCAGGCGG - Intronic
915141617 1:153771772-153771794 TGGGGGAGGAAGGGGGCACTGGG - Intronic
915572234 1:156751041-156751063 TGGGGGCGGAACTGAGCACGCGG + Intronic
915908180 1:159894935-159894957 TGGGGGTGCAACAGTGCATCAGG + Intronic
918078795 1:181190242-181190264 TGGAGGTGGGACGGGGTGTGGGG + Intergenic
919805925 1:201380992-201381014 TGGGGGTTGGAGGGGGCTTGTGG + Exonic
919814286 1:201428035-201428057 GGGGGGGGGGTCGGGGCATGGGG - Intronic
920215727 1:204360372-204360394 TGGGGGGGGGGCGGGGGATGGGG - Intronic
920347304 1:205314455-205314477 TGGGCTTGGAACTGGGCAGGGGG + Intronic
921054023 1:211530729-211530751 TGGGGGTGGGAGGGGACTTGAGG - Intergenic
921095978 1:211887659-211887681 TGGGGCTGAGATGGGGCATGGGG - Intergenic
921911365 1:220552855-220552877 TGGGGGTGGCAGGCGGCAGGGGG - Intronic
922562478 1:226579274-226579296 TGGGGGAAGGATGGGGCATGGGG + Intronic
922973935 1:229768248-229768270 TGGGGGTGGTGAGGGGCAAGAGG - Intergenic
923088206 1:230717770-230717792 GGGGGCTGGAACCGGGCATTTGG + Intergenic
923093092 1:230754110-230754132 TGGGGGAGGGGCGGGGCAGGAGG + Intronic
923151817 1:231240683-231240705 TGGGGGTGGCATGGGGAAAGGGG + Intronic
1062818746 10:518649-518671 GGAGGGTGGAAGGTGGCATGAGG - Intronic
1063111147 10:3038495-3038517 TGGGGGATGGAGGGGGCATGAGG + Intergenic
1064127629 10:12677425-12677447 CGGGGGTGGGAAGGGGCTTGGGG + Intronic
1064500195 10:15963143-15963165 TGGGGGTGGAGGGAGGGATGTGG + Intergenic
1065645623 10:27831061-27831083 TGGGGGAGGGAAGAGGCATGAGG + Intronic
1067686921 10:48471266-48471288 TGGTGCTGGGGCGGGGCATGGGG - Intronic
1068753115 10:60619182-60619204 TGGGAGTGGGCCTGGGCATGGGG - Intronic
1068960358 10:62861147-62861169 AGGGGGTGGAACGGGACAGAAGG - Intronic
1070494636 10:77010377-77010399 TGGGGGTTGAATGGGGAGTGAGG + Intronic
1070596107 10:77834291-77834313 TGAGGGTGAAACAGGGCATTGGG - Intronic
1071520407 10:86328761-86328783 TGGGGGTGGAGGGGGGAACGGGG - Intronic
1072555324 10:96510342-96510364 TGGGGCTGGTGAGGGGCATGGGG - Intronic
1072578291 10:96719890-96719912 GGGTGGAGGAACGGGGCTTGGGG + Intronic
1072692913 10:97583549-97583571 AGGGGGCGGGACGGGGCGTGGGG - Intronic
1073289641 10:102407179-102407201 TGGGGCTAGGATGGGGCATGGGG - Intronic
1073705234 10:105975770-105975792 TGGGGGAGGAGCAGGGCAGGTGG - Intergenic
1075129471 10:119725998-119726020 AGGGGGTGGAGCCGGGCCTGGGG + Intergenic
1076102867 10:127797252-127797274 AGAGGGTGCAACAGGGCATGTGG - Intergenic
1076131121 10:128014706-128014728 TGGGGTTGAGACGGGGGATGGGG - Intronic
1077023628 11:430466-430488 TGGGGGTGGGAGGGGGCAGCAGG + Intronic
1077229101 11:1450682-1450704 TGGGGCTGGACGGGGGCGTGGGG - Exonic
1078066403 11:8081725-8081747 AGGGGGTGGAGCGGGGCAGGCGG - Intronic
1078723337 11:13904222-13904244 TGGGCATGGAAAGGGCCATGAGG + Intergenic
1079374517 11:19880054-19880076 TGAGGCTGGCACGGGGCTTGGGG - Exonic
1079391166 11:20023281-20023303 TGGGGGTGGGAGGGGGCGGGGGG + Intronic
1079420038 11:20277265-20277287 TGGGGCTGGCACGGGGGTTGTGG - Intergenic
1080302802 11:30803207-30803229 TGGAGATGGAAGGGGCCATGAGG + Intergenic
1080749606 11:35139782-35139804 TGGGGCTGGAACAGGGCGAGTGG + Intronic
1082784781 11:57311031-57311053 TGGGGGTCAGATGGGGCATGGGG - Intronic
1083348809 11:62012869-62012891 TGGGGGTTGAGCTGGGGATGAGG + Intergenic
1083412200 11:62501805-62501827 TGGGGCAGGCAGGGGGCATGGGG + Intronic
1084650537 11:70486842-70486864 TGGGCGTGGCACTCGGCATGGGG + Intronic
1085326108 11:75607713-75607735 TGGGAGGGGAGCCGGGCATGGGG + Intronic
1087614796 11:100475466-100475488 TGAGGGTGGAACGTGGGAGGAGG - Intergenic
1089292904 11:117449212-117449234 GGGAGCTGGAAGGGGGCATGGGG + Intronic
1089301861 11:117503809-117503831 TGGGGGTGCTAGGGGGCGTGTGG + Intronic
1089507295 11:118972154-118972176 TGGGGGTGGAGCGGGGGCGGCGG - Intronic
1089617041 11:119700586-119700608 TGGGGGTGGGACGGTGGGTGGGG + Intronic
1090665811 11:128914335-128914357 TGGGGGTGCAGCGGGGCAGCGGG - Intronic
1090964037 11:131582777-131582799 TGGTGGGGGAAGGGGGCGTGGGG - Intronic
1094438290 12:30445990-30446012 ATGGACTGGAACGGGGCATGGGG + Intergenic
1094862872 12:34489801-34489823 TGGGAGTGGATTGAGGCATGTGG - Intergenic
1096436146 12:51592033-51592055 TGGGGGTGGGATGGGGGAAGGGG - Intronic
1096593166 12:52675799-52675821 AGGTGGTGGAGCGGGGAATGGGG - Intronic
1096780120 12:53986658-53986680 TGGCGTTGGAACAGGGCATTTGG + Intronic
1096780923 12:53991646-53991668 TGGGGGCGGAAAGGGGGACGGGG + Intronic
1097166056 12:57087376-57087398 TGGGGGAGGGAGGGGGCACGTGG + Intronic
1097246414 12:57610092-57610114 TGGGGGCGGAGCCGGGCAGGGGG + Intergenic
1099437383 12:82660249-82660271 TGGGGGTGGAAAGGACCTTGGGG - Intergenic
1100581168 12:95942376-95942398 GAGGGGTGGGAGGGGGCATGCGG + Intronic
1101654786 12:106710460-106710482 TGGGGGTGGGAGGGGGCAGATGG - Intronic
1102290374 12:111694336-111694358 TGGGGGTGGTAAGGAGCAGGGGG - Intronic
1102554704 12:113719259-113719281 TGGGGAAGGGACTGGGCATGGGG + Intergenic
1103946961 12:124532216-124532238 TGATGGTAGAAGGGGGCATGGGG - Intronic
1103997943 12:124842183-124842205 TGGGAGTGACACGGGGCGTGGGG - Intronic
1104626677 12:130362218-130362240 TGGGGGTGGAAGGTGGGAGGAGG - Intronic
1106032166 13:26013269-26013291 TGGGGGTGGAGAGGGGGCTGGGG - Intronic
1106248344 13:27966854-27966876 TGGGGGTGGAGGGGGGGACGCGG - Intronic
1107516835 13:41137587-41137609 TTGGGGTTGAGGGGGGCATGTGG - Intergenic
1107732140 13:43359063-43359085 TGGGGGTGGGGAGGGGCAGGGGG - Intronic
1110909046 13:80932437-80932459 TGGGGGTGGAGGTGGGGATGGGG + Intergenic
1110987229 13:81986026-81986048 TGGGATTGGAAAGAGGCATGGGG - Intergenic
1112340122 13:98546165-98546187 TGGGGGTGGCACTAGGCATCAGG - Intronic
1113683720 13:112263086-112263108 TGGAGGTGGAAGGGGTCATGGGG - Intergenic
1114969258 14:28005365-28005387 TGGGGCTGGAACCAGGCATGTGG + Intergenic
1115160702 14:30390300-30390322 TGGGGGTGGAAGGGGGAACCAGG + Intergenic
1115546164 14:34466537-34466559 TGGGGGTGGGACTGGGGGTGGGG - Intergenic
1116719052 14:48469452-48469474 TGGGAGAGGAAGGGTGCATGTGG - Intergenic
1117164571 14:53020585-53020607 TGGGGGTGGGAAGGGGGATGGGG + Intergenic
1119540978 14:75438078-75438100 TGGAGGTGAAACTGGGCAAGAGG + Exonic
1119983209 14:79105591-79105613 TGGGGGTGGAAGGAAACATGGGG - Intronic
1121016639 14:90553020-90553042 TGGGGCAGGGACGGGGCCTGTGG + Intronic
1121680281 14:95787896-95787918 TGGGGATGAACCAGGGCATGGGG - Intergenic
1122412700 14:101534027-101534049 TGGGGGGGGCACTGGGCCTGGGG + Intergenic
1122775607 14:104115828-104115850 TGGGGATGGAAGTGGGCATAGGG - Intergenic
1122874150 14:104655598-104655620 TGGGAGTGGAGCAGGGCGTGTGG - Intergenic
1123038040 14:105479224-105479246 GGGGAGTGCAACGGGGCTTGGGG + Intronic
1202835027 14_GL000009v2_random:71563-71585 TGGGGGTTGGAAGGGGGATGTGG + Intergenic
1125213865 15:37246696-37246718 TGGAGGTGCAAGGGGGCATGTGG + Intergenic
1126317918 15:47390513-47390535 TGGGGGTGGAAAGGCATATGTGG - Intronic
1128584420 15:68835255-68835277 TGGGGGTAGAAGGGGGCAGAGGG - Intronic
1129109326 15:73328590-73328612 CGGGGGTGGTACTGGGCATCAGG - Intronic
1129254938 15:74328934-74328956 TGGGGGAGGAAATGGGCATGGGG - Intronic
1129262242 15:74374867-74374889 TGAGGATGGAGCGGGGCAGGGGG - Intergenic
1129714405 15:77838636-77838658 TGGGGGTAGAAGGGGACAGGTGG - Intergenic
1131034198 15:89210502-89210524 TGAGGGAGGAAAGGGGCAGGAGG + Intronic
1132831562 16:1930623-1930645 TGGGGGTGGGAGGGGGCAAGTGG - Intergenic
1132839424 16:1971866-1971888 TGGGGGTAGACCGGCGGATGTGG - Intergenic
1133179098 16:4039184-4039206 TGGGGGTGGAAAGGGGCTTGGGG - Intronic
1135280255 16:21148114-21148136 TGAGGGTGGGATGGGGCAGGGGG + Intronic
1136574978 16:31117938-31117960 AGGGGGTGGGGCGGGGCCTGAGG + Intronic
1136739291 16:32500085-32500107 TGGGAGTGCATTGGGGCATGTGG + Intergenic
1138235589 16:55379836-55379858 TAGGGGTGGGAGTGGGCATGAGG - Intergenic
1138286802 16:55816457-55816479 TGGGGGTGGGAGTGGGGATGAGG + Intronic
1138436452 16:57003393-57003415 TGGTTGTGGGATGGGGCATGTGG - Intronic
1138499223 16:57428635-57428657 TGGGGATGGAAGGGGGCAGAGGG + Exonic
1138611458 16:58128821-58128843 TGGGGGGGGGGCGGTGCATGTGG - Intronic
1139327673 16:66164746-66164768 TGGGGTTGGATCGAGGCAGGAGG - Intergenic
1139356487 16:66369880-66369902 TAGGTGTGGAAAGGGGCATGTGG + Intronic
1139954096 16:70685201-70685223 TGGGGGTGGGGCGGGGCTGGGGG + Intronic
1140112282 16:72014305-72014327 TGGGGGTGGAATGGAGCACTGGG - Intronic
1141611129 16:85181759-85181781 TGGGGCTGGGACGGGTCCTGGGG + Intronic
1142135612 16:88450691-88450713 TGGGAGAGGAACAGGGCGTGGGG - Intergenic
1142213852 16:88821436-88821458 TGTGGGTGGACCTGGGCCTGGGG + Intronic
1142352250 16:89585827-89585849 TGGGGGTGGAGGGGGGCCTTCGG + Intronic
1203013922 16_KI270728v1_random:331707-331729 TGGGAGTGCATTGGGGCATGTGG - Intergenic
1203032257 16_KI270728v1_random:604866-604888 TGGGAGTGCATTGGGGCATGTGG - Intergenic
1142592128 17:1010903-1010925 CGGGGGTGGAACGGGGCTGCTGG - Intronic
1142717071 17:1752969-1752991 TTGGGGTGGCCCGGGGAATGGGG + Intronic
1142863106 17:2775488-2775510 GGGAGGGGGCACGGGGCATGGGG + Intergenic
1142996488 17:3763696-3763718 TTGGGGTGGGACTGGGCATTGGG + Intronic
1143027840 17:3951547-3951569 TGGGGGTGGGACCGGGCGGGGGG - Intronic
1143594277 17:7905074-7905096 TGGGGGTGGAAAGGGCCCAGTGG - Intronic
1143862952 17:9904685-9904707 TGTGGGTGGAGCGGGGGATGCGG - Intronic
1144359453 17:14478093-14478115 TGGGGGAGAAATGAGGCATGAGG - Intergenic
1144674554 17:17153536-17153558 TGGGCGAGGAACGGGGCAGCAGG - Intronic
1144740694 17:17580693-17580715 TGGGGGCTGAATGGGGAATGGGG - Intronic
1144875268 17:18394206-18394228 TGGGGGAGGACAGGGGCAGGTGG - Intergenic
1144950822 17:18992522-18992544 TGGGGGTGGGACAGGGCTTTAGG + Intronic
1145156956 17:20550215-20550237 TGGGGGAGGACAGGGGCAGGTGG + Intergenic
1145759932 17:27420264-27420286 TGGGGGTGAACAGGGGCAGGTGG - Intergenic
1145788857 17:27611665-27611687 TGGAGGTGGGGTGGGGCATGTGG + Intronic
1147171922 17:38625608-38625630 TGGGGGAGCAAAGGGGCATGGGG + Intergenic
1147262708 17:39217961-39217983 GGGGCGTGGGACTGGGCATGGGG + Exonic
1148547522 17:48529384-48529406 TGGGGGTGGGAGGGGGGATGGGG - Exonic
1148677814 17:49455316-49455338 ATGGGGGGGAATGGGGCATGGGG + Intronic
1148961957 17:51400936-51400958 TGGGGGTGCAAAGAGGTATGGGG - Intergenic
1148983738 17:51602277-51602299 TGGAGGTGGAGGGGTGCATGGGG - Intergenic
1149316576 17:55444381-55444403 TGGGGGTGGGCCGGAGCAAGCGG + Intergenic
1149457053 17:56796812-56796834 TGGGGGAGGGAGGAGGCATGGGG - Intronic
1149868064 17:60161610-60161632 TGGGGGTGGTCAGGGGCATGGGG - Intronic
1150284098 17:63945796-63945818 TGGGGGTGGTAAGGGGGAGGGGG + Intronic
1151000992 17:70376276-70376298 TGTGGGTGGAATGGAGGATGGGG - Intergenic
1151400069 17:73850224-73850246 TGGAGCTGGAGGGGGGCATGAGG + Intergenic
1151550972 17:74822341-74822363 TGGGGGTGGGAAGGGGCTGGGGG - Intronic
1151553465 17:74835137-74835159 TGGAAGTGGAAGGGGGCCTGTGG - Intronic
1151831833 17:76557360-76557382 TGGGGGAGGATAGGGGCATTTGG - Intergenic
1152042063 17:77909932-77909954 TAGGGGTGGAGCGGAGGATGGGG - Intergenic
1152239453 17:79153892-79153914 TGAGGGTGGAATGGATCATGGGG - Intronic
1152727387 17:81954343-81954365 TGGGGGTGGAAAAGGGGCTGAGG - Intronic
1154274510 18:12947825-12947847 TGGGGGCGGGGCGGGGCTTGAGG + Intronic
1154430445 18:14304164-14304186 TGGGGGTTGGAAGGGGGATGTGG + Intergenic
1154432687 18:14320491-14320513 TGGGGGTTGGAAGGGGGATGTGG + Intergenic
1155241270 18:23865791-23865813 CGGGGGTGGTACAGGGCAGGAGG + Intronic
1155513532 18:26600857-26600879 TGGGGATGGAAGGGGGCAGAGGG - Intronic
1157419261 18:47531642-47531664 TGGGGGTGGGAGGGGGCACAGGG + Intergenic
1157506258 18:48228807-48228829 TGGGGGCGTAAGGGTGCATGGGG - Intronic
1158118856 18:54026170-54026192 TGGGGGAGGAAAGGGGCAGCAGG + Intergenic
1158319649 18:56248884-56248906 TGGGGGTGGAGGGGGGCAGGGGG + Intergenic
1160913915 19:1487798-1487820 TGGGGGTGTAGCGGGGCTGGGGG + Exonic
1160968230 19:1755879-1755901 TGGGGGTGTAAGGGTGCAGGAGG + Intronic
1161701506 19:5798322-5798344 TAGGGGTGGAGCAGGGCCTGGGG + Intergenic
1161850268 19:6734314-6734336 TGAGGGTGGGGTGGGGCATGAGG + Intronic
1162525155 19:11202546-11202568 TGGGGGTGGAACGGGGCATGGGG - Intronic
1162781620 19:13009877-13009899 TGGTGGTAGAACGGGGCCGGGGG + Intronic
1162783971 19:13022805-13022827 TGGGGGTGGGGTGGGGCATTGGG - Intronic
1163124042 19:15234719-15234741 GGGAGGTGGAAAGGGGCAAGAGG - Intergenic
1163490852 19:17616476-17616498 TGGGGGTGGAAGGGGGAGAGAGG + Intronic
1163722642 19:18905547-18905569 TGCGGGTGGAGAGGGGCAGGAGG + Intronic
1163725604 19:18921589-18921611 TGGGGATGGAGAGGGGAATGGGG + Intronic
1164609705 19:29623830-29623852 TGGGAGGGGAACAGGGCCTGTGG + Intergenic
1165256133 19:34578128-34578150 TGCGGCTGGGACAGGGCATGTGG + Intergenic
1165355181 19:35299905-35299927 AGGGGGTGGACCTGGGGATGCGG + Intronic
1165419598 19:35716393-35716415 TAGGGGTGGATCGGGCCACGGGG - Intronic
1165433563 19:35785120-35785142 TGGGGGTGGCGAGGGGCAGGTGG + Intronic
1165475120 19:36026094-36026116 TGGGGGAGGAAGGGAGCAGGAGG + Intronic
1166010102 19:39935329-39935351 TGAGGGTGGGAGGTGGCATGTGG + Intergenic
1166271787 19:41718904-41718926 TGGGGTGGGATCCGGGCATGTGG + Intronic
1166272264 19:41721699-41721721 TGGGGTGGGACCGGGGCATGTGG + Intronic
1166303248 19:41923783-41923805 TGGGGGTGGATCTGGGGAGGCGG + Intronic
1166500173 19:43334566-43334588 TGGAGGTGGGACTGGGCATGAGG - Intergenic
1166726941 19:45034320-45034342 TGGGGGTGGAAAGGGGCAGAGGG - Intronic
1166790405 19:45395712-45395734 GGGGGCTGGAGGGGGGCATGGGG + Exonic
1167294209 19:48639885-48639907 TGGGGGTAGCACAGAGCATGGGG + Intronic
1167563359 19:50239982-50240004 TGGTGGTGGGAAGGGACATGGGG - Intronic
1167750205 19:51374828-51374850 TGGGGGCGAATCGGGGGATGGGG - Intergenic
1167797066 19:51716467-51716489 TGGGGTTGGAACTGGAGATGGGG - Intronic
1168152167 19:54455104-54455126 TGGGGCTGCGACGGGGCAAGGGG - Intronic
1202637599 1_KI270706v1_random:55785-55807 TGGGGGTTGGAAGGGGGATGTGG - Intergenic
925420176 2:3704435-3704457 GGGGTGTGGAGAGGGGCATGGGG + Intronic
925420265 2:3704633-3704655 GGGGTGTGGAGAGGGGCATGGGG + Intronic
926086249 2:10022204-10022226 AGGCGGTGGAACGGGCCCTGAGG + Intergenic
927328297 2:21832230-21832252 TGGAGGTGGCAGGGGGCAAGGGG + Intergenic
927863856 2:26576599-26576621 TGGGGCTGGAACTGGGGCTGGGG - Intronic
927973999 2:27324093-27324115 TGGGGGTGGAGCTGGGCAGGTGG - Intronic
928118841 2:28567027-28567049 TGGGGGTGGAACGAGGTTCGGGG + Intronic
930749836 2:54923793-54923815 TGAGGGAGGGAGGGGGCATGGGG - Intronic
931485357 2:62685011-62685033 TGGGGGTGCTAGGGGGAATGGGG + Intronic
932011850 2:67986121-67986143 TGGGTGTGGGAAAGGGCATGGGG + Intergenic
932421829 2:71605810-71605832 TGGGGGAGGAATGGGGGATGGGG - Intronic
932575636 2:72961003-72961025 TGGGGCTGGAACCGTGAATGAGG - Intronic
932803801 2:74766039-74766061 TGGGGATGGAAGGGGAGATGGGG + Intergenic
932838574 2:75060488-75060510 TGGGGGAGGAGCCTGGCATGAGG + Intronic
933587808 2:84199146-84199168 TGAGGGTGGAAGGTGGCAGGAGG - Intergenic
934113982 2:88766338-88766360 AGTGAGTGGAACGGGGCCTGGGG + Intergenic
934500508 2:94857291-94857313 TGGGGTTGGATCGGGGCTTTGGG - Intergenic
934559973 2:95308178-95308200 TGGGGGTGGACGGGTGCCTGGGG - Intronic
934603830 2:95679437-95679459 TGGGAGTCTAACTGGGCATGTGG + Intergenic
934699055 2:96423909-96423931 TGGGGGTGGACAGAGGCAGGAGG - Intergenic
935222636 2:101028264-101028286 AGGGGCTGCAACGGGGCATGGGG + Intronic
936537209 2:113321664-113321686 TGGGAGTCTAACTGGGCATGTGG + Intergenic
937347072 2:121132611-121132633 TGGGGGTGCAGGGGGGGATGGGG + Intergenic
938196584 2:129334222-129334244 GGGGGGGGGGGCGGGGCATGAGG + Intergenic
938370165 2:130763617-130763639 TGGGTGGGGCACGGGGCGTGGGG - Exonic
938644758 2:133319151-133319173 AGGGGGTGGAAGGGGGCGGGGGG - Intronic
938777964 2:134558822-134558844 TGGAGGTGTTACGGGGCCTGGGG - Intronic
942190187 2:173461929-173461951 TGAGGGTTGAACTGGGCAGGTGG + Intergenic
942326640 2:174781761-174781783 TAGGGAGGGAAGGGGGCATGAGG + Intergenic
943109973 2:183592600-183592622 TGGGGGTGGGGCGGGGTAGGAGG + Intergenic
944420358 2:199523610-199523632 TGAGGGTGGAAGGTGGCAGGAGG - Intergenic
945222806 2:207502131-207502153 TTGGGTTGGAAAGGGGCAAGTGG - Intergenic
945718913 2:213393646-213393668 TAGGGGTGGAATTGGGGATGAGG + Intronic
948395686 2:237643324-237643346 TGGGGGTGGAGCCGGGCATTTGG + Intronic
948451918 2:238080947-238080969 AGGGGGTGGGAGGGGGTATGTGG - Intronic
1169914275 20:10671837-10671859 TGGGGGCGGAATGGGGCGGGGGG + Intronic
1170884224 20:20325129-20325151 TGGGGGTGGAGGAGGGTATGTGG - Intronic
1171185510 20:23121540-23121562 TGGGGGTGGGGCGGGGCATGCGG - Intergenic
1171424840 20:25042894-25042916 TGGGCGTGGAGAGGGGCATGTGG - Intronic
1171884175 20:30639874-30639896 TGGGGGTTGGAAGGGGGATGTGG - Intergenic
1172146803 20:32762887-32762909 TTGGGGTGGAACGGGGACAGCGG + Intronic
1173198075 20:40932427-40932449 TGGGGGCCAAACTGGGCATGAGG - Intergenic
1173528571 20:43751180-43751202 TGGGGGTGGATCTGGGCAGAGGG + Intergenic
1173658441 20:44716764-44716786 TGGCTGTGGACCGGGGCAGGAGG + Intronic
1174175150 20:48639896-48639918 TGGGGCAGGAAAGTGGCATGAGG + Intronic
1174837072 20:53866657-53866679 TGGGGGTGGTAAGGGAGATGAGG + Intergenic
1175520633 20:59600490-59600512 TGGGGGTGGAATTGGTCTTGGGG + Intronic
1175855234 20:62117588-62117610 TGAGGTTGGCACTGGGCATGAGG - Intergenic
1176703760 21:10093227-10093249 TGGGGGTGGCAGGGGGGTTGGGG + Intergenic
1176847044 21:13884780-13884802 TGGGGGTTGGAAGGGGGATGTGG - Intergenic
1176859861 21:14004461-14004483 TGGGGGTGGAGCGGGGTGGGAGG + Intergenic
1179494610 21:41763881-41763903 TAGGGGAGGAACGGGGCCTTTGG + Intronic
1179875100 21:44263086-44263108 TGGGGGTGGAACGTGGAAGCAGG + Intergenic
1180163746 21:46009521-46009543 TGGGGGTGGACGGAGGCCTGAGG + Intergenic
1180787095 22:18553340-18553362 TGGGGGTGGAGTGGGGGAAGGGG - Intergenic
1181052442 22:20244243-20244265 TGGGGTTGGAGCCGGGCAGGAGG + Intronic
1181234645 22:21441966-21441988 TGGGGGTGGAGTGGGGGAAGGGG + Intronic
1181244004 22:21492865-21492887 TGGGGGTGGAGTGGGGGAAGGGG - Intergenic
1181283780 22:21737658-21737680 ATGGGGTGGTGCGGGGCATGGGG - Intergenic
1181405778 22:22684215-22684237 GTGGGGAGGGACGGGGCATGAGG - Intergenic
1181417380 22:22770405-22770427 AGGGGGTGGAGCTGGGCATCAGG + Intronic
1181534420 22:23534246-23534268 AGGGGGTGGGAGGGGGCAAGGGG - Intergenic
1182031112 22:27160155-27160177 GGGAGGTGGAAGGCGGCATGGGG - Intergenic
1182120848 22:27785753-27785775 TGGGGCTGGGAGGGGCCATGGGG - Intronic
1182529173 22:30942029-30942051 TGGGGGTGGGCCGGGGGATCTGG - Intronic
1182898983 22:33882438-33882460 TGAGGGTGGAACTGGGTGTGGGG - Intronic
1183033320 22:35121604-35121626 TGGGGGAGGATTGGGGCATGGGG + Intergenic
1183698547 22:39436991-39437013 TGTGGGTGGCCCTGGGCATGGGG + Intronic
1183903204 22:41021725-41021747 CGGGGGTTGAGCGGGGCCTGCGG - Intergenic
1184103789 22:42355646-42355668 AGGGGGTGGGATGGGGCTTGAGG - Intergenic
1184390473 22:44200686-44200708 TGGCCCTGGGACGGGGCATGTGG - Intronic
1184453090 22:44594448-44594470 TAGGGGTGGGAGGGGGCAGGAGG - Intergenic
1184916985 22:47576022-47576044 TGGGGGTGGAACTCGGGGTGCGG + Intergenic
949334126 3:2954956-2954978 TTGGGGTGGTGCGGGGCAGGGGG - Intronic
949987696 3:9553287-9553309 GGGGGCTGGGACGGGGAATGGGG + Intronic
950161223 3:10762772-10762794 TGGGGGTGGAAGTGAGCATGAGG + Intergenic
950214905 3:11152618-11152640 TGGAGGTGGGAGGGGGGATGGGG - Intronic
950269845 3:11605160-11605182 TGGGGGTGGGCGGGGGCGTGGGG - Intronic
951296775 3:20946801-20946823 TGAGGGTGGAACAGGGGAAGAGG - Intergenic
952610688 3:35205694-35205716 TGTCGGTGGAAGTGGGCATGGGG - Intergenic
952856775 3:37778226-37778248 TGTGGATGGGATGGGGCATGAGG + Intronic
953306787 3:41838916-41838938 TGGGGGTGGAGTGGGGAATAGGG + Intronic
953920143 3:46946148-46946170 TGTGGGTGGGAAGGGGCAAGAGG - Intronic
954320863 3:49831190-49831212 TGGAGGTGGAAGGGAGCAAGAGG - Intronic
954374040 3:50184995-50185017 TGGGGATGGAAGTGGGAATGGGG - Intronic
954456121 3:50600770-50600792 GGGGGGTGGAGGGTGGCATGTGG - Intergenic
954698583 3:52440283-52440305 TGGGGGTGCATGGGGACATGAGG + Intronic
954748850 3:52802638-52802660 TGGGGGTAGAAGGAGGCAAGGGG - Intronic
955387646 3:58492175-58492197 TGGGGCTGGCGCGGGGCTTGCGG + Intronic
955717012 3:61840687-61840709 TGGGGGAGGGACAGGTCATGTGG + Intronic
956204069 3:66738094-66738116 TGGGGGTGGAACATAGAATGGGG + Intergenic
960465613 3:117993727-117993749 TGGGGGTGGGATGGGCCAAGTGG + Intergenic
961359797 3:126360079-126360101 TGTGTGTGGAACAGGGGATGAGG - Intergenic
961421695 3:126810867-126810889 TGGGGGTGGGATGGGGCAGGAGG + Intronic
961723030 3:128908627-128908649 TGGGGGTGGAGGGGAGCATGAGG - Intronic
961815626 3:129548701-129548723 TGGTGGGGGCATGGGGCATGAGG + Intronic
962475934 3:135755363-135755385 TGGGGGAGGCAGGGTGCATGGGG + Intergenic
963366762 3:144345049-144345071 TGGGTGTGGAAGGGGGGATAGGG - Intergenic
964476283 3:157100483-157100505 TGGGGGTGCAGCGGGGGTTGGGG + Intergenic
964570187 3:158102609-158102631 TGGGGTTGGAAAGAGGCTTGGGG - Intronic
964708605 3:159647342-159647364 AGAGGGTTGAACGGGGAATGAGG + Intronic
966861566 3:184233558-184233580 TGGGGCTGGAAGGGAGCATGAGG - Exonic
966887196 3:184383255-184383277 TGGGGGTGTAAGCGGCCATGGGG + Intronic
968460405 4:721842-721864 TGGGTGTGGAAAGAGGCCTGTGG + Intronic
968605540 4:1533415-1533437 TCGGGCTGGAACGCGGCCTGAGG - Intergenic
968734130 4:2286351-2286373 CGGGGGTGGGAGGGGGCATCAGG + Intronic
969262688 4:6043688-6043710 TGGGGGCTGAAAGGGGAATGGGG - Intronic
973393214 4:49573279-49573301 TGGGGGTTGGAAGGGGGATGTGG + Intergenic
973644855 4:52940190-52940212 TTGGGGTGGAAAGGTGCCTGAGG + Intronic
976292151 4:83430874-83430896 TGGGGGTGGAAGAGTGCAGGGGG + Intronic
980375976 4:131949579-131949601 TGGGGGTGGCAGGGGGGTTGGGG + Intergenic
981084164 4:140666274-140666296 TGGGGCTGGGAGGGGGCTTGAGG + Intronic
981369342 4:143940879-143940901 TGGGGGTGGAGTGGGGGAGGGGG + Intergenic
981379082 4:144050821-144050843 TGGGGGTGGAGTGGGGGAGGGGG + Intergenic
981549263 4:145926617-145926639 TGGGGGTGGAAGTTGGGATGAGG + Intronic
981951711 4:150417538-150417560 TGGGGGTGGAAGTGGGCAGCGGG - Intronic
982109322 4:152039511-152039533 TGGAGGTGGAAGGGGGCCTTTGG - Intergenic
984741260 4:183165546-183165568 TGGGTGTGGAAGGGGGTGTGGGG + Intronic
1202764917 4_GL000008v2_random:141640-141662 TGGGGGTTGGAAGGGGGATGTGG - Intergenic
985975485 5:3416529-3416551 TGGGGGTGGAAGGGGCAGTGTGG - Intergenic
986227224 5:5827089-5827111 TGGGAGTGGAATGAGCCATGTGG + Intergenic
988941673 5:36153492-36153514 TGGGGGTGGGAGTGGGCCTGGGG - Intronic
990661016 5:58015139-58015161 TTGGGGTGGAATGAGGCATTGGG - Intergenic
992501627 5:77349240-77349262 TGGGGATGGAAAGGGGCAGCAGG + Intronic
992886139 5:81162190-81162212 TGGGGGTGGTGGGGGACATGGGG + Intronic
995229695 5:109745117-109745139 ATGGATTGGAACGGGGCATGAGG + Intronic
995663210 5:114509702-114509724 TGGGGGTGGAAAGTGGGAAGAGG + Intergenic
995884901 5:116883396-116883418 TGGGGGAGGAATGGGCCAGGCGG + Intergenic
997187672 5:131898644-131898666 TGAGGGTGGAGCCTGGCATGGGG - Intronic
997200494 5:132007188-132007210 TGTGGGTAGAACTGGGCATGTGG - Intronic
997338031 5:133121630-133121652 TGGAGGTGAAATGGGGCAGGGGG + Intergenic
997554359 5:134782612-134782634 TGGGGTGGGAACGGGGGGTGTGG - Intronic
997665945 5:135629548-135629570 TGGGGGTGGAATGTGGAGTGAGG + Intergenic
998583717 5:143404573-143404595 TGGGGGTTGAACTTGGCAGGCGG - Intronic
999120499 5:149206063-149206085 TGGCGGAGGAAAGGGTCATGGGG - Intronic
999366319 5:151026079-151026101 TAGCGGTGGAATGGGGCATTTGG + Intronic
1000160849 5:158596294-158596316 TGGCTGGGGAAAGGGGCATGGGG - Intergenic
1000462857 5:161544727-161544749 TGGGGCAGGAATGGGGGATGGGG + Intronic
1001197045 5:169682813-169682835 TAGGGGTTGCACGGGGCTTGGGG - Intronic
1001233344 5:170008922-170008944 TGGGGGTAGAAGTGGGTATGGGG - Intronic
1001288219 5:170438795-170438817 TGGAGGGGGAATGGGGCATCAGG - Intronic
1001931691 5:175677771-175677793 TGGGGGTGGGCCGGAGCAGGTGG - Intronic
1002069878 5:176672845-176672867 AGGGGGTGTGGCGGGGCATGGGG + Intergenic
1002105875 5:176879249-176879271 TGGCGGTGGACCCGGGCCTGGGG + Intronic
1002198448 5:177513594-177513616 TTGGGGTGGCCAGGGGCATGGGG + Intronic
1002248223 5:177903799-177903821 TGGGTGTGGGAAGGGGCATTAGG - Intergenic
1003406396 6:5830066-5830088 TGGGGGTGGGGCAGGGTATGTGG + Intergenic
1003551002 6:7101855-7101877 TGGAGGGGGAACGAGGGATGGGG - Intergenic
1003577594 6:7312630-7312652 TGGGGGTGGAGCGGAGCCGGAGG + Intronic
1004193726 6:13486599-13486621 CGGGGGTGGGACGGAGGATGCGG + Intronic
1006136188 6:31897537-31897559 CGGGGGTGCAACGGGGCCGGGGG - Intronic
1006177274 6:32129987-32130009 TGTGGGTGGAACGGGGAAGCTGG - Intronic
1006379673 6:33690219-33690241 TGGGGCTGGATGGGGGCATGGGG + Intronic
1006656456 6:35598094-35598116 TTGGGGTGGAACGGGGAATTAGG - Intronic
1007996681 6:46315384-46315406 GAGGGGTGGAGCGGGGCCTGTGG + Intronic
1009794385 6:68449173-68449195 TGGGGGAGGACGGGGGGATGCGG - Intergenic
1012863627 6:104592092-104592114 TGGGGGTGGGAAGGGGGATGGGG + Intergenic
1012896741 6:104957568-104957590 TTGGGGTGGAATGGGGGAGGGGG - Intronic
1014104934 6:117551008-117551030 TGGGTGTGCAATGTGGCATGGGG - Intronic
1017084372 6:150700365-150700387 TGGGGCTGGAGTGGGGCCTGAGG - Intronic
1017584713 6:155908105-155908127 TGCAGGTGTAAGGGGGCATGAGG + Intergenic
1017777399 6:157690947-157690969 TGGGGGTGGAAGGGGACCCGAGG - Intergenic
1017809426 6:157974345-157974367 TGGGGGTGGAGCGGGCAATTTGG - Intergenic
1017900239 6:158713373-158713395 TGTGGGTGGCACAGGGGATGAGG - Intronic
1018381188 6:163259840-163259862 TGGGGGTGGAGCGGGGCGGATGG - Intronic
1018421287 6:163642793-163642815 TGGGGGTCACACGGGGCAGGTGG + Intergenic
1018871815 6:167789899-167789921 CAGGGGTGGATGGGGGCATGGGG - Intronic
1019160736 6:170065938-170065960 TGGGGGTGGATGGAGGGATGCGG - Intergenic
1019160932 6:170066516-170066538 TGGGGGTGGATTGAGGAATGGGG - Intergenic
1019160938 6:170066534-170066556 TGGGGGTGGATGGAGGGATGGGG - Intergenic
1019160946 6:170066552-170066574 TGGGGGTGGATGGAGGGATGGGG - Intergenic
1021593830 7:22293688-22293710 TGCTGGTGCAGCGGGGCATGGGG - Intronic
1025200060 7:56956587-56956609 TGGGGAGGGACCGGGGCCTGGGG - Intergenic
1025550871 7:62247041-62247063 TGGGAGTGCATTGGGGCATGCGG + Intergenic
1025671884 7:63620345-63620367 TGGGGAGGGACCGGGGCCTGGGG + Intergenic
1026742981 7:72990447-72990469 TGGGGGTGGGATGGGGGCTGTGG + Intergenic
1029453477 7:100655632-100655654 TGGGGCTGGACAGGGGCAAGAGG - Intronic
1029625643 7:101718755-101718777 TTGGGGTGGAACGGGGAGGGTGG - Intergenic
1031731432 7:125306642-125306664 TGGCGGTGGAAGGGTGGATGCGG + Intergenic
1031864412 7:127022513-127022535 TGGGGGTGGAGGGAGGAATGGGG + Intronic
1032122813 7:129169153-129169175 TGGGGCCGGGACGGGGAATGAGG + Intronic
1032284637 7:130531150-130531172 TGGGAGTGGGGCAGGGCATGGGG + Intronic
1032411129 7:131693929-131693951 TGGGGGCCGAGTGGGGCATGTGG + Intergenic
1034343123 7:150370382-150370404 TGTGGGTGGAAGAGGGCAGGCGG + Intronic
1034398830 7:150848101-150848123 TGGGGGTGAAGAGGGGCTTGTGG - Intronic
1034422147 7:150995841-150995863 TAGGGGTGGGACGGGGCAGAGGG - Intronic
1034424998 7:151009622-151009644 CGGGGGTGGGGCTGGGCATGGGG - Intronic
1034458059 7:151182218-151182240 TGGAGGAGGAAGGGGGCGTGGGG + Intronic
1036289286 8:7473199-7473221 TGGGGGTGGCGGGGGGCCTGTGG + Intronic
1036332195 8:7838333-7838355 TGGGGGTGGCGGGGGGCCTGTGG - Intronic
1037467145 8:19171984-19172006 TGGGGGTGGAACCTGGCCTTGGG - Intergenic
1038407540 8:27333250-27333272 TGGGGGTGGAACGGAAGATAAGG + Intronic
1038411317 8:27361830-27361852 TGGGTGTGGAGCGGAGCAGGGGG - Intronic
1039646115 8:39285103-39285125 AGGGGGTGGCATGGGGCAGGGGG - Intergenic
1040890973 8:52315393-52315415 GTGGGGTGGAATGGGCCATGTGG - Intronic
1043660041 8:82727783-82727805 AGGAGGTAGAAAGGGGCATGTGG + Intergenic
1044434008 8:92140943-92140965 GGTGGGTGAAATGGGGCATGAGG - Intergenic
1047635755 8:126760306-126760328 TGTGACTGGAAGGGGGCATGAGG - Intergenic
1049256014 8:141614349-141614371 TGGGGGTGGAGGGGAGCAGGAGG - Intergenic
1049412245 8:142478509-142478531 TGTGGGGGAAACGGAGCATGGGG + Intronic
1049692124 8:143966051-143966073 TGGAGGTGCCAGGGGGCATGTGG - Intronic
1049697873 8:143992435-143992457 TGGGAGAGGAACGGGCCATGGGG - Intronic
1049765696 8:144354333-144354355 TGGGGGTGGCGCGGCGCGTGAGG + Intronic
1049879410 8:145052152-145052174 TGGGGCTGGGGCGGGGCCTGGGG - Intergenic
1050150805 9:2617887-2617909 TGGGGGTGGAGGGGGGCCTGAGG - Intergenic
1050328269 9:4518611-4518633 TGGAGTTGGAATAGGGCATGAGG - Intronic
1051319550 9:15886967-15886989 TGGGGGTGGTTGGGGGAATGAGG + Intronic
1051781064 9:20689453-20689475 TGGGGGTGGGATGGGGTAAGTGG + Intronic
1051893444 9:21965810-21965832 TGGGGGTGGAAGGGGGAAAAAGG + Intronic
1052472785 9:28921334-28921356 TGGGGGTGGAATCAGGTATGTGG - Intergenic
1052834662 9:33241495-33241517 TGGGTGTGGGACTGGCCATGAGG - Intronic
1052988077 9:34502364-34502386 TGGGCCTGGAACAGGGCCTGGGG + Intronic
1053143804 9:35698537-35698559 TGGGGATGGACCAGGGCAAGGGG - Intronic
1053151267 9:35744725-35744747 TGTGAGTGGAAGGGGGCAGGTGG + Intronic
1053503288 9:38620401-38620423 TGGGGGTGGATCGCGGGTTGCGG - Intergenic
1053656658 9:40223254-40223276 TGGGGTTGGATCGGGGCTTTGGG + Intergenic
1054368777 9:64369532-64369554 TGGGGTTGGATCGGGGCTTTGGG + Exonic
1054527941 9:66152975-66152997 TGGGGTTGGATCGGGGCTTTGGG - Intronic
1054676405 9:67859284-67859306 TGGGGTTGGATCGGGGCTTTGGG + Exonic
1056386366 9:86099871-86099893 TCGGGGCGGAACGTGGGATGGGG - Intronic
1056578568 9:87873735-87873757 TCAGGGTGGCACGGGACATGGGG - Intergenic
1056759870 9:89406821-89406843 TGGGTGTGGAAGGCGGCATGTGG - Intronic
1056839676 9:89988325-89988347 TGGTGGTGGAAGGGAGCAGGAGG - Intergenic
1056882263 9:90407282-90407304 TGGGGGTGGGAGTGGACATGAGG - Intergenic
1057152847 9:92809546-92809568 TGGGGGTGGATCGCGGGTTGTGG + Intergenic
1059437894 9:114287441-114287463 TGTGGGTGGACCAGGGCCTGGGG + Intronic
1061181132 9:129025978-129026000 TGGGGGTGGGAGAGGGCAGGAGG - Intronic
1061192143 9:129088145-129088167 TGGGGGGGGATGGGGGGATGGGG + Intronic
1061320230 9:129823754-129823776 TAGGGCTGGAGCGGGGCCTGGGG - Intronic
1062044256 9:134417872-134417894 TTGGGGTGGGAGGGGGCAGGAGG - Intronic
1062410499 9:136421773-136421795 GGGGGGTGGAAGGTGGCACGGGG + Intronic
1062436189 9:136547563-136547585 TGGGGGTGGGGTGGGGCATAGGG + Intergenic
1062470584 9:136701876-136701898 TGGGGGTGGATGAGGTCATGAGG - Intergenic
1062608004 9:137356885-137356907 AGGGTGTGGACCAGGGCATGGGG - Intronic
1202788797 9_KI270719v1_random:63322-63344 TGGGGGTGGCAGGGGGGTTGGGG + Intergenic
1203545667 Un_KI270743v1:126528-126550 TGGGGGTTGGAAGGGGGATGTGG - Intergenic
1186606888 X:11101710-11101732 TGGGGGTGGAGCATGGCAGGTGG - Intergenic
1187091026 X:16096811-16096833 TGGGGGTAGAGAGGGGCAGGAGG - Intergenic
1189113554 X:38320267-38320289 TGGGGGAGGGGCGGGGCAAGGGG + Intronic
1189858047 X:45243393-45243415 TGGGGGTGGTGTGGGGCAAGGGG - Intergenic
1190326816 X:49211546-49211568 TGGGGGAGGACTGGGGAATGAGG + Intronic
1190594862 X:52042230-52042252 TGGGTGGGGAACAGGGCAAGTGG + Intergenic
1190598207 X:52066835-52066857 TGGAGGTGGCAGGGGGCAGGGGG + Intronic
1190610617 X:52187238-52187260 TGGAGGTGGCAGGGGGCAGGGGG - Intronic
1190613962 X:52211843-52211865 TGGGTGGGGAACAGGGCAAGTGG - Intergenic
1190737643 X:53266422-53266444 TGGGAGTGGCAGAGGGCATGGGG + Intronic
1192182220 X:68923222-68923244 TGGGGGTGGGATGGGGGAGGTGG - Intergenic
1194452002 X:94055066-94055088 TGGGGGTGGGAGGGGGTGTGTGG + Intergenic
1194774405 X:97944670-97944692 TGGTGGTGGTATGGGGCAGGGGG - Intergenic
1194948603 X:100097874-100097896 TGGGGGTGGAAGGTGGGAGGAGG + Intergenic
1195108859 X:101625096-101625118 TGAGGGTGGATCTGGGGATGTGG + Exonic
1195431303 X:104792404-104792426 TGGGTGGAGATCGGGGCATGAGG + Intronic
1195537551 X:106026184-106026206 TGGTGGTGGTACGGGGGAAGCGG - Intergenic
1195748263 X:108139469-108139491 GGGGTGTGGAGCGGGGCGTGGGG + Intronic
1196014842 X:110927748-110927770 TGAGGGTGGAGCGGGGGAGGAGG + Intergenic
1197573238 X:128176146-128176168 TGGGGGTGGAAGGTGGGAGGAGG + Intergenic
1197780514 X:130154619-130154641 TGTGGGTGGAAAGGTGGATGGGG + Intronic
1197800818 X:130346189-130346211 TTGGGGTGGGAAGGGGCAGGAGG + Intronic
1199894796 X:152118774-152118796 TGGGGATGGAAATGGGGATGGGG + Intergenic
1199947108 X:152679067-152679089 TGGGGGTGGAAATGGGGGTGGGG - Intergenic
1199962573 X:152789387-152789409 TGGGGGTGGAAATGGGGGTGGGG + Intergenic
1200017705 X:153179184-153179206 TGGGGGTGGGAGTGGGCGTGGGG - Intergenic
1200049773 X:153422560-153422582 TGGTGGTGGGGCGGGGCAGGGGG - Intergenic
1200203054 X:154295725-154295747 AGGGAGTGGCACGAGGCATGCGG + Exonic
1200239396 X:154486022-154486044 TGGGGGTGGCCCGGGGCGCGAGG + Intronic