ID: 1162525157

View in Genome Browser
Species Human (GRCh38)
Location 19:11202548-11202570
Sequence GTTGGGGGTGGAACGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 449}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162525157_1162525168 0 Left 1162525157 19:11202548-11202570 CCATGCCCCGTTCCACCCCCAAC 0: 1
1: 0
2: 2
3: 54
4: 449
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162525157 Original CRISPR GTTGGGGGTGGAACGGGGCA TGG (reversed) Intronic
900522969 1:3115108-3115130 GATGTGGGAGGAGCGGGGCAGGG - Intronic
901056815 1:6452151-6452173 GTTGGGGGTGGCGTGGGGGATGG - Intronic
901158342 1:7155385-7155407 GTTGGGGGGGGGATTGGGCAGGG + Intronic
902470804 1:16646713-16646735 AGTGGGGGTGGAGAGGGGCAGGG + Intergenic
902477552 1:16696354-16696376 GTTGGGGGTGGCGTGGGGGATGG + Intergenic
902487996 1:16760735-16760757 AGTGGGGGTGGAGAGGGGCAGGG - Intronic
902712528 1:18250065-18250087 GTGGGGGATGGAAGGGGGGAGGG - Intronic
902776214 1:18676517-18676539 GTTGGGGGAGGAGAGGGGAAAGG + Intronic
902990999 1:20186787-20186809 GTTTGGGGTAGAACTGGGAATGG + Intronic
903082332 1:20820502-20820524 GTCCTGGGTGGAAGGGGGCAGGG + Intronic
903135903 1:21309039-21309061 GTTGGGACTGGAACTGGGCCAGG + Intronic
903163736 1:21507104-21507126 TTTGAGGGTGGAAGGTGGCAGGG + Intergenic
903693009 1:25187424-25187446 GCTGGGGGGGGAGCGGGGCGGGG - Intergenic
903913405 1:26745578-26745600 GTTGGGGGTGGGAGGGGAGACGG - Intronic
904086981 1:27916214-27916236 GTTGGGGGAGGAAGGGGGATGGG - Intergenic
905796448 1:40819003-40819025 GGTGGGGCTGGAGCGGGGCTAGG + Intronic
906296312 1:44651051-44651073 GTTGGGGGAGTAGTGGGGCACGG + Exonic
907274785 1:53311138-53311160 GATGGGGGTGGACCAGGGCAGGG - Intronic
907274800 1:53311179-53311201 GTTGGGGGTGGGCAGGGGCCTGG - Intronic
907318110 1:53585536-53585558 AATGGGGGTGAAACAGGGCAGGG + Intronic
909335264 1:74465524-74465546 GTTGGGGGGGGACTCGGGCATGG - Intronic
911035510 1:93541582-93541604 GTGGGGGGTGGGGCGGGGCGGGG + Intronic
912384223 1:109263331-109263353 GTTGGGGCAGGCACTGGGCAGGG + Intronic
913303677 1:117400160-117400182 GATGTGGGAGGAACAGGGCAGGG - Intronic
914921050 1:151847692-151847714 GGTGGTGGTGGGACGGGGCCTGG + Intronic
915347092 1:155203031-155203053 ATTGGGTGGGGAACGTGGCACGG + Intronic
915523655 1:156463401-156463423 GTTGGGGGTGGGAGTTGGCACGG - Intergenic
915717313 1:157956849-157956871 GTGGGGGTTGGAACTGGGTAAGG - Intergenic
917755488 1:178094080-178094102 GCTGGGGATGGAGCGGGGCCGGG - Intergenic
917793359 1:178513926-178513948 GTTGTGGGGGGCAGGGGGCAGGG + Intronic
918142975 1:181733764-181733786 GTTGGGGGTGGAGGGGAACAGGG - Intronic
918162945 1:181918462-181918484 GTTGTGTGTGGGAGGGGGCATGG - Intergenic
918313721 1:183305293-183305315 GCAGGGGGTGGAGTGGGGCAGGG + Intronic
918965878 1:191347205-191347227 TTTGGGGTTGGCACGGGGTAGGG + Intergenic
919801577 1:201357690-201357712 GTTGGGGGTGGGGCTGGGAACGG - Intergenic
919990977 1:202708764-202708786 GTGGCAGGTGGAAGGGGGCAGGG - Intronic
920314330 1:205066648-205066670 GTAGGAGGTGGAAAGGGTCAAGG + Intronic
920825881 1:209423872-209423894 TGTGGGGGTGGAAGGGGCCAGGG + Intergenic
921063948 1:211609625-211609647 GTTGGGGGCTGCAGGGGGCATGG - Intergenic
921072584 1:211674832-211674854 GACTGGGGTGGAATGGGGCAGGG - Intronic
922176157 1:223199694-223199716 GTGGGGGGGGGAAGGGGGGAGGG - Intergenic
922451898 1:225744231-225744253 GTTGGGGGTGGGCAGGGGAACGG + Intergenic
923147247 1:231206888-231206910 GTGGGGGGTGGTGCTGGGCACGG + Intronic
923151815 1:231240681-231240703 CTTGGGGGTGGCATGGGGAAAGG + Intronic
923701088 1:236301194-236301216 ATTGGGGGTGGAACGGGCCATGG - Intergenic
923994176 1:239472721-239472743 GTTGGGGGTGGGATGGAGGAGGG + Intronic
924547604 1:245044838-245044860 GTTGGGGCTGGGTCGGGGGAGGG - Intronic
1065503339 10:26403291-26403313 GTCGGGGGTGGTGGGGGGCAAGG + Intergenic
1065917437 10:30365293-30365315 GTTGGGGGCAGAGCAGGGCAGGG - Intronic
1066059048 10:31706294-31706316 CTTGGGGGTGGCATGGGGAAGGG - Intergenic
1067552753 10:47246884-47246906 GCAGGGAGTGGGACGGGGCAGGG + Intergenic
1068582378 10:58756360-58756382 TGTGGGGGTGGAGAGGGGCATGG + Intronic
1071512554 10:86272401-86272423 GCTGGGGGAGGGATGGGGCATGG - Intronic
1071520409 10:86328763-86328785 GGTGGGGGTGGAGGGGGGAACGG - Intronic
1073113064 10:101074064-101074086 GTTGGGGGTAGAGCGTGGCGGGG + Intergenic
1073214697 10:101829806-101829828 GGTGGGGGCGGGGCGGGGCAGGG - Intronic
1073229927 10:101960506-101960528 GGTGAGGGTGGAATGGGGCATGG - Intronic
1073310218 10:102534983-102535005 GTAGGGGGTGGAGGTGGGCATGG - Intronic
1074126083 10:110530119-110530141 GTCGGGGGTGGGGCGGGGCTGGG - Intergenic
1074476593 10:113780121-113780143 GTTGGGGTGGGGATGGGGCAGGG + Intronic
1075724983 10:124606478-124606500 GGTGGAGGTGGGAGGGGGCAGGG + Intronic
1075788981 10:125069876-125069898 GTGGGGGGGGGAGGGGGGCAGGG - Intronic
1076037767 10:127215154-127215176 ATTGGGTGTGGAACGTGGCTGGG - Intronic
1076319476 10:129567300-129567322 GATGGGGGTGGGAGGTGGCAGGG - Intronic
1076444570 10:130503841-130503863 GTTGGGGATGGAAGTAGGCATGG - Intergenic
1076550378 10:131274022-131274044 GTTGAGAGAGGAACGGGGCCTGG + Intronic
1076811984 10:132891319-132891341 GTCGGGGGTGGTAGGGGGCAAGG + Intronic
1078093563 11:8282892-8282914 GGTGGCGGTGTGACGGGGCAGGG - Intergenic
1078882709 11:15467559-15467581 GTTGGGGGTGGGGAAGGGCATGG + Intergenic
1079863397 11:25703446-25703468 GTTGCGGGGGGCAGGGGGCAGGG + Intergenic
1080646274 11:34190253-34190275 TTTGGGGGGGCAGCGGGGCAGGG - Intronic
1080647763 11:34199285-34199307 GGTGGTGGTGGAAAGGGACAAGG - Intronic
1083810081 11:65099261-65099283 GAGGGGGGTGGAACAGAGCAGGG + Intronic
1084363832 11:68685103-68685125 GATGGGGGTGGAAAGTGGAAAGG + Intronic
1084403036 11:68956047-68956069 TCTGGGGGTGGGGCGGGGCAGGG + Intergenic
1084560144 11:69900490-69900512 GTTGGGGTTAGACCAGGGCAAGG - Intergenic
1084797577 11:71518880-71518902 CGTGGGGGTGGCACAGGGCAGGG + Intronic
1085400819 11:76234501-76234523 GTGGGGGGTGGAAAGGGGTGGGG + Intergenic
1085968477 11:81557639-81557661 CTTGGGGGTGGAAGGGGGTAAGG + Intergenic
1086448336 11:86891082-86891104 GCTGGGGGTGGAACAGTGGAAGG - Intronic
1088245415 11:107813642-107813664 GTTGGGAGTGGAACTGTACATGG - Intronic
1088723184 11:112612408-112612430 GTTGGGGGTGGGAGGGGGGAGGG + Intergenic
1089156932 11:116409713-116409735 GCTGGGGGAGGGAGGGGGCATGG + Intergenic
1089335254 11:117718359-117718381 GTTGGGGGTGAAAGGGGTTATGG + Intronic
1089361644 11:117892656-117892678 AGTGGGGGTGGAGTGGGGCAAGG - Intergenic
1089540937 11:119188578-119188600 GTTGGGGCAGGAGTGGGGCAGGG + Intronic
1089983918 11:122795231-122795253 GTTGGAGATGGAAGGAGGCAGGG + Intronic
1090276630 11:125424637-125424659 GGTGCTGGTGGAGCGGGGCATGG - Intronic
1090664548 11:128905756-128905778 GCGGGGGGAGGAAAGGGGCACGG + Intronic
1091286393 11:134410996-134411018 GCTGGGGGAGGAAGGGGACAGGG + Intronic
1091380405 12:54486-54508 GGTGGGGGTGCAATGGGGGAGGG + Intergenic
1091750379 12:3018458-3018480 GGTGGGGGTAGGACCGGGCAGGG - Intronic
1092163734 12:6329953-6329975 GGTGAAGGTGGAACTGGGCACGG + Exonic
1093161779 12:15755348-15755370 GTTGGAGGAGAAAAGGGGCAAGG + Intronic
1093787284 12:23207344-23207366 GTTGGGGGTGGGTGGGGGCGTGG - Intergenic
1094025584 12:25957939-25957961 GTTGGGAGTGCAGCGGGGCGGGG + Intergenic
1094449533 12:30570014-30570036 GTTGGGGGTGGGAGGGGGGCAGG - Intergenic
1094762183 12:33546696-33546718 GGTGGGGAGGGAAGGGGGCAAGG + Intergenic
1096059139 12:48681830-48681852 GTTCGGGGTGGGGCCGGGCATGG - Intronic
1096154656 12:49335241-49335263 TTTGGGGGAGGAAAGAGGCAAGG - Intronic
1096436148 12:51592035-51592057 GGTGGGGGTGGGATGGGGGAAGG - Intronic
1096979092 12:55718235-55718257 GTGGGGGCTGGAGCGGGGAAGGG - Intronic
1097705784 12:62866924-62866946 GTGTGGGGTGGAAGGGAGCAGGG - Intronic
1098545652 12:71708077-71708099 GTAGGGGGTGGGACAGGCCAGGG + Intergenic
1101152020 12:101891768-101891790 GTGGTGGGTGGAGCTGGGCAGGG + Intronic
1102036527 12:109773534-109773556 GTTGGGGGTGGGACGGGGTGTGG - Intergenic
1102290376 12:111694338-111694360 TTTGGGGGTGGTAAGGAGCAGGG - Intronic
1102554702 12:113719257-113719279 GTTGGGGAAGGGACTGGGCATGG + Intergenic
1102651525 12:114445846-114445868 GGTGGGGGTGGAAGTGGGCCGGG + Intergenic
1103238960 12:119397885-119397907 GGTGGGGGAGGAAGGGGGCAGGG + Intronic
1103736551 12:123064438-123064460 GCTGGGGGTGGCACAGGGCAGGG + Intronic
1104011096 12:124930757-124930779 GCTGGGGGTGGGAGGTGGCATGG - Intergenic
1104188427 12:126454833-126454855 GTTGGGGGTGGAGGTGGGGAAGG - Intergenic
1105831409 13:24165563-24165585 GTGGGGGGTGCAACCGGGAAGGG - Intronic
1107732142 13:43359065-43359087 GGTGGGGGTGGGGAGGGGCAGGG - Intronic
1108310166 13:49181389-49181411 GATGGGGGTGGGGAGGGGCAGGG - Intronic
1108588489 13:51891856-51891878 GTGGGGGTTGGAGGGGGGCAAGG + Intergenic
1108680967 13:52779772-52779794 GTTGGGGTTGGACCTGGGCAGGG - Intergenic
1108972269 13:56392464-56392486 GGTGGGGGTGGGAGGGGGAAAGG + Intergenic
1109308046 13:60662161-60662183 GGTGGGGGTGGCAGGGGGCGGGG - Intergenic
1113766899 13:112887598-112887620 GCTGGGAGTGGCAGGGGGCAGGG - Intergenic
1114474820 14:22986853-22986875 GCTTTGGGTGGAACTGGGCAGGG + Exonic
1114655251 14:24311769-24311791 GTGGGGGGTGGAAAGGGACAGGG - Exonic
1114665061 14:24372739-24372761 GTTGGGGGAGGAGGGGTGCAAGG + Intronic
1116784556 14:49273042-49273064 GTTGGGGGTGCATGGGGGCAAGG - Intergenic
1117164569 14:53020583-53020605 GATGGGGGTGGGAAGGGGGATGG + Intergenic
1118064953 14:62180523-62180545 GGTGGGGGTGGTCGGGGGCAGGG + Intergenic
1118765728 14:68908187-68908209 GGTGGGGGTGGGGCGGGGCACGG + Intronic
1118838098 14:69490829-69490851 GTAGGGGGTGGAACTGGAGAAGG - Intronic
1120936226 14:89898165-89898187 GTTGGGGGTGAATGTGGGCATGG - Intronic
1121019759 14:90572848-90572870 GTTGGGAGTGGAGTGGAGCATGG - Intronic
1121412345 14:93756757-93756779 ATTGGGGGAGGAGAGGGGCAGGG - Intronic
1121446972 14:93984989-93985011 TTAGGGAGTAGAACGGGGCATGG + Intergenic
1121570200 14:94941488-94941510 GGTGGGGGTGACACAGGGCAGGG - Intergenic
1121704964 14:95984791-95984813 GTTGGGTGGGGCACAGGGCAAGG + Intergenic
1121837724 14:97106951-97106973 GTTGGGGGTGGGTGGGGGGAGGG + Intergenic
1122156695 14:99754351-99754373 GTGGGGGGAGGCAGGGGGCAGGG - Intronic
1122217325 14:100212953-100212975 GCTGGGGGTGGCATGGGGTAGGG + Intergenic
1123690852 15:22837603-22837625 GCTGGGGGCGGGACGGGGCGGGG - Intergenic
1124133234 15:27008973-27008995 GGTAGGGGTGGGACGGGGCGAGG + Intronic
1125360471 15:38859356-38859378 TTTGGGGGAGGGATGGGGCAAGG + Intergenic
1125436026 15:39645876-39645898 GTCCGGGGTGGAAGGGGGCAGGG + Intronic
1125626721 15:41115607-41115629 TTTGGGGGTGGGCAGGGGCAGGG - Intronic
1126835940 15:52664942-52664964 GTTGGGGGTGGGGGGGTGCAGGG + Intronic
1127976298 15:63999674-63999696 GGTGGGAGAGGAATGGGGCAGGG - Intronic
1128892328 15:71342535-71342557 GTTGGGGGTGGGCAGGGGGAAGG - Intronic
1129254940 15:74328936-74328958 GATGGGGGAGGAAATGGGCATGG - Intronic
1129262244 15:74374869-74374891 GATGAGGATGGAGCGGGGCAGGG - Intergenic
1129666336 15:77581654-77581676 GTTAGGTGTGGGCCGGGGCAGGG - Intergenic
1129865827 15:78907870-78907892 GTGGGGGGTGGTGCGGGGGAAGG + Intergenic
1129968168 15:79755330-79755352 GTTGGTGGTGGAAGGGGTCCAGG + Intergenic
1129989363 15:79948844-79948866 GGTGATGGTGGAACGGGGGAAGG - Intergenic
1129989747 15:79951461-79951483 GTTGGGGGAGGGAAGGGGCCGGG + Intergenic
1131149252 15:90036664-90036686 GCTGGGGGTGGGGCAGGGCATGG + Intronic
1132896196 16:2230478-2230500 GTGGGAGGTGGGGCGGGGCATGG + Intronic
1133040075 16:3056062-3056084 GGTGGGGGTGGTACAGGGTAGGG + Intronic
1133043951 16:3075907-3075929 GGTGGGGGTGGTACAGGGTAGGG + Intronic
1133179100 16:4039186-4039208 GATGGGGGTGGAAAGGGGCTTGG - Intronic
1133756657 16:8767231-8767253 CTTGGGGCTGGAAAGGGACAGGG + Intronic
1134549501 16:15132390-15132412 GTTAGGGGAGGGAAGGGGCAGGG + Intronic
1134592526 16:15466857-15466879 GCTAGGGGTTGAATGGGGCAAGG - Intronic
1134694726 16:16215073-16215095 GTAGAGGGTGGAACGGAGAAAGG - Intronic
1135280253 16:21148112-21148134 GATGAGGGTGGGATGGGGCAGGG + Intronic
1135323700 16:21512944-21512966 GTTGGGGATGGAGGGGTGCAGGG + Intergenic
1135698470 16:24610780-24610802 GCAGGGGGTGGAAAGGGGGAAGG - Intergenic
1136335183 16:29606209-29606231 GTTGGGGATGGAGGGGTGCAGGG + Intergenic
1136513423 16:30753329-30753351 GCAGGGGGTGGGACAGGGCAGGG + Intronic
1137071648 16:35909295-35909317 GATGGGGGTGTAAAGTGGCAGGG + Intergenic
1138449605 16:57085613-57085635 CTTTGGGGAGGAAGGGGGCAGGG - Intergenic
1138590106 16:57995128-57995150 GGTGGGGCTGGAAGAGGGCAGGG + Exonic
1141714831 16:85720795-85720817 GTTGGGGGTGGCGCTGGGCGTGG + Intronic
1141762731 16:86039193-86039215 GTTGGGGGCGGAACGCTGCAGGG - Intergenic
1141789758 16:86226560-86226582 ATTGGGGGTGGTAGGGGGGAAGG + Intergenic
1142035907 16:87862043-87862065 GTTGGGGGTGGAGGGGTGCAGGG + Intronic
1142157920 16:88541033-88541055 GTGGGGGGCGGAAAGGGGCAGGG + Intergenic
1142221393 16:88856729-88856751 GCGGGCGGTGGGACGGGGCAGGG - Intronic
1142238553 16:88934706-88934728 TTCGGGGGTGGAAGAGGGCAGGG - Intronic
1142526933 17:549477-549499 GTGGAGGGTGGGACGGGGCAGGG + Intronic
1142956712 17:3527752-3527774 GATGGGGGTGGAAGAGGACAAGG + Intronic
1143966054 17:10757149-10757171 GTTGGGGGTGGCATTGGGCCCGG + Intergenic
1144785739 17:17830693-17830715 GTGGGAGGTGGGACGGGGCTGGG - Intronic
1145018496 17:19413489-19413511 GATGGGGATGGGACGGGGCAGGG + Intronic
1145265991 17:21379786-21379808 GTTGGGGGTGGGGGGGGGCCTGG + Intronic
1145976789 17:28988534-28988556 GTTGGGGCTGTGATGGGGCATGG - Intronic
1146093672 17:29907348-29907370 GTTGGGGGTGGAGTGGGGGGAGG + Intronic
1146787405 17:35731904-35731926 GTCAGGGGTGGAGCGGGGCCGGG + Intronic
1146943973 17:36861835-36861857 CTTGGGGGTGGAGAGGGACAGGG + Intergenic
1147118848 17:38323260-38323282 GTTGGGGGAGGCAGGGGCCATGG + Intergenic
1147171920 17:38625606-38625628 GTTGGGGGAGCAAAGGGGCATGG + Intergenic
1148180272 17:45600431-45600453 GTGGGTGTTGGGACGGGGCAGGG + Intergenic
1148213143 17:45820123-45820145 CTTGGGGCTGGAACAGGGCTGGG - Intronic
1148235746 17:45967917-45967939 GTTGTGGGAGGAACTGGCCAGGG - Intronic
1148615892 17:48999042-48999064 GTTGGGGGTGGGAAGAGGAAGGG - Intronic
1148868132 17:50639695-50639717 GTTGGGGCTGGCAGGGGGCAGGG + Intronic
1149355381 17:55834347-55834369 GTTGGGGGTGGAGCAGGGAGAGG - Intronic
1150128350 17:62652999-62653021 GTTGGGGGAGAAAGGGGTCAAGG + Intronic
1150284096 17:63945794-63945816 GTTGGGGGTGGTAAGGGGGAGGG + Intronic
1150645779 17:66976649-66976671 CCTGGGGGTGGGGCGGGGCAGGG - Intronic
1151013814 17:70531211-70531233 GTTGGGGGTGGAGGGGTGGAGGG + Intergenic
1152238001 17:79148412-79148434 GTTGGGGGGTGGAAGGGGCAGGG + Intronic
1152362740 17:79839932-79839954 GCAGGGGGCGGAATGGGGCAGGG + Intergenic
1152388932 17:79991695-79991717 GGTGGGGGTGGGGCGGGGCGGGG + Intronic
1152407310 17:80105038-80105060 GGTGGGGGTGGTACGGGTCAGGG - Intergenic
1152545082 17:80996404-80996426 GTTGGTGGGGGAACGTGGTATGG - Intronic
1154413148 18:14153797-14153819 GTTGGGGGTGGAGGGGGGGTGGG - Intergenic
1157072336 18:44422660-44422682 GTGGGAGGTGGGAAGGGGCAGGG - Intergenic
1157606435 18:48928854-48928876 ATTGAGGGTGGCACGGGGCAGGG + Intronic
1158273823 18:55745001-55745023 GATGGGGTTGGAAAGAGGCATGG + Intergenic
1158319647 18:56248882-56248904 GGTGGGGGTGGAGGGGGGCAGGG + Intergenic
1158406582 18:57165434-57165456 GTGGGGGGAGGAATGGGGGAGGG - Intergenic
1158657969 18:59358584-59358606 GTGGGGGGTGGAAGCGGGAAAGG + Intronic
1160105798 18:75974895-75974917 GTTGGGGGAGGAAGGAGGGAAGG - Intergenic
1160676302 19:393145-393167 GTTGGGGGAGGATGGAGGCAGGG + Intergenic
1160863237 19:1246375-1246397 GTCGGGAGTGGAATGGGACACGG - Intergenic
1160867686 19:1262928-1262950 AATGTGGGTGGAGCGGGGCAAGG + Intronic
1160906761 19:1455318-1455340 CGTGGGGGAGGAACGGGGCCTGG + Intronic
1160913913 19:1487796-1487818 GCTGGGGGTGTAGCGGGGCTGGG + Exonic
1160914619 19:1490756-1490778 GTAGGGGCGGGAACGGGGCGAGG - Exonic
1161054998 19:2186393-2186415 CTTGTGGGTGGAGAGGGGCAGGG + Intronic
1161286694 19:3472109-3472131 GTTGGGAGTGGGACGTGGGAAGG - Intergenic
1161512591 19:4679759-4679781 GTGGGGGGTGGGACGAGGCGGGG - Intronic
1161644451 19:5444529-5444551 GATGGGGGTGGCAGGGGCCAGGG - Intergenic
1162159362 19:8699953-8699975 GTTGGGGATGGAGAGAGGCAGGG + Intergenic
1162320708 19:9969555-9969577 GTGGTGAGTGGAGCGGGGCAGGG - Exonic
1162515170 19:11143065-11143087 GTTGGGGGGGGCACGGGCCCTGG + Intronic
1162525157 19:11202548-11202570 GTTGGGGGTGGAACGGGGCATGG - Intronic
1162781618 19:13009875-13009897 TTTGGTGGTAGAACGGGGCCGGG + Intronic
1163034043 19:14561436-14561458 GATGGGGGTGCAGAGGGGCAGGG - Intronic
1163437421 19:17303594-17303616 GTTGGGGGAGGGATGGGGCCTGG + Intronic
1165300083 19:34963344-34963366 CTTGGGGGTGGGGTGGGGCACGG - Intronic
1165419600 19:35716395-35716417 GTTAGGGGTGGATCGGGCCACGG - Intronic
1165724996 19:38106606-38106628 GTTGGGGGTGTAAGGGAGCAGGG - Exonic
1165948620 19:39459891-39459913 GATTGGGGAGGAACGGGCCACGG + Exonic
1165992353 19:39823874-39823896 GTTGGGAATGGATCAGGGCAGGG - Intergenic
1166782243 19:45348790-45348812 GTTGGGGGAGGCACAGGTCAGGG - Intronic
1166889448 19:45981608-45981630 GTTGAGGCTGGAGCGGGGGAGGG - Intergenic
1167503855 19:49861421-49861443 GTTGGGGATAGCAGGGGGCAGGG - Intronic
1167564667 19:50248908-50248930 GTCGGGGGTGAACCGGGGAAGGG - Intronic
1168719539 19:58547326-58547348 GTTGGGGGTGGTGAAGGGCAAGG + Intronic
1202703203 1_KI270713v1_random:3505-3527 AGTGGGGGTGGAGAGGGGCAGGG + Intergenic
1202711573 1_KI270714v1_random:22180-22202 GTTGGGGGTGGCGTGGGGGATGG + Intergenic
925098477 2:1226414-1226436 GCTGGGGATGGAGCGTGGCACGG - Intronic
926163206 2:10502352-10502374 GTTGGGGGTGGAGGGGGGCGTGG - Intergenic
926693791 2:15756214-15756236 GTTGGGGCTGCAGCAGGGCAGGG - Intergenic
927328295 2:21832228-21832250 GGTGGAGGTGGCAGGGGGCAAGG + Intergenic
928025360 2:27735319-27735341 GGTGGGGTTGGAAGGGGTCAGGG - Intergenic
928118839 2:28567025-28567047 GTTGGGGGTGGAACGAGGTTCGG + Intronic
932312653 2:70756162-70756184 GTTGGGGGAGGAAAGGGGGTAGG - Intronic
932368876 2:71171460-71171482 GCTGGGGCTGGGACGGGGAAGGG - Intergenic
932421831 2:71605812-71605834 CTTGGGGGAGGAATGGGGGATGG - Intronic
932538080 2:72620285-72620307 GTTGTGGGTGGTGGGGGGCAGGG + Intronic
932803799 2:74766037-74766059 GTTGGGGATGGAAGGGGAGATGG + Intergenic
932822957 2:74916793-74916815 GTAGGGGGTGGGAGGAGGCAAGG + Intergenic
933578728 2:84100754-84100776 GGTGGGGGTGTGAGGGGGCAGGG + Intergenic
934712951 2:96527597-96527619 GGTGGGGGTGGAATGGGGTGGGG + Intergenic
934736875 2:96694116-96694138 GCTGGGGGTGGGACGGGGAGGGG - Intergenic
935222634 2:101028262-101028284 TTAGGGGCTGCAACGGGGCATGG + Intronic
936463188 2:112726306-112726328 TCTGGGGGTGGGATGGGGCAGGG + Intronic
936493379 2:112995492-112995514 GTGGGTGGTGGCACGCGGCACGG + Intergenic
936701698 2:115018707-115018729 GTTGGGGGTGTAAGGGGCTAGGG + Intronic
937102121 2:119279825-119279847 GATGGGGGTGGTGCTGGGCAGGG - Intergenic
937157853 2:119733999-119734021 ATTGGGGGTGTAGCGGGGGATGG - Intergenic
937326387 2:120991838-120991860 GTTGGGGGTGGAAAGGGGAAGGG + Exonic
937347070 2:121132609-121132631 GTTGGGGGTGCAGGGGGGGATGG + Intergenic
937766535 2:125667288-125667310 GTTGTGGGTGGGACTGGACAGGG + Intergenic
938103207 2:128512292-128512314 GCTGGGGGTGGTACGCGGCAGGG + Intergenic
938252027 2:129822802-129822824 GTTGAGGGTGTAAAGTGGCATGG + Intergenic
938644760 2:133319153-133319175 GCAGGGGGTGGAAGGGGGCGGGG - Intronic
938751444 2:134334525-134334547 GTTGGGGGTGGGATGGGGTGAGG + Intronic
939957013 2:148535599-148535621 TATGGGGGTGGGGCGGGGCAAGG - Intergenic
941660653 2:168192512-168192534 GATTGGGGTGGAATGGGGCGGGG - Intronic
941870952 2:170385112-170385134 ATGGGGGGAGGAAGGGGGCATGG + Intronic
942380475 2:175385869-175385891 GATGGGGGTGGCCCGGGGCCAGG - Intergenic
943703803 2:191014202-191014224 GGTGGGGGCGGAAGGGGGCCGGG - Exonic
945939272 2:215932181-215932203 GCTGGGAGTGGCACGGGGCTGGG - Intergenic
946174145 2:217912380-217912402 TTGGAGGGTGGAAAGGGGCAGGG - Intronic
946396411 2:219445738-219445760 GCTGGGGGTGGCAGGGGGCTGGG + Intronic
946936915 2:224731823-224731845 GTTGAGAGTGGAAAGAGGCATGG - Intergenic
947665797 2:231904615-231904637 GGTGGGGGTGGAGCCAGGCATGG + Intergenic
947970313 2:234317876-234317898 GTTGTAGGTGGAGTGGGGCAGGG + Intergenic
948339776 2:237240269-237240291 GTTGGGAATGGAGTGGGGCAGGG - Intergenic
948436424 2:237956748-237956770 TTGGGGGGTGGAACGGGGGTGGG - Intergenic
1168792702 20:590586-590608 CTTGGTGGTGGAAGAGGGCAGGG + Intergenic
1168794743 20:604121-604143 GGTGGGGGTGGGGCGGGGGAAGG - Exonic
1169227213 20:3864316-3864338 CCTGGGGGTGGAACGGGCCAGGG - Exonic
1169425847 20:5496894-5496916 GATGGGGGTGGATGGGGGGAGGG - Intergenic
1169914273 20:10671835-10671857 TTTGGGGGCGGAATGGGGCGGGG + Intronic
1171051145 20:21860407-21860429 GTTCGGGGTGGAGCGGGGCTGGG + Intergenic
1171291399 20:23984860-23984882 GATCAGGGTGGAAAGGGGCAGGG + Intergenic
1172033171 20:31995619-31995641 GTTGGGGAAGGAAGTGGGCAGGG - Intronic
1172951747 20:38726950-38726972 GGTGGGGCTGGAATGGGGCACGG - Intronic
1173059252 20:39645983-39646005 ATTGGGAGAGGAAAGGGGCATGG - Intergenic
1173201513 20:40958640-40958662 GTTGGGGGCTGTCCGGGGCAAGG + Intergenic
1174187807 20:48719463-48719485 GTTGGGGGAGGATGGGGTCAGGG + Intronic
1174259855 20:49286080-49286102 TTTGGAGGTGGAAAGGGGAAAGG + Intergenic
1174338728 20:49882994-49883016 GTGGGGGGTGGGGGGGGGCATGG - Intronic
1174362408 20:50037293-50037315 GTTGGAGGTGGAGTGGGGTAGGG - Intergenic
1175136929 20:56831199-56831221 GTTGGGGCTGGAACGCAGCTTGG - Intergenic
1175270926 20:57733761-57733783 GTCAGGGGTGGGACGAGGCAGGG - Intergenic
1175638150 20:60602680-60602702 GCTGGGGGTGAAGGGGGGCAAGG + Intergenic
1175691196 20:61067143-61067165 GCTGGGGGTGGGAAGGAGCAGGG + Intergenic
1175739639 20:61411745-61411767 GTTGGGGGTGTGTCTGGGCAGGG + Intronic
1176009654 20:62886082-62886104 GTTGCGGGTGGCACAGGGCACGG + Intronic
1176703758 21:10093225-10093247 GTTGGGGGTGGCAGGGGGGTTGG + Intergenic
1177046165 21:16172908-16172930 GGTGGGGGCGGGGCGGGGCAGGG - Intergenic
1178788508 21:35676380-35676402 GTTGTGGGTGGATGGTGGCATGG + Intronic
1178964251 21:37100660-37100682 GATGGGGTTGGAATGAGGCAGGG + Intronic
1180593974 22:16961883-16961905 GTGAGGGGTGGGATGGGGCAGGG - Intergenic
1180636391 22:17265868-17265890 GTATGGGGTGGAGCAGGGCAAGG - Intergenic
1181012903 22:20052730-20052752 CTTGGGAGTGGGATGGGGCAGGG + Intronic
1181400557 22:22648075-22648097 GATCAGGGTGGAAAGGGGCAGGG - Intergenic
1181726016 22:24811432-24811454 GGTGGGGGTGGGCAGGGGCAGGG + Intronic
1181750932 22:24988810-24988832 GATGGGGAGGGAATGGGGCAGGG + Intronic
1182048773 22:27297618-27297640 GTTGGGGGTGGGGGGTGGCAGGG - Intergenic
1183033318 22:35121602-35121624 GGTGGGGGAGGATTGGGGCATGG + Intergenic
1183334210 22:37237364-37237386 GCTGGAGGTGTCACGGGGCAGGG + Intronic
1183655068 22:39179818-39179840 GTTTGGGGTGGGATGGAGCAGGG + Intergenic
1184337389 22:43862014-43862036 GGTGGGGGTGGGAAGGGGCTTGG - Intronic
1184459258 22:44627890-44627912 GTAGGGGGAGGAGCGGGGCCTGG + Intergenic
1184558735 22:45248737-45248759 GTTGGGGCTGGAAAGGCCCAAGG - Intergenic
1184707593 22:46225034-46225056 GTCGGGGTTGGAACCGGCCAGGG + Intronic
1184880877 22:47303486-47303508 GGTGGGGGTGGGAAGGGGAAGGG + Intergenic
1185082156 22:48715463-48715485 GCTGGGGGTGGGGCGGGGCAGGG + Intronic
1185111279 22:48901510-48901532 GTTGGGGGTGATACGGCTCAGGG + Intergenic
949281377 3:2351808-2351830 GTTGGGGGTTGAGAGGGGGAGGG + Intronic
949334128 3:2954958-2954980 GATTGGGGTGGTGCGGGGCAGGG - Intronic
949797232 3:7864349-7864371 GTTGGAGGTGGAACCTGGTAGGG + Intergenic
949991598 3:9583668-9583690 GTTGTTGGTTGATCGGGGCAAGG + Intergenic
950182625 3:10926246-10926268 GTGGAGGGTGGAATGGGGGACGG - Intronic
950538239 3:13594291-13594313 GCTGGGGGTGGTGCTGGGCAGGG + Intronic
952116989 3:30194533-30194555 TTTGGGGGTGGTGGGGGGCAGGG + Intergenic
952831877 3:37571785-37571807 CTTGGGGCTGGAAGGTGGCAGGG + Intronic
953874939 3:46661317-46661339 GTTGGGGGTGGAGTGGGGGAGGG - Intergenic
953905426 3:46866105-46866127 GTTGGGGGTGGAGGGAGGGAGGG + Intronic
953907007 3:46873487-46873509 CTTGGGGGTGGAGGGGGGCAAGG - Intronic
953908669 3:46881438-46881460 GTGGGGGTGGGAACGGGGGAGGG + Intronic
954248773 3:49352509-49352531 GGTGGGGGTGGCATGGGGCAAGG + Intergenic
954298627 3:49687530-49687552 AGTGGGGGTGGAGAGGGGCAGGG - Intronic
954431192 3:50471653-50471675 GTGGAGGGTGGAAGGGGACAGGG + Intronic
954698870 3:52441475-52441497 GTGGGGAGAGGAATGGGGCAGGG + Intronic
954748852 3:52802640-52802662 GGTGGGGGTAGAAGGAGGCAAGG - Intronic
956457675 3:69439496-69439518 GATGGGGATGGAATGGGGCAGGG + Intronic
956595044 3:70958243-70958265 ATTGGGGGTGGTTCGGGGGAGGG - Intronic
956750369 3:72340046-72340068 GGTGGGGGTGGGGCGGGCCACGG + Intergenic
960965365 3:123100625-123100647 CCTGGGGGTGGAAGGGGGCAGGG + Intronic
961006820 3:123411146-123411168 GTTGGTGGAGGCACAGGGCAAGG - Intronic
962475932 3:135755361-135755383 GTTGGGGGAGGCAGGGTGCATGG + Intergenic
962630357 3:137269561-137269583 GATGGGGGTGGAGGGAGGCAGGG + Intergenic
963635263 3:147786800-147786822 GTTGGGAGTGGTAGGGGGAAGGG + Intergenic
964414805 3:156436064-156436086 GTTGGGGGTGGGCAGGGGTAGGG - Intronic
964445783 3:156755843-156755865 TTTGGGGGTGGGAGGGGGGATGG + Intergenic
964485963 3:157185666-157185688 GGTGGGGGTGGAAGGAGGGAGGG - Intergenic
967004346 3:185369452-185369474 GTTGGGTGAAGAACAGGGCAAGG + Intronic
967839309 3:193992012-193992034 GTGGAGGGGGGAAAGGGGCAGGG + Intergenic
967848534 3:194063993-194064015 GTTGGGGGCCACACGGGGCATGG - Intergenic
967912680 3:194555387-194555409 GATGGGGGTGGGATGGAGCAGGG - Intergenic
968087155 3:195878920-195878942 GTGGGGGGAGGCACGGGGCGTGG + Intronic
968131203 3:196193956-196193978 GCTGAGGGTGGAGCAGGGCAGGG - Intergenic
968401049 4:297872-297894 GTAGAGGGTGGATCTGGGCAGGG + Intronic
968698387 4:2043416-2043438 GTGGGGGGTGGGACCAGGCAGGG - Intronic
969331148 4:6473981-6474003 GTAGAGGCTGGAACAGGGCAGGG - Intronic
969846028 4:9920678-9920700 GCTGGGGGCGGAACTTGGCAGGG + Intronic
972642230 4:40935522-40935544 GGTGGGGGTGGAATGAGGGACGG + Intronic
975778801 4:77819029-77819051 GTCGGGGGTGGCCCGGGGCCGGG - Intronic
977901970 4:102432809-102432831 ATTGGGGGTGGAAGGTGGCAAGG + Intergenic
980375974 4:131949577-131949599 GTTGGGGGTGGCAGGGGGGTTGG + Intergenic
981000550 4:139825042-139825064 GGTGGCGGTGGAAGGGGGCGGGG - Intronic
981047340 4:140277312-140277334 GTTGGGGGGGGCAGGGGGTAGGG + Intronic
982287282 4:153748426-153748448 GTGGGGGGTGAAAAGGGGGAGGG - Intronic
982798556 4:159673929-159673951 GATGGGGGTGGAGCAGGCCATGG - Intergenic
983216371 4:165006674-165006696 GATGGGGGTGGGGCGGAGCATGG + Intergenic
983829907 4:172313410-172313432 GTTGGGGTGGGGACCGGGCACGG - Intronic
984490769 4:180431766-180431788 TGTGGCGGGGGAACGGGGCAGGG + Intergenic
984762732 4:183376765-183376787 GGTGGGGGTGGAAGGGGGACAGG - Intergenic
985625575 5:983463-983485 GTGGGGGGTGGGGTGGGGCAAGG - Intergenic
985706646 5:1405416-1405438 GTGGGGACTGGAACAGGGCAGGG - Intronic
986781097 5:11066468-11066490 GTTGGGGATGGCAGGGGTCAGGG - Intronic
992886137 5:81162188-81162210 GTTGGGGGTGGTGGGGGACATGG + Intronic
994477733 5:100291448-100291470 GTTGGGGTTGGTGGGGGGCAGGG - Intergenic
996997932 5:129721747-129721769 GTTGGGGGTGGAGAAGGGGAGGG - Intronic
997338029 5:133121628-133121650 GGTGGAGGTGAAATGGGGCAGGG + Intergenic
997582472 5:135026516-135026538 GGTGGGGGTGGAATAGGGCAGGG - Intergenic
999443402 5:151620256-151620278 GTTGGGGGTGGAGCGGTGGGGGG - Intergenic
999925039 5:156366320-156366342 GGTGGTGGTGGAACAGGGCAGGG + Intronic
1000462855 5:161544725-161544747 GTTGGGGCAGGAATGGGGGATGG + Intronic
1000951461 5:167488650-167488672 GGTGGGGGTAGAAGGGGGCGGGG - Intronic
1002292346 5:178208690-178208712 ACTGGGGGTGGAATGGGGTAGGG - Exonic
1002888737 6:1316931-1316953 GAGGGGGGTGGACGGGGGCAGGG - Intergenic
1003473522 6:6460342-6460364 CTTGGGGGTGGGAGGCGGCAAGG + Intergenic
1003838042 6:10092546-10092568 TTTGGGGGGGGTAGGGGGCAGGG + Intronic
1004139685 6:13005846-13005868 GTGGGGGGTGGGGTGGGGCAGGG - Intronic
1004969757 6:20896759-20896781 GTTGGGGGTGGAAGGTAGGAGGG + Intronic
1005009671 6:21323658-21323680 TTTGGGGGTGTAAGGGGACAAGG + Intergenic
1006379671 6:33690217-33690239 GCTGGGGCTGGATGGGGGCATGG + Intronic
1006687920 6:35853145-35853167 GTTGGCGGGGGGAAGGGGCAGGG + Intronic
1007340540 6:41188564-41188586 GTGGAGGGTGGAAGGGGACATGG - Intergenic
1007431590 6:41780154-41780176 GTTGGGGGTGGTCCGGGGAGCGG + Intronic
1007493752 6:42244806-42244828 GTTTGGGGTTGAATAGGGCAAGG - Intronic
1007520217 6:42446202-42446224 GTTTGGAGTGGGACTGGGCACGG - Intronic
1007740287 6:44005580-44005602 TTTTGGAGTGGAAAGGGGCAGGG - Exonic
1008514563 6:52307174-52307196 GTTGGGGGCGGGACGGGGGACGG - Intergenic
1010169329 6:72956779-72956801 GTTGGAGGAGAAAAGGGGCAAGG + Intronic
1012426508 6:99120987-99121009 GAAGGGGGTGGAAAGGGGGAAGG + Intergenic
1013651223 6:112196729-112196751 ATTGGGGGTAAAACAGGGCAAGG + Intronic
1015749544 6:136546347-136546369 GTAGGGGGTGGGAGGTGGCAGGG - Intronic
1019282980 7:209956-209978 CTTGGGGGAAGACCGGGGCAGGG - Intronic
1019471748 7:1224781-1224803 GGTGGGGGCAGAAGGGGGCAGGG + Intergenic
1020010906 7:4805391-4805413 GTTGGGGATGGGGCGGGGCGGGG + Intronic
1022529877 7:31060106-31060128 GCTGGGGGTGGGTCGGGGCTGGG + Intronic
1022812901 7:33886608-33886630 TTAGGGGGTGGAACAGGACAAGG + Intergenic
1024531143 7:50393541-50393563 GTTGGGGGTTGAGAGGAGCAAGG + Intronic
1024565363 7:50675819-50675841 GGTTGGGGTGGGACGGGGAAAGG + Intronic
1026359642 7:69591602-69591624 GTTCTGGGCGGAATGGGGCAGGG - Intergenic
1026972597 7:74477398-74477420 ATTTGGGGTGGGACGGGGCAGGG + Intronic
1027236892 7:76303586-76303608 GTTTTGGGAGGAACGGAGCAGGG - Intronic
1029436156 7:100565170-100565192 GGTGGGGGTGGGACGAGGGAGGG - Exonic
1029729806 7:102432028-102432050 GTAGGGAGTGGAAGGGGCCAGGG + Intergenic
1030354349 7:108526166-108526188 GCTGGGGGCGGAGCGGGGCGGGG - Exonic
1031116356 7:117673167-117673189 GATGGGGGTGGAGCAGGCCACGG - Intronic
1031605117 7:123759894-123759916 GTGGGGGGTGGTGGGGGGCAAGG - Intergenic
1032074903 7:128831676-128831698 GTAGGGGGTGGGCTGGGGCAGGG - Intronic
1032633099 7:133675161-133675183 GTGGGGGATGGTAGGGGGCAGGG + Intronic
1033022650 7:137742221-137742243 GTTGGGGGTGGAAGGAGGGATGG - Intronic
1033943223 7:146681471-146681493 GTAGAGGGTGGAAGGTGGCAGGG + Intronic
1035089530 7:156295677-156295699 GGTGGGGGAGGCACAGGGCAGGG + Intergenic
1035144692 7:156802760-156802782 GTGGGGAGTGGCAGGGGGCAGGG - Intronic
1035487158 7:159234895-159234917 GTTAGGGGAGGAAGGGGGCCTGG + Intergenic
1035960330 8:4129368-4129390 GTTGGGGGTGGAGGTGGTCAAGG - Intronic
1036061542 8:5327383-5327405 ATTGGGGGTGGATTGGGGTATGG + Intergenic
1036142594 8:6222317-6222339 GTTGGGAGTGGGATGGGGCAGGG - Intergenic
1036453591 8:8890731-8890753 GCTGGGGGTGGACCGCGCCATGG + Exonic
1036612498 8:10362505-10362527 GTGGGTGGTGGAACTGGGCATGG + Intronic
1036843214 8:12141617-12141639 GTTAGGTGTGGAACCGGGCTAGG + Intergenic
1037696502 8:21228624-21228646 GATGGGGCTGGAACAGGGAAAGG - Intergenic
1041154478 8:54971029-54971051 GTTGGGGGTGGACAGGGAAAGGG + Intergenic
1042198176 8:66252206-66252228 GTTGGGGGTTGAGGGAGGCAGGG + Intergenic
1042265704 8:66907221-66907243 GTTGGGGGTTGGCGGGGGCAAGG - Intronic
1042448184 8:68913958-68913980 GTTGGGTGGGGACCGGGGCTGGG - Intergenic
1042467081 8:69140544-69140566 GGTGGAGGTGGCAGGGGGCAGGG + Intergenic
1043198511 8:77331191-77331213 GTTTGGGGTAGAATGGGACAAGG - Intergenic
1043401772 8:79891643-79891665 GCTGGGGGTGGAGCGGGGGGCGG - Intergenic
1044784286 8:95778335-95778357 GTGGGGTGGGGAACGAGGCAAGG - Intergenic
1045264429 8:100607144-100607166 GGAGGGGGTGGAGCAGGGCAGGG + Intronic
1047176614 8:122547175-122547197 GCTGGGGGTGGAATGGGAGAGGG + Intergenic
1047469931 8:125160457-125160479 GTTGGGGGTGGCTTGGGGTATGG + Intronic
1049665035 8:143839274-143839296 CTGGGTGGGGGAACGGGGCAGGG - Intronic
1049697875 8:143992437-143992459 GGTGGGAGAGGAACGGGCCATGG - Intronic
1050438008 9:5629499-5629521 GTTGGGGGTGGGACGGCGCCGGG - Intronic
1051326894 9:15981743-15981765 GGTGGGGGTGGAAAAGGGAAGGG - Intronic
1052588871 9:30465675-30465697 GTAGGGGGTGGGATGGGCCAGGG - Intergenic
1052666304 9:31499595-31499617 GTTGAGGGTGGAGTGGGGCATGG - Intergenic
1052879733 9:33594106-33594128 GTTGGGGGTGGAAGGAGAAAGGG + Intergenic
1053434702 9:38067395-38067417 GCTGGGGGTGGGGCAGGGCAGGG + Intronic
1053496248 9:38550123-38550145 GTTGGGGGTGGAAGGAGAAAGGG - Intronic
1053511372 9:38690758-38690780 GTAGGGGGTGGAGGGAGGCAAGG - Intergenic
1054241004 9:62613202-62613224 GTTGGGGGTCGGGGGGGGCAGGG - Intergenic
1054892626 9:70268443-70268465 TTTGGGGGGGGCAGGGGGCATGG - Intronic
1055560466 9:77516728-77516750 GTGGGGGGCGGTAGGGGGCAGGG + Intronic
1055868075 9:80840045-80840067 GTTGGGGGTAGGACAGGGCAGGG - Intergenic
1055929638 9:81546495-81546517 GTTGTGGGTGGAAGGGTGGAAGG + Intergenic
1056280801 9:85039650-85039672 GTTGGGGGTGGGGTGGGGCGGGG - Intergenic
1056280832 9:85039867-85039889 GAGGAGGGTGGAAGGGGGCAGGG - Intergenic
1057128974 9:92640287-92640309 GGTGGGGGTGGGGCTGGGCAGGG - Intronic
1057356087 9:94332514-94332536 GTTGCCGGTGGTTCGGGGCAGGG + Intergenic
1057651664 9:96925114-96925136 GTTGCCGGTGGTTCGGGGCAGGG - Intronic
1060031199 9:120216430-120216452 GGTGGGGAGAGAACGGGGCAGGG + Intergenic
1060188732 9:121579048-121579070 GTTGGGGGTAGGTCAGGGCAGGG + Intronic
1061053081 9:128207482-128207504 GTGGGGGGTGTAGCGGGGCGGGG - Intronic
1061566409 9:131443749-131443771 TTTTGGGGTGGACTGGGGCAGGG + Intronic
1062016785 9:134295021-134295043 GGTGGGGGTGGTGGGGGGCAGGG + Intergenic
1062051429 9:134449196-134449218 GTCGGGGGTGGGGTGGGGCAGGG - Intergenic
1062205790 9:135336193-135336215 CTTGAGGGTGGAGCAGGGCATGG - Intergenic
1062365840 9:136208660-136208682 GCTGCAGGTGGCACGGGGCAGGG + Exonic
1062410497 9:136421771-136421793 GTGGGGGGTGGAAGGTGGCACGG + Intronic
1062525269 9:136975732-136975754 GTGGCGGGTGGCCCGGGGCAGGG - Intergenic
1062649697 9:137569303-137569325 GTGGGGGGTGGGTGGGGGCATGG - Intronic
1202788795 9_KI270719v1_random:63320-63342 GTTGGGGGTGGCAGGGGGGTTGG + Intergenic
1203364230 Un_KI270442v1:243379-243401 GTTGGGGCTGGGTAGGGGCAGGG + Intergenic
1185463037 X:341076-341098 GGTGGGGGCGGCAGGGGGCAGGG - Intronic
1187554462 X:20338712-20338734 GTTGGAGGAGGAACAGGGGAGGG + Intergenic
1188431762 X:30111631-30111653 GAGGAGGGTGGAAGGGGGCAAGG - Intergenic
1188505661 X:30881209-30881231 GATGGGGGTGGAGGGGGGTAAGG + Intronic
1189113552 X:38320265-38320287 GGTGGGGGAGGGGCGGGGCAAGG + Intronic
1189254010 X:39623423-39623445 TTTGGGGGGGGAGGGGGGCAAGG - Intergenic
1189836377 X:45027564-45027586 GTTGGGGGTGGCAAGGGGATAGG - Intronic
1189858049 X:45243395-45243417 GTTGGGGGTGGTGTGGGGCAAGG - Intergenic
1190078604 X:47337286-47337308 GTTGGGCGTGGAGTTGGGCATGG + Intergenic
1190247464 X:48700066-48700088 GTTGGGGGTGGGTAGGGGGACGG - Intronic
1192735360 X:73845218-73845240 ATTGGGGGTGGAGTGTGGCAGGG + Intergenic
1192735512 X:73846100-73846122 ATTGGGGGTGGAGTGTGGCAGGG + Intergenic
1193691380 X:84648712-84648734 GTAGGAGGAGGAAAGGGGCATGG + Intergenic
1193975273 X:88110749-88110771 GTTGGGGAGGGAAAGGGGGAGGG - Intergenic
1194774407 X:97944672-97944694 GGTGGTGGTGGTATGGGGCAGGG - Intergenic
1194974493 X:100379898-100379920 GTTGGGGGTGGGAGGTGGCATGG + Intronic
1196918341 X:120561440-120561462 GTGGGGGGGGGAAGGGGGGAGGG + Intronic
1197220139 X:123904454-123904476 GTTGGGGGTAGAGTGGGGAATGG - Intronic
1197264073 X:124347353-124347375 GTGGGGGGTGGGGAGGGGCAGGG + Intronic
1197363542 X:125536294-125536316 GTTGGCGGGGGAGAGGGGCATGG + Intergenic
1199026793 X:142949125-142949147 GTCGGGGGTGGGGTGGGGCAAGG - Intergenic
1199032979 X:143022539-143022561 GTTGGAGGTGGAAGGGAGAAAGG + Intergenic
1199673237 X:150163836-150163858 GCTGGGGGTGCAAGGGAGCAGGG + Intergenic
1200090394 X:153633214-153633236 GTAGGGGGAGGACCTGGGCAGGG + Intergenic
1200097933 X:153672810-153672832 GTGGGGGGTGGCACAGGGCCAGG - Intronic
1200136717 X:153878852-153878874 GATGGGGCTGGGATGGGGCAGGG - Intronic
1201644431 Y:16213550-16213572 GTTGGGGGTAGATCTGTGCAGGG + Intergenic
1201658384 Y:16371771-16371793 GTTGGGGGTAGATCTGTGCAGGG - Intergenic