ID: 1162525158

View in Genome Browser
Species Human (GRCh38)
Location 19:11202553-11202575
Sequence TTGTGGTTGGGGGTGGAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162525158_1162525168 -5 Left 1162525158 19:11202553-11202575 CCCCGTTCCACCCCCAACCACAA 0: 1
1: 0
2: 5
3: 43
4: 306
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79
1162525158_1162525172 27 Left 1162525158 19:11202553-11202575 CCCCGTTCCACCCCCAACCACAA 0: 1
1: 0
2: 5
3: 43
4: 306
Right 1162525172 19:11202603-11202625 TCTGCCAGCTTCGTGATCGATGG 0: 1
1: 0
2: 0
3: 6
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162525158 Original CRISPR TTGTGGTTGGGGGTGGAACG GGG (reversed) Intronic
900085279 1:890781-890803 CTGTGGTTGGGGCTTGAACAAGG - Intergenic
900338221 1:2175375-2175397 TTGGGGTTGGGGTTGGGATGGGG - Intronic
901056817 1:6452156-6452178 TTGGGGTTGGGGGTGGCGTGGGG - Intronic
901236519 1:7670242-7670264 TTGGGGCTGGGAGTGGAACGGGG - Intronic
901818240 1:11807075-11807097 TAGTGGTTAGGAGTGGAAGGAGG - Intronic
902649366 1:17826589-17826611 TTCTGGGTGGGGGTAGAATGAGG + Exonic
903869053 1:26419111-26419133 GTGTGGTTGGGGGTGGAATGGGG + Intronic
903896993 1:26613394-26613416 TTGTTGTTGGGGGTGGGGCTGGG - Intergenic
904276396 1:29387478-29387500 TTGTGGTTGATGGAGGAAAGGGG + Intergenic
905796447 1:40818998-40819020 TTGAGGGTGGGGCTGGAGCGGGG + Intronic
906685658 1:47761489-47761511 TGGTGGTTGTGGGTGGAGTGGGG + Exonic
908011645 1:59784607-59784629 ATGTGTTTAGGGGTGGAACTGGG + Intergenic
911434122 1:97832968-97832990 TTCTGGATGGAGGTGGAAAGAGG + Intronic
912467225 1:109882474-109882496 TTGAGGTTTGGGGTGGGAGGGGG + Intergenic
914414118 1:147462557-147462579 TTGTTGTTGGGGGTGCAAAATGG - Intergenic
915532673 1:156512137-156512159 TGGGGGTGGGGGGTGGAAGGAGG + Intergenic
915903942 1:159864660-159864682 CTGTGGTTAGGGTTGGAACATGG + Intronic
917287788 1:173439772-173439794 TTGTGTTTGGTGGTGGCAGGAGG - Intergenic
918071485 1:181136370-181136392 TAGGGGTTGGGGGTGGAAAGAGG - Intergenic
918304209 1:183231116-183231138 GTGGGGTTGGGGGTGGTAAGGGG - Intronic
918425668 1:184407268-184407290 TTGGGGTTGGGGGAGGTATGGGG - Intronic
919409410 1:197225869-197225891 CTGTGGTCTGGGGTGGACCGAGG - Intergenic
919512143 1:198478415-198478437 TAGTGGTTGGGGGTGGGAAGTGG + Intergenic
920726377 1:208439093-208439115 TAGGGGTTGGGGGAGGGACGGGG + Intergenic
921220982 1:212973862-212973884 TTGGGCTGGGGGGTGGAATGTGG + Intronic
923114615 1:230923403-230923425 TTGTGTGTTGGGGTGGAATGGGG + Intronic
1062944151 10:1447722-1447744 TTGAGGTTGGAGGTGAAAGGAGG - Intronic
1064162264 10:12956763-12956785 TTGTGGTGGTGGGTGGAGGGAGG - Intronic
1065135096 10:22659821-22659843 TTGTTGTTGGGGGTGGGAGGAGG - Intronic
1065276570 10:24092175-24092197 ATGTGGTTGGAGGTGGCATGAGG - Intronic
1066059050 10:31706299-31706321 TTGTGCTTGGGGGTGGCATGGGG - Intergenic
1066107998 10:32172329-32172351 ATGTTGTGGGGGGTGGGACGCGG - Intergenic
1067064144 10:43094200-43094222 TGGGGGCTGGGGGTGGAAAGAGG - Intronic
1067295984 10:44975428-44975450 GTGGGGGTGGGGGTGGAAGGTGG - Intronic
1068582377 10:58756355-58756377 TTGTGTGTGGGGGTGGAGAGGGG + Intronic
1069562676 10:69441818-69441840 GTGTGTTTGGGGGTGGAAGTGGG - Intergenic
1069924214 10:71837176-71837198 TTGTGGTTGGAGGTAGAAGGGGG - Intronic
1070295835 10:75160725-75160747 GTGAGGTTGTGGGTGGAAGGTGG + Intronic
1070408017 10:76113721-76113743 TTGTGGCTGGGAGAGAAACGCGG - Intronic
1070627640 10:78062508-78062530 TGGTGGTTTGGGGTGGAGCCTGG + Intergenic
1071520822 10:86330570-86330592 CTGTGGTTGGGGCAAGAACGGGG - Intronic
1072095185 10:92171427-92171449 ATCTGGTTGGGGGTGGAGGGTGG - Intronic
1073037553 10:100574839-100574861 ATGGGGTAGGGGGTGGAAGGAGG - Intergenic
1075898037 10:126014909-126014931 TTGTGGTTGGGGGAGGCACGGGG - Exonic
1076369991 10:129946321-129946343 ATGTGTTTGGGGCTGGAATGGGG + Intronic
1076693712 10:132237012-132237034 TCGTCGTTAGGGGTGGAACTGGG - Intronic
1077168130 11:1152864-1152886 CTGTGCATGGGGGTGGCACGTGG - Intergenic
1078507944 11:11966053-11966075 TTGGGGTTGAGGGTGGGAGGTGG - Intronic
1079394503 11:20050233-20050255 TTGGGGTTGGGGGTGGCAAAAGG - Intronic
1081911495 11:46702807-46702829 TTGTGGTTTGGGATGGAACCCGG + Intronic
1083333278 11:61909017-61909039 GTGTGGGTGGGGGCGGAATGAGG - Intronic
1084323432 11:68385940-68385962 TTGTGGTTGGGGCTGGTTTGTGG + Intronic
1085793974 11:79520076-79520098 TGTGGTTTGGGGGTGGAACGGGG + Intergenic
1086135281 11:83438302-83438324 TTCAGGTTGGGGGTGGGATGGGG + Intergenic
1086497505 11:87419734-87419756 TTGTGGGTGTGGGAGGAAGGAGG - Intergenic
1087096860 11:94327400-94327422 TGGTGGTGGGGGGTGGGACGGGG + Intergenic
1089696825 11:120221057-120221079 TTGGGGCTGGGGGTGGCATGAGG - Intronic
1090410041 11:126501788-126501810 ATGTGGGTGGGGGTTGAACTAGG - Intronic
1090665813 11:128914342-128914364 GTGTGGTTGGGGGTGCAGCGGGG - Intronic
1091329522 11:134720295-134720317 TTGTGGTTGGGGGAGGGGGGAGG - Intergenic
1092845643 12:12582411-12582433 TTGTGGTTGGGAGGAGAAAGGGG + Intergenic
1095730975 12:45506392-45506414 TTGTGTCTGGGGGTGGGAAGGGG + Intergenic
1096243680 12:49972932-49972954 ATGTGTATGGGGGTGGAATGAGG - Intronic
1096393257 12:51246257-51246279 TTGGGGTTGGTGGGGGAACATGG - Intronic
1097323103 12:58246851-58246873 TGGTGGTGGGGGGTGGGAGGGGG + Intergenic
1098596129 12:72274004-72274026 TTGTGGGTGGGGGTGGAGAACGG - Intronic
1098697790 12:73581342-73581364 ATTTGGTTGGGGGTGGTAGGAGG + Intergenic
1098998836 12:77152875-77152897 CTGTTGTTGGGGGTGGTAGGAGG + Intergenic
1099681610 12:85836624-85836646 GTGTGGTTGGGTGTGGAAAGCGG - Intergenic
1101121007 12:101580082-101580104 TTGTGGGTAGGGGTGGGAGGAGG - Intronic
1101399192 12:104373288-104373310 CTGGGGTTGGGGGTGGATGGAGG + Intergenic
1102601295 12:114032653-114032675 TTGTGGTGGTGGGGGCAACGTGG + Intergenic
1102821052 12:115909533-115909555 TTGTGTTTGGGGTTGGGAGGGGG + Intergenic
1104856430 12:131904485-131904507 TAGTGTTTGGGGGTGGGAGGAGG + Intronic
1104892316 12:132146161-132146183 CTGGGGCTGGGGGTGGAAAGGGG - Intronic
1105023608 12:132834348-132834370 CTGTGGTTGGAGGTGGAGTGTGG - Intronic
1105261010 13:18779500-18779522 GTATGGGTGGGGGTGAAACGTGG - Intergenic
1105263316 13:18796091-18796113 GTATGGGTGGGGGTGAAACGTGG - Intergenic
1106465092 13:30006403-30006425 TTGGGGTGGGGGGTTGAAGGAGG + Intergenic
1106956198 13:34942155-34942177 GGGTGGTTGGGGGAGGGACGAGG + Intergenic
1107998807 13:45888020-45888042 TTGGGGTTGGGTGTTGAAGGTGG + Intergenic
1108474641 13:50801712-50801734 TTGTGGTTTGTGGTGGTACAAGG - Intronic
1109372897 13:61447506-61447528 TTGTGGTTGTGGGTGAAGCGTGG + Intergenic
1110119899 13:71867057-71867079 TTGGGGGTGGGGGTGGGGCGGGG + Intronic
1110332353 13:74287401-74287423 CTGGGGTTGGGGGTGGATAGAGG - Intergenic
1112235741 13:97634655-97634677 TTGTGGTTGGGGGTGGGTGGTGG - Intergenic
1113293523 13:108932365-108932387 TTGTGGTTTGGGGTGTGACTTGG + Intronic
1113941151 13:114019158-114019180 AGGGGGATGGGGGTGGAACGTGG + Intronic
1114492787 14:23113777-23113799 TTGGGGTTGTGGGTGGAAAGGGG - Intergenic
1115160701 14:30390293-30390315 ATGAGGCTGGGGGTGGAAGGGGG + Intergenic
1115764290 14:36607047-36607069 GTGGGGTTGGGGGTGGGACTGGG - Intergenic
1117411877 14:55457334-55457356 TTGGGGTTGGGGGTGGAGGAGGG + Intergenic
1118359244 14:65042181-65042203 CTGGGGTTGGGGGTGGGACGGGG + Intronic
1118492378 14:66273719-66273741 GTGTGGATGAGGGTGGAAAGTGG - Intergenic
1120912530 14:89680577-89680599 TTCTGGCTGGGGCTGGAAGGAGG - Intergenic
1121463908 14:94102112-94102134 TTCTGGTTGGAGGTGGGACCAGG + Intronic
1122270706 14:100567491-100567513 TGGTGGTTGGGGGTGGGGTGGGG + Intronic
1126375365 15:47991862-47991884 TTGGGGTTGGGGTTGGAGCCTGG - Intergenic
1127162727 15:56206864-56206886 TTGGGGTTGGGGGTGGGGTGTGG + Intronic
1127184521 15:56464569-56464591 TGGTGGTGGTGGGTGGAATGAGG - Intronic
1127968189 15:63939452-63939474 TTGGGGTTTGGGGTGGGACTTGG + Intronic
1128229131 15:66022753-66022775 CTGGGGTTGGGGGTGGAGGGTGG + Intronic
1128636366 15:69305108-69305130 TTGTGGTGGGCGGTGGAGAGGGG + Intronic
1130109222 15:80950849-80950871 TTGTGGTTGGGGCAGGAAAGGGG - Exonic
1132678715 16:1131032-1131054 GTGGGGGTGGGGGTGGACCGGGG + Intergenic
1133168142 16:3963601-3963623 TTGTGGTTGGGGAAGGAAATGGG + Exonic
1133644947 16:7755172-7755194 GTGGGGTTGGGGGTGGGACCAGG + Intergenic
1136397216 16:29999832-29999854 CTGGGGTTGGGGGTGGACAGTGG + Intronic
1137580253 16:49629421-49629443 CTGTGGGTGTGGGTGGAAAGAGG - Intronic
1138361756 16:56435882-56435904 TTGAGGTTGGGGCTGGAAGGAGG - Intronic
1138499221 16:57428628-57428650 ATGTGGTTGGGGATGGAAGGGGG + Exonic
1138848789 16:60600695-60600717 TTGAGGGTGGAGGTGGAAGGAGG - Intergenic
1140913024 16:79470472-79470494 TTGTGGTGGGGGCTGGTACATGG - Intergenic
1141259757 16:82441713-82441735 TGGTTTTTGGGGGTGGAATGGGG + Intergenic
1142890971 17:2942371-2942393 TTGTGTTTGGGGCTGAAACTTGG + Intronic
1143093993 17:4467006-4467028 ATGTGGGTGGGGGTGGAGCGGGG + Intronic
1143465016 17:7130936-7130958 TTGTGATTGGGGGTGGGGAGGGG - Intergenic
1144157267 17:12517983-12518005 TTGTGATGATGGGTGGAACGTGG + Intergenic
1144444890 17:15317807-15317829 TTATGGTTGGGGGTGGGATGAGG - Intronic
1144578894 17:16446927-16446949 TTGTGGGTGGGGGTGGGGGGCGG + Intronic
1145195286 17:20888376-20888398 TTATGGTTGGAGATGGAACTCGG - Intronic
1145867033 17:28248032-28248054 GTGTGGTGGGGGGTGGAAGAGGG + Intergenic
1146008731 17:29178398-29178420 TTGTAGGTGGGGGTGGAGGGTGG - Intronic
1146940675 17:36842401-36842423 TCCTGGTTGGGGCTGGAAGGGGG - Intergenic
1147615529 17:41825140-41825162 ATGTGGGTGGGGGTAGAACCTGG - Intergenic
1147689467 17:42306540-42306562 GAGTGGTTGGGGGTGGAGAGTGG - Intronic
1148701843 17:49592265-49592287 TTGGGGTTGGGGGTGGAAGAAGG - Intergenic
1149462157 17:56837959-56837981 TAGTGGTTGGGGGTAGAAACAGG - Intronic
1149644954 17:58233878-58233900 TTGTGGTGGAGGCTGGAATGGGG - Intronic
1149997771 17:61413842-61413864 TTGAGGCTGGGGGCGGGACGGGG - Intergenic
1150048477 17:61936169-61936191 TGGAGGGTGGGGGTGGAAGGAGG + Intergenic
1150631228 17:66881805-66881827 TTGGGGGTGGGGGTGGAAAATGG + Intronic
1150814094 17:68378923-68378945 TTGGGGTCGGGGGTGGGGCGGGG + Intronic
1150816412 17:68395580-68395602 TGGGGGTTGGGGGTAGAAAGAGG - Intronic
1151404662 17:73878557-73878579 TTGTGGCTGGGGTTGGGAGGTGG + Intergenic
1151955341 17:77377298-77377320 TTCTGGTTGGTGGAGGCACGGGG + Intronic
1152087663 17:78230612-78230634 GTGTGTTTAGGGGGGGAACGAGG + Intergenic
1152545083 17:80996409-80996431 ATGGGGTTGGTGGGGGAACGTGG - Intronic
1152747865 17:82049541-82049563 ATGTGGCTGGGGGTGGACCCTGG - Intronic
1153755662 18:8280397-8280419 TTGTGGTCGGGGGTGGGGGGGGG + Intronic
1154262089 18:12843955-12843977 CGGTGGTTAGGGGTGGAATGGGG - Intronic
1154266439 18:12883425-12883447 CGGTGGTTGGGGGTGGCTCGTGG - Intronic
1155513534 18:26600864-26600886 ATGTGGTTGGGGATGGAAGGGGG - Intronic
1156071753 18:33219774-33219796 ATGGGGTTGGGGGTGGAGGGAGG + Intronic
1156204935 18:34875257-34875279 GTGTGGCTGGGGGAGGAGCGGGG - Exonic
1156650964 18:39226991-39227013 TTGTGGTTGTGGGAGGGACCTGG + Intergenic
1156810511 18:41244023-41244045 CTGTGGTGGGGGGTGGAAATAGG - Intergenic
1157573512 18:48729262-48729284 TAGTGGTGGTGGGGGGAACGTGG - Intronic
1157945330 18:51972984-51973006 TGGTGGTTAGGGGTGGAAGTTGG - Intergenic
1158403714 18:57142964-57142986 TTGTGGTTGGGGGTGGGAAAAGG + Intergenic
1158476977 18:57788942-57788964 TTGGGGGTGGGAGTGGAAGGAGG - Intronic
1158725023 18:59963375-59963397 TTGTTATTGGGGATGGAGCGGGG - Intergenic
1160435870 18:78852307-78852329 CAGGGGTTGGGGGAGGAACGTGG + Intergenic
1160677591 19:399636-399658 CTGCCGTTGGGGCTGGAACGGGG - Intergenic
1160828104 19:1090014-1090036 GTGTGTGTGGGGGGGGAACGCGG + Intronic
1160951317 19:1668973-1668995 GTGTGGCTGGGGGTGGCCCGGGG - Intergenic
1161264543 19:3358387-3358409 GTGTGGAGGGGGGTGGAACTGGG + Intergenic
1161401901 19:4069601-4069623 TTTTGGTTGGGGGAGGAAAAAGG - Intergenic
1162525158 19:11202553-11202575 TTGTGGTTGGGGGTGGAACGGGG - Intronic
1162582393 19:11539169-11539191 CTATGGTTGGGGCTGGAATGGGG + Intronic
1163490851 19:17616469-17616491 TTGGGGGTGGGGGTGGAAGGGGG + Intronic
1165798697 19:38534616-38534638 TTGTGGATGTGGCTGGAACAGGG + Intronic
1166200022 19:41231335-41231357 TTGTGGATGTGGGTGGAAGGAGG - Intronic
1166726943 19:45034327-45034349 CTGGGGATGGGGGTGGAAAGGGG - Intronic
1166930166 19:46297368-46297390 TCCTGGTTGGGGGTGGAACTTGG + Intronic
1167455572 19:49595560-49595582 TTGGGGGTGGCGGTCGAACGGGG - Exonic
1167663442 19:50810148-50810170 TTGTGGTTGGGGGTGGGTTATGG + Intergenic
1167663498 19:50810329-50810351 TTATGGTTGGGGGTGGGTTGTGG + Intergenic
1167667047 19:50828365-50828387 CTGTGGTTGGGGGTGGAGACAGG + Intronic
1167752376 19:51388710-51388732 TTGTGGTTGGGGATGGCATTGGG + Exonic
927292367 2:21417240-21417262 TTGTTGTTGGTGGTGGTAAGGGG + Intergenic
927705978 2:25296811-25296833 TTGGGCTTGGGGGTGGGACCTGG + Intronic
927762740 2:25774105-25774127 TTGAGGGTGGAGGTGGAAGGAGG + Intronic
927810953 2:26179906-26179928 TTGTGGTTGGGGCAGGGGCGGGG + Intronic
928094581 2:28395826-28395848 TGGTGGTTGGGTGGGGGACGAGG + Intronic
928118838 2:28567020-28567042 TTAGAGTTGGGGGTGGAACGAGG + Intronic
928135044 2:28681698-28681720 TTGGGGCTGGGGGTGGCACAGGG + Intergenic
928342480 2:30456553-30456575 TTGTGGGTGGGGGTGGGCCACGG + Intronic
929378419 2:41319207-41319229 TTGTGGTTGTGGATGGAAAGAGG - Intergenic
933150507 2:78909503-78909525 TTGTGGGGTGGGGTGGAATGGGG - Intergenic
935496728 2:103791589-103791611 TAGTGGCAGGGGGTGGAAAGAGG + Intergenic
935645253 2:105329464-105329486 GTGTAGTGGGGGCTGGAACGCGG - Intronic
935924090 2:108048351-108048373 TTGTGGTTGGGTTTGGACCATGG - Intergenic
936477597 2:112853071-112853093 GTGGGGTGGGGGGTGGTACGGGG + Intergenic
936968752 2:118153573-118153595 ATGTGCTTGGGGGGGGAACGGGG - Intergenic
937326385 2:120991833-120991855 GTGTGGTTGGGGGTGGAAAGGGG + Exonic
939153202 2:138496443-138496465 TTGTGGTTGGCCCTGGAACCTGG - Intergenic
940622858 2:156134745-156134767 TGGTGGTGGGGGGTGGAGGGCGG - Intergenic
941385852 2:164851225-164851247 TTGGGGTTGGGGGTGGAAAATGG - Intergenic
942579943 2:177407510-177407532 TTGAGGTTGGGTGTGGGAGGGGG + Intronic
943116513 2:183678798-183678820 TAGTTGTTGGGGGAGGAACCTGG - Intergenic
945962082 2:216146200-216146222 TTGTGGTTGGTGGTTGAAATGGG + Intronic
947753713 2:232545891-232545913 GAGTGGTTGGGGGTGGGCCGTGG + Exonic
948152216 2:235753211-235753233 TTCAGGTTGGGGGTGGCAAGAGG + Intronic
948273103 2:236688791-236688813 TGGTGGTTGGGGGTGGGGAGGGG + Intergenic
948644285 2:239393968-239393990 GTGGGGTTGGGGGTGGAGGGGGG - Intronic
949014065 2:241699674-241699696 ATGTGGCTGGGGGTGGGGCGGGG + Intergenic
1168777923 20:463239-463261 TTGTGGTTGGGGGTGGGAGGTGG - Intergenic
1170766119 20:19291218-19291240 TGGTGCTTCGGGGTGGAATGAGG + Intronic
1171003221 20:21435840-21435862 TTGTGGCTGGGGCTGGAGAGAGG + Intergenic
1171196386 20:23202796-23202818 TTCTAGTTGGGGGTGGAGGGTGG + Intergenic
1173528569 20:43751173-43751195 TTGGGGGTGGGGGTGGATCTGGG + Intergenic
1173885147 20:46450978-46451000 TAGAGATTGGGGGTGGAAGGGGG + Intergenic
1175788644 20:61727829-61727851 TTGTGGCTGGGGGTGGTCGGGGG - Intronic
1176219127 20:63961739-63961761 TTGTGGCTGGGGTTGGGGCGAGG + Intronic
1178354439 21:31898695-31898717 TTGTGGAGTGGGGTGGAACAGGG + Intronic
1179875099 21:44263079-44263101 TTCAGGGTGGGGGTGGAACGTGG + Intergenic
1180115836 21:45704359-45704381 TGGTGGTTGGTGGGGGAACTGGG + Intronic
1180130816 21:45825793-45825815 GTGGGGTTGGTGGTGGGACGTGG + Intronic
1180150476 21:45944642-45944664 ATGTGGTTGTGGGTGGAACTGGG - Intergenic
1180941662 22:19663612-19663634 ATGTGGCTGGGAGTGGCACGGGG + Intergenic
1181012901 22:20052725-20052747 TTGTGCTTGGGAGTGGGATGGGG + Intronic
1181803218 22:25360494-25360516 TTGTGGTTGGGGCTGGTGTGTGG - Exonic
1182783655 22:32888442-32888464 TTGCTGTTGGGGATGTAACGTGG - Intronic
1183690622 22:39386136-39386158 TGGTGGTTGGGGAAGGAACCAGG - Intergenic
1184490121 22:44803603-44803625 TAGTGGTGGGGGGTGGAGAGAGG - Intronic
1184697786 22:46149839-46149861 GTGTGGTGGGCGGGGGAACGAGG - Intergenic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
949174561 3:1044206-1044228 GTGTGGGTGGAGGTGGAAGGTGG - Intergenic
950449780 3:13059117-13059139 TGGAGGTCGGGGGTGGAAGGAGG - Intronic
951614115 3:24522469-24522491 CTGTGGGTGGGGGTGGAACCTGG - Intergenic
952832518 3:37576887-37576909 TTGTGGTTGGAGGTGGAGTGTGG - Intronic
952878737 3:37969778-37969800 TTGTGGCTGAGGGTGGAGCGAGG - Intronic
952958887 3:38577442-38577464 TTGTGGGTGTGGGTGTAAAGGGG + Intronic
952972096 3:38657889-38657911 TGGTGGCTGGGGGTGGAGGGAGG + Intergenic
952986836 3:38793385-38793407 TTGAGGTTGGGGGAGGAGCATGG - Intronic
953420810 3:42751826-42751848 TGGGGGTTGGGGGTGGACCTCGG + Intronic
954196066 3:48997990-48998012 GTGTGGTTGGGGGTGGAGTGAGG + Intronic
955206580 3:56901009-56901031 TTTTGGGTAGGGGTGGAAAGTGG + Intronic
955387821 3:58492816-58492838 CTGTGTCTGGGGGTGGGACGGGG + Intronic
955542609 3:59993730-59993752 TTGATGTTGGAGGTGTAACGGGG + Intronic
956142780 3:66162359-66162381 TTGTGGTTGGGCGGGGGAGGGGG + Intronic
956786382 3:72646107-72646129 TTGTTCTTGGTGGTGGAAGGTGG - Intergenic
958767322 3:98385177-98385199 TTGTGGTTGGGGGTCTACTGGGG - Intergenic
960987926 3:123292532-123292554 CTGTGGGTGGTGGTGGAAGGCGG - Intronic
961060727 3:123826049-123826071 TTGGGGGTGGGGGTGGTACAGGG - Intronic
962697565 3:137965515-137965537 CTTTGGTGGGGGGTGGAAGGTGG - Intergenic
968765891 4:2468948-2468970 TTGTGGGCGGGGGCGGAAAGAGG + Intronic
969283898 4:6190601-6190623 CTGGGGTTGGGGGTGGGAGGCGG - Intronic
970148171 4:13058973-13058995 TTGATGGTGGGGGTGGAAAGAGG - Intergenic
970837146 4:20422935-20422957 TTGTGGTGGGGGGTGGGAGGAGG + Intronic
972159738 4:36208820-36208842 TTTTGGTTGGGGGTGGGGTGGGG + Intronic
975233100 4:71957821-71957843 TTGGGTTGGGGGGTGGAGCGGGG - Intergenic
976148083 4:82063259-82063281 TTGTGGTTGTGGGAGGCAGGTGG - Intergenic
976350806 4:84057607-84057629 TGGTGGTTGGGGGTGGCAAAAGG - Intergenic
977431782 4:96939311-96939333 TTGGGGTTGGGGGTGGGATTAGG + Intergenic
977493455 4:97742213-97742235 GTGGGGTTGGGGGAGGAAGGAGG + Intronic
978113468 4:104991046-104991068 TTGTGGTTTGGGGTGGAGGGAGG + Intergenic
978554602 4:109965740-109965762 TAGTGGTCAGGGGTGGAACCTGG - Intronic
978759883 4:112345358-112345380 ATGTGGATGTGGGTGGAATGGGG + Intronic
982825588 4:160000803-160000825 TGGTGGTTGGGGGTAGGAAGTGG + Intergenic
982899775 4:160983410-160983432 TTAGGGTTGAGGGTGGAAGGGGG - Intergenic
984916504 4:184730008-184730030 GAGTGCTTGGGGGTGGAATGTGG + Intronic
985725691 5:1514800-1514822 TTTTGGCTGGAGGTGGAAGGTGG - Intronic
987300917 5:16597620-16597642 TTGTGGGTGGGGGAGGACCAAGG - Intronic
987524387 5:19029444-19029466 TTGTAGGTGGGAGTGGAAGGAGG + Intergenic
988964108 5:36399128-36399150 TTGTGGTGGGGGGTAGAGGGAGG - Intergenic
990448743 5:55916704-55916726 TTGTCACTGGGGGTGGAACATGG - Exonic
992269160 5:75048419-75048441 TTGTGGTTCGTGGAGAAACGTGG + Intergenic
993920181 5:93792017-93792039 ATGTGGTTGGGGGTGGGGAGGGG + Intronic
994980678 5:106872788-106872810 TTCTGGGTGGGGGTGGAATCAGG - Intergenic
995400547 5:111736089-111736111 TGGTGGGAGGGGGTGGAGCGAGG + Intronic
996923357 5:128794785-128794807 ATGGGGTTGGGGGTGGAGGGAGG - Intronic
997549527 5:134739507-134739529 ATGTGTTTGGGGGAGGAAGGAGG - Intronic
998496835 5:142598107-142598129 ATGTTGTTGGGGGTAGAAGGAGG + Intronic
999284634 5:150386979-150387001 TTGAGGCTGGGGATGGTACGTGG - Intronic
1000560281 5:162778610-162778632 TTGTGGTGGGGGGTAGCAAGGGG - Intergenic
1000727751 5:164792848-164792870 TAGAGGTTGGGGGTGGAAGGGGG - Intergenic
1000909582 5:167005997-167006019 TTGTGGTAGGACGTGGAAGGAGG + Intergenic
1001603199 5:172942535-172942557 TCTTGGTTGGGGGTGGACCAAGG - Intronic
1001713013 5:173793109-173793131 TTGTGGGTGGGGGTGGGTGGGGG + Intergenic
1001866591 5:175111418-175111440 TTGAGGTTGGGGATGGAGGGTGG - Intergenic
1002442389 5:179271147-179271169 TTGGGGGTGGGGGTGGAGGGAGG + Intronic
1003094771 6:3133541-3133563 TGGTGGTTGGGAGGGGAAAGTGG - Intronic
1003368087 6:5496145-5496167 TTTTGGTTGGGGGTGGAAGGAGG + Intronic
1005210885 6:23460882-23460904 TTGAGGTAGGGTGTGGAATGGGG - Intergenic
1005898229 6:30196126-30196148 TTGTGGTTGGGGGTGGCTGAGGG - Intronic
1006075423 6:31529366-31529388 TTGTGGGTGGGGGTGGGGTGAGG - Intronic
1006454954 6:34126400-34126422 TTGGGGGTGGGGGCTGAACGAGG - Intronic
1006612537 6:35303048-35303070 TAGGGGTTGGGGGTGGAGAGAGG - Intronic
1007498019 6:42274950-42274972 CTGGGGATGGGGGTGGAAGGTGG - Intronic
1007976009 6:46101983-46102005 TTGGGGGTGGGGGTGGTATGAGG + Intergenic
1008314583 6:50024969-50024991 TTGCAGTTGGGGGTGGTAAGGGG - Intergenic
1008505404 6:52225188-52225210 TTGGGGTTGGGGGTGGTGAGAGG - Intergenic
1008645667 6:53511796-53511818 GTGGGGTTGGGGGTGGAGGGAGG + Intronic
1017583326 6:155891702-155891724 TTGTGGATGGTGGGGGAAAGAGG - Intergenic
1018509461 6:164509847-164509869 TTGTGGTGGGGGAAGGAAGGTGG + Intergenic
1019798088 7:3066966-3066988 TTGGGGTTGGAGATGGAAGGGGG - Intergenic
1022996647 7:35762777-35762799 TTTTGGTGGGGGGTGGGAGGGGG - Intergenic
1023067143 7:36389615-36389637 TGGTTGTTGGGGGTGGAGCCAGG + Intronic
1023789049 7:43737532-43737554 TGGGGGTTGGGGGAGGAAAGGGG - Intergenic
1024462654 7:49674567-49674589 TTGTGGTTGGTGGTGGTGGGGGG - Intergenic
1026194189 7:68158323-68158345 TGGTGGTGGGGTGTGGAAGGTGG - Intergenic
1026253350 7:68689961-68689983 TTGTGGTTGGGGGTGGTTACGGG - Intergenic
1026844548 7:73690856-73690878 AAGTGGTTGGGGGAGCAACGTGG + Intronic
1028019306 7:85750279-85750301 GGGTGGTTGGTGGAGGAACGAGG + Intergenic
1029493295 7:100883957-100883979 TTGTGGTTGTGAGAGGAAGGGGG + Intronic
1030038556 7:105429463-105429485 ATGTGGTTGGGGGCTGGACGCGG - Intergenic
1030594891 7:111525974-111525996 TTGGGGGTGGGGGTGGAGTGGGG - Intronic
1030751006 7:113232686-113232708 TTGTGGTTGTGGGTGGGTCAGGG + Intergenic
1031522818 7:122787217-122787239 TTGGGGTTGGGGGTGTATAGAGG - Intronic
1032485696 7:132285920-132285942 TTGTGGGTGGGGGTGGTGGGTGG - Intronic
1033018141 7:137693188-137693210 GTGTGGTTGGGAGTGGGATGAGG + Intronic
1033022652 7:137742226-137742248 TGGGGGTTGGGGGTGGAAGGAGG - Intronic
1033113306 7:138602721-138602743 CTGTGGTTAGGGGTGGAAATGGG - Intronic
1034352882 7:150428732-150428754 GTGTGGTTGGGGGTCGGAGGGGG - Intergenic
1035391287 7:158506695-158506717 GTGGGGTTGGGGGAGGATCGGGG - Intronic
1037190074 8:16113897-16113919 TGGTGGTTGGGGGTGGTTGGGGG - Intronic
1038651835 8:29410961-29410983 GTGGGGTTGGGGGTGGATTGTGG + Intergenic
1039024867 8:33247202-33247224 TCGGGGGTGGGGGTGGAGCGAGG - Intergenic
1039550565 8:38440167-38440189 TTGTGGGTGGGGGAGGAACTCGG + Intronic
1039756509 8:40529111-40529133 TTGGGGCTGGGGGTGGAGTGTGG - Intergenic
1040509685 8:48083334-48083356 TTGTTGTTGGGGGTGGGGCTTGG + Intergenic
1042448186 8:68913963-68913985 TTGGGGTTGGGTGGGGACCGGGG - Intergenic
1042977154 8:74482009-74482031 TTGTGGTATGAGGTGGAATGGGG + Intronic
1044973399 8:97641798-97641820 TTGGGGATGGGGGTGGAGGGTGG - Intergenic
1045249515 8:100471821-100471843 TTGTGGTGGGGGGGGTAAGGGGG + Intergenic
1049581263 8:143412141-143412163 TCGTGGTTGGGGGGGGCACATGG - Intergenic
1051152526 9:14098947-14098969 TTGGGGTTGCGGGTGGATGGAGG + Intronic
1051237530 9:15017550-15017572 GTGTGGTGGGGGGTGGCAAGTGG - Intergenic
1051746264 9:20297841-20297863 TGGTGGGTGGGGGTGGAGCGTGG - Intergenic
1052480860 9:29024019-29024041 TATTGGTTGTGGGTGGAAGGAGG - Intergenic
1052877923 9:33581191-33581213 GTGGGGTTGGGGGTGAAAGGCGG + Intergenic
1053001722 9:34580415-34580437 TTGTTGTTGAGGGTGGAGTGGGG - Intronic
1053163612 9:35829614-35829636 TTGTGACAGGGGGTGGAACGAGG - Exonic
1053498058 9:38563014-38563036 GTGGGGTTGGGGGTGAAAGGCGG - Intronic
1053503290 9:38620408-38620430 TTGGATTTGGGGGTGGATCGCGG - Intergenic
1054375915 9:64449204-64449226 TGGGGGTTGTGGGTGGTACGGGG + Intergenic
1054880191 9:70136518-70136540 GTGTGGGAGGGGGTGGAAGGTGG - Intronic
1055426013 9:76197707-76197729 TTGTGGTTGGGGACAGAAGGAGG - Intronic
1057152832 9:92809501-92809523 TTGGATTTGGGGGTGGATCGCGG + Intergenic
1057152845 9:92809539-92809561 TTGGATTTGGGGGTGGATCGCGG + Intergenic
1057177662 9:93011395-93011417 CTGGGGATGGGGGTGGAAGGAGG - Intronic
1057672655 9:97107730-97107752 TTGTGGTTAGGGGTGGTCTGGGG + Intergenic
1057907530 9:98994111-98994133 TTGGGGGTGGGGGTGGCATGGGG + Intronic
1058313941 9:103540808-103540830 GTATGTTTGGGGGTGGAAAGGGG - Intergenic
1059719631 9:116946852-116946874 TGGAGGTTGGGGGTGGCATGGGG - Intronic
1059855101 9:118387750-118387772 GTGTGGTGGGGAGTGGAATGGGG + Intergenic
1060660503 9:125402498-125402520 TGGTGGGTGGGGGTGGCATGTGG + Intergenic
1060825164 9:126683599-126683621 TTATGGTTGTGGGCGGGACGGGG - Intronic
1061375619 9:130222756-130222778 GTGTGGTTAGGGGTGGCAGGAGG + Intronic
1062133780 9:134914029-134914051 TTGTGTTTGTGGGTGGAGCGTGG + Intronic
1186317016 X:8382031-8382053 TGGTGGGTGGAGGTGGAAGGGGG + Intergenic
1190214434 X:48470253-48470275 TTGTGGCTGGGTGGGGAATGTGG + Intronic
1190946197 X:55096275-55096297 TTGTGGCTGGGGCTGGGACCAGG + Intronic
1193261353 X:79410313-79410335 TGGTGGTTGGGGGCGGGATGTGG - Intergenic
1195943807 X:110188349-110188371 TAGGGGTTGGGGGTGGGACTTGG + Intergenic
1197170344 X:123426924-123426946 CTGTGTGTGGGGGTGGAAGGGGG + Intronic
1197180934 X:123535837-123535859 TTGTGGGTGGGGGAGGGAGGAGG + Intergenic
1199587584 X:149432391-149432413 TTGTGGTTAAGGGTGGAGCTGGG - Intergenic
1199646191 X:149914923-149914945 GGGTAGTTGGGGGTGGAAGGGGG + Intergenic
1199664949 X:150089147-150089169 ATTTGGTTGGGGGTGGCAGGTGG + Intergenic
1200097934 X:153672815-153672837 TGGTGGTGGGGGGTGGCACAGGG - Intronic
1200311439 X:155082376-155082398 TTGAGGTTGGCAGTGGAGCGTGG + Intronic
1200391384 X:155950144-155950166 TTGTGGTTGGTTTTGGAATGTGG + Intergenic