ID: 1162525159

View in Genome Browser
Species Human (GRCh38)
Location 19:11202554-11202576
Sequence CTTGTGGTTGGGGGTGGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1601
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 1566}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162525159_1162525168 -6 Left 1162525159 19:11202554-11202576 CCCGTTCCACCCCCAACCACAAG 0: 1
1: 0
2: 3
3: 31
4: 1566
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79
1162525159_1162525172 26 Left 1162525159 19:11202554-11202576 CCCGTTCCACCCCCAACCACAAG 0: 1
1: 0
2: 3
3: 31
4: 1566
Right 1162525172 19:11202603-11202625 TCTGCCAGCTTCGTGATCGATGG 0: 1
1: 0
2: 0
3: 6
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162525159 Original CRISPR CTTGTGGTTGGGGGTGGAAC GGG (reversed) Intronic
901236520 1:7670243-7670265 CTTGGGGCTGGGAGTGGAACGGG - Intronic
902362157 1:15947853-15947875 CTTGGGGTTGTGGAAGGAACTGG - Intronic
903000955 1:20265440-20265462 CTCTTGGCTGGGAGTGGAACTGG - Intergenic
903869052 1:26419110-26419132 TGTGTGGTTGGGGGTGGAATGGG + Intronic
903896994 1:26613395-26613417 GTTGTTGTTGGGGGTGGGGCTGG - Intergenic
903932405 1:26870590-26870612 CTGGTGCTGGGGAGTGGAACAGG + Intergenic
904812599 1:33173092-33173114 ATTGGGGTTGGGGGAGGAAAGGG - Intronic
904842167 1:33379494-33379516 CGGGTGGTTGGGGGTGGTAGTGG - Intronic
905250161 1:36643298-36643320 CCTGGGGCTGGGGATGGAACTGG - Intergenic
905796446 1:40818997-40819019 CTTGAGGGTGGGGCTGGAGCGGG + Intronic
906382895 1:45344149-45344171 CTTGTGGTTGGGAGTGGGGCTGG - Exonic
908011644 1:59784606-59784628 TATGTGTTTAGGGGTGGAACTGG + Intergenic
912467224 1:109882473-109882495 CTTGAGGTTTGGGGTGGGAGGGG + Intergenic
912630672 1:111244036-111244058 CTTGTGGGGAGGGGTGCAACTGG + Intergenic
913188573 1:116393202-116393224 CTTGTGGTTTGGGGTGGGTGTGG + Intronic
913993373 1:143635318-143635340 CTTCAGGTTGAGGGTGGCACAGG + Intergenic
914802413 1:150971350-150971372 GTGGTGGGTGGGGGTGGAGCGGG - Intronic
916602242 1:166304384-166304406 CTTGTGGGTGGGGCGGGAAGCGG + Intergenic
918029911 1:180796996-180797018 CCTGGGGTAGGGGGTGGAAGTGG + Intronic
918374951 1:183899802-183899824 CTGGTAGTTGGGGATGGCACTGG - Intronic
919779285 1:201212133-201212155 CTTGTGGATGGGGCAGGACCTGG + Exonic
920878989 1:209862978-209863000 CCTGTGGCTGGAGGTGGAAAGGG - Intergenic
921758717 1:218887318-218887340 CTTGTGGAGGGGGGAGAAACAGG + Intergenic
922045862 1:221945860-221945882 CTTGTGGCCTGGGGTGGCACTGG - Intergenic
922339958 1:224647412-224647434 CTTGTCCATGGAGGTGGAACAGG + Intronic
923057912 1:230441791-230441813 CTTGAGGAAGGGGGTGGACCAGG - Intergenic
924655601 1:245972604-245972626 CCAGGGGTTGGGGGAGGAACTGG - Intronic
1062898745 10:1125746-1125768 CTTCTGGCTGGAGGTGGAAGAGG - Intronic
1064075121 10:12262645-12262667 GTAGTGGTGGGGGGTGGCACTGG - Intergenic
1065025460 10:21535348-21535370 CTTCTGGCTCGGGGTGCAACGGG - Intronic
1065954874 10:30684491-30684513 CTTGTGGTTGGGGATGTGGCAGG - Intergenic
1066059051 10:31706300-31706322 TTTGTGCTTGGGGGTGGCATGGG - Intergenic
1067691622 10:48505605-48505627 CTTGTGGTTGGGGCAGGACCTGG + Intronic
1069562677 10:69441819-69441841 TGTGTGTTTGGGGGTGGAAGTGG - Intergenic
1069924215 10:71837177-71837199 CTTGTGGTTGGAGGTAGAAGGGG - Intronic
1070768179 10:79068302-79068324 CTGGTGGTTGGGGTGGGAAGAGG - Intergenic
1071263912 10:83946672-83946694 CTTGGGGCTGGAGGTGGACCTGG - Intergenic
1071283566 10:84124623-84124645 CTTTAGGTTGGGAGGGGAACAGG + Intergenic
1071485558 10:86099827-86099849 CTGGTGGCTGGGGGTGGCACAGG + Intronic
1071520823 10:86330571-86330593 CCTGTGGTTGGGGCAAGAACGGG - Intronic
1072667701 10:97406285-97406307 CTGGTGGCTGGGGGAGGAAAAGG + Intronic
1073236653 10:102022526-102022548 CTTTTGGTTGTGGGGGAAACAGG - Intronic
1073382877 10:103094109-103094131 CTGGTGGTGGGGGGTGGGATGGG - Intronic
1074431567 10:113399186-113399208 CATCTGGTTGGGGGTGGACATGG + Intergenic
1075234528 10:120714775-120714797 CTTGGGGGTGGGGGTGCTACTGG + Intergenic
1075898038 10:126014910-126014932 TTTGTGGTTGGGGGAGGCACGGG - Exonic
1076364087 10:129910990-129911012 CTGGTGGTTGGTGCTGGATCCGG - Intronic
1076502478 10:130948163-130948185 CTTGTGTGTGGGGGTGGTAGGGG - Intergenic
1076693713 10:132237013-132237035 CTCGTCGTTAGGGGTGGAACTGG - Intronic
1077107312 11:847857-847879 TCTGTGGCTGGGGGTGGAAGGGG - Intronic
1077182642 11:1223471-1223493 CTTGGTCTTGGGGGTGGGACAGG + Intronic
1078136981 11:8659666-8659688 CTTGTGTGTGGGTGTGGGACTGG + Intronic
1079658596 11:23013133-23013155 GTGGTGGTTGGGTATGGAACTGG - Intergenic
1080011626 11:27465344-27465366 CTTGTGGTTGGGGGAAGACCAGG + Intronic
1080110043 11:28556493-28556515 CTTGGGGGTGGGGGTGGGAGTGG + Intergenic
1080455141 11:32411940-32411962 CTTGTTGCTGGGGGTGGAGATGG + Intronic
1082896813 11:58200617-58200639 CTTGTGGTTGGGGCTGAGGCTGG + Intergenic
1087096859 11:94327399-94327421 GTGGTGGTGGGGGGTGGGACGGG + Intergenic
1087382347 11:97422667-97422689 CCTGTTGTTGAGGGTGGTACAGG + Intergenic
1090665814 11:128914343-128914365 GGTGTGGTTGGGGGTGCAGCGGG - Intronic
1091003556 11:131931747-131931769 CATGTGGTGGGGGGTGGTGCAGG + Intronic
1091332275 11:134739285-134739307 CGTGTGGTTTGGGTTGGAGCTGG + Intergenic
1091423592 12:365484-365506 CCTGTGTGTGGGGGTGGTACAGG + Intronic
1091781092 12:3215069-3215091 CTTGGGGATGGGGGTGGGAAGGG - Intronic
1093061917 12:14616361-14616383 CTTGTGTTTGGAGGAGGAACTGG + Intronic
1095730974 12:45506391-45506413 CTTGTGTCTGGGGGTGGGAAGGG + Intergenic
1096217710 12:49807726-49807748 GTTGTGGGTGAGGGTGGCACTGG - Intronic
1096512876 12:52141465-52141487 CATGTGGTTGAGGGTGGGAGGGG - Intergenic
1096656284 12:53094484-53094506 CCTGGGGTGGTGGGTGGAACTGG + Intergenic
1096958997 12:55558956-55558978 CCTGGGGTTGGGGGAGGAATGGG - Intergenic
1097007650 12:55930917-55930939 CTTTTGGTGGGGGTTGGAAAGGG - Intronic
1101471275 12:104999323-104999345 GTTGTGGGTGGGGGTAGTACTGG + Intronic
1101759760 12:107648934-107648956 CTTGGGGGTGGGCATGGAACTGG + Intronic
1102732095 12:115120630-115120652 CTTGAGGGTGGGGGGGGAAGAGG + Intergenic
1102821051 12:115909532-115909554 CTTGTGTTTGGGGTTGGGAGGGG + Intergenic
1104892317 12:132146162-132146184 CCTGGGGCTGGGGGTGGAAAGGG - Intronic
1108180457 13:47835307-47835329 CTCGTGGGTGGGGGTGGTCCAGG - Intergenic
1109729067 13:66386415-66386437 TTTTTGGATGGGGGTTGAACTGG + Intronic
1110791525 13:79591504-79591526 TCTGTGGTTGGGGGTGGGAGTGG + Intergenic
1112677704 13:101722647-101722669 CTTGTTGTGGGGGGTGCAACAGG + Exonic
1114492788 14:23113778-23113800 GTTGGGGTTGTGGGTGGAAAGGG - Intergenic
1115762663 14:36590836-36590858 CTTGTGGTGGGGGGTGGAGGGGG - Intergenic
1115764291 14:36607048-36607070 GGTGGGGTTGGGGGTGGGACTGG - Intergenic
1116984630 14:51205712-51205734 GTTCTGGTGGGGGTTGGAACTGG - Intergenic
1117411876 14:55457333-55457355 CTTGGGGTTGGGGGTGGAGGAGG + Intergenic
1117515979 14:56501861-56501883 CTGGGGGTGGGGGGTGGGACAGG - Intronic
1118359243 14:65042180-65042202 CCTGGGGTTGGGGGTGGGACGGG + Intronic
1119213643 14:72851516-72851538 CTTGTGGTTTGGGGAGGAAAAGG - Intronic
1120363910 14:83541364-83541386 CTTGTGGGTGGGGGAGGAGTGGG + Intergenic
1120857653 14:89226626-89226648 ATTGGGGTTGGGGGAGGCACAGG - Intronic
1122125943 14:99578933-99578955 CTTGTGGATGGAGGTGGGGCAGG - Intronic
1127312107 15:57761498-57761520 CTTGTGGTAGGGGTAGGCACAGG + Intronic
1129297194 15:74606127-74606149 CTTGAGGCTGGGGATGGGACTGG + Intronic
1129301525 15:74628409-74628431 CTTGTGGGTGGAGGTGGACTGGG - Intronic
1129302948 15:74636893-74636915 CTTTTGATTGGGGGTGGGAGAGG - Intronic
1130109223 15:80950850-80950872 TTTGTGGTTGGGGCAGGAAAGGG - Exonic
1130553103 15:84904530-84904552 TCTGTGGTTGGGGGTGGAGGTGG - Intronic
1130914176 15:88291596-88291618 CCCATGGTTGGGGGTGGCACTGG + Intergenic
1132928685 16:2447188-2447210 CTTGTGGTTGGGGAAGAAATTGG - Intronic
1133168141 16:3963600-3963622 TTTGTGGTTGGGGAAGGAAATGG + Exonic
1134320016 16:13154275-13154297 CTTGTGCTTGGGAGGAGAACAGG - Intronic
1135290463 16:21233188-21233210 CCTGAGGTTGGGAGTGGAAATGG + Intergenic
1135359869 16:21803400-21803422 CATGTTGTTGGGGGGGGGACTGG + Intergenic
1135795916 16:25442315-25442337 GTTGGGGGTGGGGGTGGGACAGG + Intergenic
1135851479 16:25967828-25967850 CTTGTGGGTGGGAGAGGAATTGG + Intronic
1136089970 16:27911667-27911689 CATGTGGTTGGGGGAGGGAGTGG - Intronic
1137942518 16:52702755-52702777 TAGGGGGTTGGGGGTGGAACTGG + Intergenic
1138499220 16:57428627-57428649 AATGTGGTTGGGGATGGAAGGGG + Exonic
1141434873 16:83994361-83994383 CTTGTGGTTGGGGGCAGAGGCGG - Exonic
1141490767 16:84371142-84371164 CTGGTGGTTGAGAGGGGAACTGG + Intronic
1142595544 17:1028089-1028111 CTTGGGGTGGGGGGAGGAAAGGG - Intronic
1143093992 17:4467005-4467027 CATGTGGGTGGGGGTGGAGCGGG + Intronic
1143430619 17:6880499-6880521 CTTTTGATTGGGGGTGGGAGGGG + Intronic
1143590552 17:7884181-7884203 CTTGGAGATGGGGGTGTAACAGG + Intronic
1144214268 17:13041109-13041131 ATTCTGGTTGGGGGAGGAAAGGG + Intergenic
1144574364 17:16419735-16419757 CTTGAGCTTGGGGCTGGATCTGG - Intronic
1145447566 17:23196501-23196523 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145447877 17:23200914-23200936 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145448062 17:23203632-23203654 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145448244 17:23206350-23206372 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145448414 17:23208898-23208920 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145448600 17:23211614-23211636 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145448785 17:23214333-23214355 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145449099 17:23219085-23219107 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145449244 17:23221291-23221313 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145449580 17:23226211-23226233 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145449769 17:23228930-23228952 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145449943 17:23231477-23231499 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145450128 17:23234189-23234211 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145450302 17:23236737-23236759 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145450456 17:23238938-23238960 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145450636 17:23241654-23241676 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145450790 17:23243858-23243880 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145450974 17:23246573-23246595 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145451162 17:23249288-23249310 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145451313 17:23251492-23251514 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145451453 17:23253529-23253551 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145451605 17:23255732-23255754 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145451712 17:23257264-23257286 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145451864 17:23259467-23259489 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145452044 17:23262181-23262203 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145452224 17:23264894-23264916 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145452375 17:23267099-23267121 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145452552 17:23269647-23269669 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145452704 17:23271850-23271872 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145452854 17:23274054-23274076 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145453009 17:23276256-23276278 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145453193 17:23278972-23278994 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145453345 17:23281176-23281198 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145453532 17:23283893-23283915 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145453706 17:23286442-23286464 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145453891 17:23289158-23289180 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145454076 17:23291873-23291895 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145454267 17:23294591-23294613 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145454439 17:23297140-23297162 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145454591 17:23299342-23299364 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145454773 17:23302059-23302081 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145454927 17:23304264-23304286 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145455115 17:23306980-23307002 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145455267 17:23309183-23309205 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145455407 17:23311221-23311243 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145455557 17:23313424-23313446 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145455712 17:23315627-23315649 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145455895 17:23318342-23318364 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145456080 17:23321055-23321077 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145456245 17:23323605-23323627 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145456431 17:23326322-23326344 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145456583 17:23328526-23328548 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145456770 17:23331242-23331264 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145456955 17:23333958-23333980 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145457143 17:23336672-23336694 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145457295 17:23338875-23338897 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145457480 17:23341591-23341613 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145457637 17:23343794-23343816 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145457788 17:23345999-23346021 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145457942 17:23348203-23348225 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145458126 17:23350919-23350941 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145458299 17:23353468-23353490 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145458483 17:23356183-23356205 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145458667 17:23358900-23358922 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145458849 17:23361617-23361639 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145459039 17:23364333-23364355 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145459224 17:23367047-23367069 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145459375 17:23369250-23369272 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145459526 17:23371452-23371474 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145459709 17:23374166-23374188 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145459863 17:23376369-23376391 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145460015 17:23378572-23378594 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145460197 17:23381122-23381144 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145460349 17:23383325-23383347 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145460547 17:23386206-23386228 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145460732 17:23388919-23388941 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145460915 17:23391635-23391657 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145461070 17:23393840-23393862 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145461247 17:23396386-23396408 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145461432 17:23399101-23399123 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145461604 17:23401649-23401671 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145461756 17:23403853-23403875 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145461908 17:23406056-23406078 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145462062 17:23408260-23408282 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145462253 17:23410976-23410998 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145462453 17:23413858-23413880 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145462638 17:23416575-23416597 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145462826 17:23419293-23419315 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145462980 17:23421496-23421518 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145463169 17:23424213-23424235 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145463322 17:23426417-23426439 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145463474 17:23428621-23428643 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145463623 17:23430827-23430849 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145463807 17:23433542-23433564 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145463962 17:23435747-23435769 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145464145 17:23438462-23438484 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145464329 17:23441175-23441197 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145464646 17:23445756-23445778 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145464832 17:23448472-23448494 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145464983 17:23450675-23450697 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145465137 17:23452879-23452901 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145465289 17:23455082-23455104 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145465442 17:23457286-23457308 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145465596 17:23459489-23459511 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145465785 17:23462204-23462226 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145465972 17:23464920-23464942 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145466155 17:23467637-23467659 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145466306 17:23469842-23469864 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145466494 17:23472557-23472579 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145466671 17:23475105-23475127 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145466826 17:23477308-23477330 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145467155 17:23482061-23482083 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145467340 17:23484777-23484799 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145467525 17:23487494-23487516 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145467679 17:23489697-23489719 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145467831 17:23491900-23491922 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145468015 17:23494615-23494637 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145468202 17:23497329-23497351 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145468358 17:23499532-23499554 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145468545 17:23502248-23502270 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145468686 17:23504284-23504306 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145468839 17:23506487-23506509 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145468990 17:23508690-23508712 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145469141 17:23510894-23510916 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145469292 17:23513097-23513119 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145469441 17:23515301-23515323 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145469594 17:23517505-23517527 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145469780 17:23520221-23520243 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145469934 17:23522425-23522447 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145470120 17:23525142-23525164 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145470425 17:23529548-23529570 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145470579 17:23531752-23531774 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145470731 17:23533955-23533977 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145470919 17:23536672-23536694 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145471071 17:23538875-23538897 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145471270 17:23541761-23541783 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145471452 17:23544479-23544501 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145471635 17:23547196-23547218 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145471980 17:23552120-23552142 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145472136 17:23554323-23554345 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145472290 17:23556526-23556548 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145472441 17:23558729-23558751 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145472627 17:23561445-23561467 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145472780 17:23563649-23563671 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145472954 17:23566197-23566219 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145473141 17:23568913-23568935 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145473314 17:23571464-23571486 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145473501 17:23574179-23574201 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145473654 17:23576384-23576406 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145473809 17:23578587-23578609 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145473994 17:23581303-23581325 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145474214 17:23584357-23584379 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145474365 17:23586560-23586582 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145474518 17:23588764-23588786 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145474692 17:23591314-23591336 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145474878 17:23594027-23594049 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145475234 17:23599291-23599313 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145475385 17:23601495-23601517 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145475538 17:23603698-23603720 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145475722 17:23606414-23606436 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145475876 17:23608617-23608639 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145476063 17:23611333-23611355 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145476250 17:23614050-23614072 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145476430 17:23616766-23616788 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145476583 17:23618969-23618991 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145476709 17:23620832-23620854 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145476894 17:23623548-23623570 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145477066 17:23626098-23626120 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145477248 17:23628814-23628836 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145477398 17:23631017-23631039 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145477581 17:23633733-23633755 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145477772 17:23636450-23636472 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145477958 17:23639165-23639187 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145478143 17:23641879-23641901 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145478297 17:23644082-23644104 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145478452 17:23646286-23646308 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145478640 17:23649003-23649025 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145478827 17:23651718-23651740 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145479012 17:23654434-23654456 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145479166 17:23656639-23656661 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145479306 17:23658675-23658697 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145479459 17:23660880-23660902 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145479612 17:23663083-23663105 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145479765 17:23665286-23665308 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145479966 17:23668172-23668194 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145480144 17:23670725-23670747 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145480298 17:23672929-23672951 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145480452 17:23675132-23675154 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145480643 17:23677849-23677871 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145480796 17:23680052-23680074 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145480949 17:23682255-23682277 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145481102 17:23684458-23684480 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145481255 17:23686661-23686683 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145481426 17:23689208-23689230 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145481578 17:23691411-23691433 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145481761 17:23694127-23694149 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145481914 17:23696330-23696352 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145482065 17:23698533-23698555 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145482241 17:23701081-23701103 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145482394 17:23703286-23703308 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145482546 17:23705489-23705511 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145482699 17:23707692-23707714 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145482850 17:23709895-23709917 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145483155 17:23714302-23714324 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145483307 17:23716505-23716527 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145483459 17:23718708-23718730 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145483647 17:23721425-23721447 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145483802 17:23723632-23723654 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145483955 17:23725836-23725858 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145484105 17:23728037-23728059 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145484247 17:23730072-23730094 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145484431 17:23732788-23732810 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145484631 17:23735672-23735694 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145484785 17:23737875-23737897 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145484934 17:23740076-23740098 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145485106 17:23742625-23742647 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145485280 17:23745173-23745195 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145485465 17:23747889-23747911 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145485646 17:23750605-23750627 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145485826 17:23753321-23753343 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145485977 17:23755524-23755546 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145486163 17:23758239-23758261 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145486317 17:23760442-23760464 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145486471 17:23762645-23762667 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145486658 17:23765361-23765383 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145486848 17:23768076-23768098 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145487034 17:23770792-23770814 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145487189 17:23772996-23773018 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145487375 17:23775711-23775733 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145487561 17:23778427-23778449 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145487747 17:23781143-23781165 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145487899 17:23783346-23783368 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145488087 17:23786063-23786085 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145488240 17:23788267-23788289 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145488423 17:23790983-23791005 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145488608 17:23793699-23793721 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145488914 17:23798106-23798128 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145489067 17:23800309-23800331 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145489256 17:23803023-23803045 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145489441 17:23805740-23805762 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145489594 17:23807944-23807966 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145489746 17:23810147-23810169 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145489871 17:23812011-23812033 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145490025 17:23814217-23814239 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145490209 17:23816932-23816954 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145490398 17:23819648-23819670 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145490772 17:23825078-23825100 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145490925 17:23827284-23827306 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145491102 17:23829835-23829857 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145491251 17:23832038-23832060 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145491427 17:23834585-23834607 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145491581 17:23836788-23836810 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145491734 17:23838991-23839013 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145491886 17:23841194-23841216 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145492040 17:23843398-23843420 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145492225 17:23846114-23846136 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145492376 17:23848317-23848339 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145492560 17:23851034-23851056 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145492739 17:23853749-23853771 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145492920 17:23856467-23856489 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145493108 17:23859182-23859204 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145493298 17:23861896-23861918 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145493448 17:23864100-23864122 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145493630 17:23866815-23866837 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145493815 17:23869530-23869552 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145494001 17:23872245-23872267 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145494189 17:23874961-23874983 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145494343 17:23877164-23877186 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145494505 17:23879537-23879559 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145494685 17:23882088-23882110 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145494838 17:23884293-23884315 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145495200 17:23889555-23889577 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145495353 17:23891758-23891780 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145495691 17:23896679-23896701 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145495869 17:23899394-23899416 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145496022 17:23901597-23901619 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145496211 17:23904310-23904332 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145496395 17:23907026-23907048 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145496565 17:23909575-23909597 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145496736 17:23912124-23912146 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145496920 17:23914837-23914859 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145497257 17:23919756-23919778 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145497446 17:23922473-23922495 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145497598 17:23924676-23924698 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145497750 17:23926879-23926901 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145497902 17:23929082-23929104 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145498082 17:23931798-23931820 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145498233 17:23934001-23934023 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145498403 17:23936550-23936572 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145498555 17:23938753-23938775 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145498709 17:23940956-23940978 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145498881 17:23943504-23943526 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145499059 17:23946054-23946076 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145499213 17:23948257-23948279 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145499547 17:23953177-23953199 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145499731 17:23955893-23955915 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145499920 17:23958608-23958630 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145500102 17:23961324-23961346 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145500285 17:23964039-23964061 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145500438 17:23966242-23966264 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145500594 17:23968445-23968467 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145500779 17:23971160-23971182 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145500965 17:23973876-23973898 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145501151 17:23976592-23976614 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145501302 17:23978794-23978816 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145501455 17:23980997-23981019 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145501628 17:23983544-23983566 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145501822 17:23986427-23986449 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145502007 17:23989142-23989164 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145502160 17:23991346-23991368 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145502312 17:23993548-23993570 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145502497 17:23996263-23996285 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145502685 17:23998980-23999002 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145502870 17:24001695-24001717 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145503059 17:24004410-24004432 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145503211 17:24006614-24006636 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145503365 17:24008817-24008839 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145503517 17:24011020-24011042 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145503707 17:24013734-24013756 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145503857 17:24015937-24015959 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145504029 17:24018486-24018508 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145504181 17:24020689-24020711 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145504320 17:24022731-24022753 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145504461 17:24024768-24024790 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145504612 17:24026969-24026991 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145504764 17:24029172-24029194 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145504943 17:24031720-24031742 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145505126 17:24034435-24034457 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145505311 17:24037151-24037173 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145505463 17:24039355-24039377 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145505644 17:24042069-24042091 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145505815 17:24044617-24044639 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145506002 17:24047334-24047356 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145506189 17:24050048-24050070 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145506373 17:24052764-24052786 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145506527 17:24054967-24054989 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145506682 17:24057170-24057192 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145506834 17:24059373-24059395 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145506976 17:24061408-24061430 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145507129 17:24063612-24063634 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145507315 17:24066327-24066349 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145507513 17:24069209-24069231 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145507668 17:24071412-24071434 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145507863 17:24074292-24074314 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145508015 17:24076495-24076517 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145508199 17:24079210-24079232 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145508383 17:24081925-24081947 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145508537 17:24084127-24084149 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145508721 17:24086842-24086864 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145508906 17:24089558-24089580 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145509094 17:24092274-24092296 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145509286 17:24094988-24095010 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145509439 17:24097192-24097214 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145509620 17:24099906-24099928 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145509772 17:24102109-24102131 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145509924 17:24104312-24104334 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145510077 17:24106516-24106538 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145510232 17:24108719-24108741 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145510423 17:24111434-24111456 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145510611 17:24114148-24114170 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145510791 17:24116862-24116884 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145510943 17:24119066-24119088 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145511117 17:24121616-24121638 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145511303 17:24124333-24124355 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145511644 17:24129247-24129269 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145511799 17:24131453-24131475 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145511984 17:24134168-24134190 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145512169 17:24136884-24136906 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145512325 17:24139088-24139110 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145512513 17:24141803-24141825 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145512665 17:24144006-24144028 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145512850 17:24146721-24146743 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145513003 17:24148924-24148946 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145513152 17:24151127-24151149 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145513218 17:24151977-24151999 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145513368 17:24154182-24154204 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145513686 17:24158766-24158788 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145513838 17:24160970-24160992 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145513990 17:24163173-24163195 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145514178 17:24165889-24165911 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145514329 17:24168093-24168115 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145514514 17:24170808-24170830 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145514667 17:24173012-24173034 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145514817 17:24175216-24175238 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145514983 17:24177597-24177619 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145515133 17:24179798-24179820 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145515322 17:24182519-24182541 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145515496 17:24185068-24185090 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145515681 17:24187783-24187805 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145515743 17:24188633-24188655 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145515896 17:24190839-24190861 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145516081 17:24193556-24193578 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145516266 17:24196272-24196294 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145516429 17:24198647-24198669 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145516579 17:24200851-24200873 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145516769 17:24203568-24203590 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145517122 17:24208662-24208684 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145517313 17:24211378-24211400 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145517498 17:24214093-24214115 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145517685 17:24216809-24216831 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145517875 17:24219525-24219547 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145518027 17:24221729-24221751 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145518211 17:24224445-24224467 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145518385 17:24226994-24227016 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145518570 17:24229709-24229731 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145518727 17:24231912-24231934 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145518867 17:24233948-24233970 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145518992 17:24235811-24235833 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145519146 17:24238014-24238036 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145519332 17:24240729-24240751 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145519484 17:24242931-24242953 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145519637 17:24245135-24245157 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145519819 17:24247851-24247873 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145519991 17:24250400-24250422 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145520177 17:24253115-24253137 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145520359 17:24255828-24255850 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145520558 17:24258716-24258738 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145520712 17:24260919-24260941 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145520900 17:24263639-24263661 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145521089 17:24266356-24266378 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145521278 17:24269070-24269092 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145521429 17:24271273-24271295 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145521582 17:24273476-24273498 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145521734 17:24275679-24275701 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145521918 17:24278396-24278418 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145522088 17:24280943-24280965 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145522264 17:24283492-24283514 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145522450 17:24286208-24286230 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145522602 17:24288412-24288434 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145522755 17:24290615-24290637 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145522945 17:24293331-24293353 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145523098 17:24295535-24295557 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145523287 17:24298251-24298273 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145523462 17:24300800-24300822 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145523647 17:24303517-24303539 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145523827 17:24306231-24306253 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145524013 17:24308949-24308971 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145524199 17:24311666-24311688 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145524357 17:24313872-24313894 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145524509 17:24316076-24316098 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145524694 17:24318792-24318814 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145524847 17:24320996-24321018 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145525001 17:24323199-24323221 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145525185 17:24325918-24325940 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145525331 17:24328122-24328144 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145525516 17:24330839-24330861 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145525703 17:24333554-24333576 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145525855 17:24335757-24335779 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145526042 17:24338473-24338495 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145526167 17:24340336-24340358 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145526348 17:24343052-24343074 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145526500 17:24345256-24345278 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145526689 17:24347972-24347994 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145527027 17:24352889-24352911 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145527286 17:24356791-24356813 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145527438 17:24358994-24359016 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145527625 17:24361713-24361735 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145527822 17:24364598-24364620 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145527973 17:24366800-24366822 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145528125 17:24369003-24369025 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145528278 17:24371206-24371228 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145528578 17:24375617-24375639 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145528732 17:24377820-24377842 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145528884 17:24380024-24380046 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145529068 17:24382739-24382761 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145529220 17:24384942-24384964 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145529404 17:24387656-24387678 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145529771 17:24393088-24393110 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145529921 17:24395291-24395313 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145530078 17:24397497-24397519 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145530420 17:24402414-24402436 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145530575 17:24404618-24404640 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145530728 17:24406821-24406843 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145530870 17:24408858-24408880 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145531057 17:24411574-24411596 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145531209 17:24413778-24413800 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145531359 17:24415981-24416003 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145531484 17:24417847-24417869 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145531660 17:24420395-24420417 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145531860 17:24423279-24423301 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145532047 17:24425996-24426018 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145532232 17:24428711-24428733 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145532383 17:24430915-24430937 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145532536 17:24433118-24433140 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145532689 17:24435321-24435343 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145532840 17:24437524-24437546 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145533027 17:24440240-24440262 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145533217 17:24442957-24442979 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145533369 17:24445160-24445182 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145533526 17:24447366-24447388 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145533710 17:24450082-24450104 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145533862 17:24452285-24452307 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145534159 17:24456695-24456717 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145534311 17:24458898-24458920 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145534494 17:24461613-24461635 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145534682 17:24464328-24464350 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145534837 17:24466531-24466553 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145534991 17:24468732-24468754 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145535143 17:24470936-24470958 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145535342 17:24473820-24473842 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145535495 17:24476023-24476045 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145535680 17:24478738-24478760 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145535832 17:24480941-24480963 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145536020 17:24483656-24483678 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145536205 17:24486375-24486397 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145536379 17:24488924-24488946 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145536531 17:24491128-24491150 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145536729 17:24494014-24494036 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145536880 17:24496220-24496242 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145537073 17:24499103-24499125 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145537257 17:24501819-24501841 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145537412 17:24504023-24504045 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145537564 17:24506226-24506248 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145537748 17:24508942-24508964 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145538029 17:24513006-24513028 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145538155 17:24514868-24514890 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145538308 17:24517072-24517094 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145538498 17:24519788-24519810 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145538649 17:24521991-24522013 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145538802 17:24524193-24524215 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145539140 17:24529114-24529136 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145539290 17:24531316-24531338 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145539452 17:24533690-24533712 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145539639 17:24536404-24536426 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145539977 17:24541322-24541344 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145540129 17:24543525-24543547 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145540314 17:24546241-24546263 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145540500 17:24548956-24548978 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145540836 17:24553876-24553898 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145541024 17:24556592-24556614 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145541210 17:24559307-24559329 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145541362 17:24561510-24561532 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145541514 17:24563715-24563737 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145541640 17:24565578-24565600 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145541831 17:24568292-24568314 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145542017 17:24571010-24571032 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145542207 17:24573725-24573747 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145542361 17:24575928-24575950 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145542549 17:24578644-24578666 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145542700 17:24580847-24580869 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145542889 17:24583558-24583580 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145543075 17:24586275-24586297 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145543295 17:24589495-24589517 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145543477 17:24592209-24592231 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145543629 17:24594412-24594434 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145543814 17:24597128-24597150 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145543966 17:24599331-24599353 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145544116 17:24601535-24601557 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145544268 17:24603738-24603760 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145544421 17:24605941-24605963 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145544599 17:24608488-24608510 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145544753 17:24610690-24610712 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145544907 17:24612892-24612914 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145545279 17:24618328-24618350 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145545430 17:24620531-24620553 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145545583 17:24622734-24622756 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145545758 17:24625282-24625304 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145545912 17:24627485-24627507 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145546064 17:24629688-24629710 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145546215 17:24631891-24631913 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145546397 17:24634605-24634627 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145546591 17:24637488-24637510 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145546774 17:24640203-24640225 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145547143 17:24645637-24645659 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145547295 17:24647840-24647862 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145547486 17:24650557-24650579 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145547669 17:24653274-24653296 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145547853 17:24655987-24656009 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145548030 17:24658535-24658557 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145548212 17:24661250-24661272 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145548361 17:24663453-24663475 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145548550 17:24666169-24666191 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145548702 17:24668372-24668394 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145548886 17:24671089-24671111 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145549010 17:24672951-24672973 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145549194 17:24675668-24675690 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145549346 17:24677871-24677893 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145549499 17:24680074-24680096 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145549686 17:24682790-24682812 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145549840 17:24684995-24685017 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145549992 17:24687197-24687219 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145550117 17:24689060-24689082 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145550291 17:24691610-24691632 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145550477 17:24694326-24694348 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145550664 17:24697042-24697064 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145550815 17:24699247-24699269 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145551003 17:24701963-24701985 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145551190 17:24704677-24704699 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145551345 17:24706880-24706902 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145551529 17:24709595-24709617 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145551700 17:24712143-24712165 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145551890 17:24714858-24714880 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145552041 17:24717061-24717083 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145552240 17:24719944-24719966 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145552393 17:24722147-24722169 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145552593 17:24725029-24725051 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145552749 17:24727232-24727254 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145552901 17:24729435-24729457 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145553087 17:24732151-24732173 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145553275 17:24734868-24734890 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145553437 17:24737242-24737264 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145553590 17:24739445-24739467 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145553772 17:24742163-24742185 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145553926 17:24744367-24744389 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145554078 17:24746570-24746592 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145554243 17:24748945-24748967 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145554399 17:24751149-24751171 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145554552 17:24753353-24753375 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145554736 17:24756069-24756091 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145554876 17:24758103-24758125 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145555050 17:24760650-24760672 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145555204 17:24762851-24762873 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145555544 17:24767767-24767789 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145555696 17:24769970-24769992 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145555880 17:24772686-24772708 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145556063 17:24775233-24775255 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145556235 17:24777782-24777804 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145556420 17:24780498-24780520 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145556609 17:24783216-24783238 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145556791 17:24785930-24785952 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145556945 17:24788133-24788155 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145557101 17:24790337-24790359 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145557252 17:24792540-24792562 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145557406 17:24794743-24794765 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145557590 17:24797458-24797480 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145557742 17:24799663-24799685 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145557926 17:24802379-24802401 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145558079 17:24804582-24804604 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145558221 17:24806617-24806639 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145558372 17:24808822-24808844 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145558558 17:24811538-24811560 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145558837 17:24815613-24815635 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145559021 17:24818327-24818349 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145559163 17:24820365-24820387 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145559348 17:24823082-24823104 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145559436 17:24824437-24824459 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145559591 17:24826640-24826662 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145559745 17:24828842-24828864 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145559895 17:24831046-24831068 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145560077 17:24833762-24833784 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145560228 17:24835965-24835987 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145560404 17:24838516-24838538 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145560556 17:24840719-24840741 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145560744 17:24843434-24843456 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145560897 17:24845637-24845659 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145561047 17:24847840-24847862 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145561230 17:24850555-24850577 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145561534 17:24854964-24854986 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145561714 17:24857512-24857534 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145561856 17:24859549-24859571 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145562242 17:24865146-24865168 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145562396 17:24867350-24867372 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145562581 17:24870065-24870087 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145562733 17:24872268-24872290 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145562885 17:24874470-24874492 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145563069 17:24877184-24877206 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145563221 17:24879387-24879409 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145563371 17:24881593-24881615 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145563567 17:24884478-24884500 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145563758 17:24887194-24887216 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145563945 17:24889910-24889932 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145564124 17:24892625-24892647 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145564312 17:24895343-24895365 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145564462 17:24897547-24897569 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145564614 17:24899750-24899772 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145564770 17:24901952-24901974 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145564945 17:24904502-24904524 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145565098 17:24906707-24906729 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145565252 17:24908910-24908932 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145565405 17:24911113-24911135 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145565558 17:24913317-24913339 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145565713 17:24915520-24915542 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145565899 17:24918236-24918258 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145566249 17:24923321-24923343 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145566401 17:24925524-24925546 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145566551 17:24927727-24927749 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145566750 17:24930611-24930633 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145566904 17:24932814-24932836 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145567077 17:24935363-24935385 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145567260 17:24938078-24938100 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145567411 17:24940282-24940304 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145567563 17:24942485-24942507 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145567749 17:24945202-24945224 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145567922 17:24947752-24947774 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145568072 17:24949954-24949976 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145568224 17:24952158-24952180 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145568376 17:24954359-24954381 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145568527 17:24956562-24956584 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145568681 17:24958765-24958787 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145568873 17:24961482-24961504 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145569026 17:24963685-24963707 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145569213 17:24966400-24966422 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145569399 17:24969113-24969135 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145569551 17:24971316-24971338 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145569706 17:24973520-24973542 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145570015 17:24977928-24977950 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145570167 17:24980131-24980153 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145570365 17:24983013-24983035 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145570547 17:24985727-24985749 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145570728 17:24988441-24988463 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145570882 17:24990645-24990667 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145571033 17:24992848-24992870 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145571221 17:24995563-24995585 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145571403 17:24998278-24998300 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145571592 17:25000994-25001016 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145571779 17:25003709-25003731 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145571963 17:25006424-25006446 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145572116 17:25008627-25008649 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145572275 17:25011004-25011026 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145572425 17:25013208-25013230 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145572577 17:25015411-25015433 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145572732 17:25017614-25017636 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145572882 17:25019817-25019839 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145573068 17:25022532-25022554 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145573221 17:25024735-25024757 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145573374 17:25026938-25026960 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145573525 17:25029142-25029164 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145573706 17:25031859-25031881 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145573888 17:25034574-25034596 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145574073 17:25037290-25037312 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145574275 17:25040174-25040196 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145574424 17:25042374-25042396 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145574576 17:25044581-25044603 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145574729 17:25046784-25046806 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145574907 17:25049335-25049357 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145575058 17:25051537-25051559 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145575212 17:25053742-25053764 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145575396 17:25056458-25056480 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145575549 17:25058662-25058684 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145575730 17:25061377-25061399 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145575914 17:25064091-25064113 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145576067 17:25066294-25066316 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145576220 17:25068497-25068519 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145576373 17:25070700-25070722 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145576562 17:25073417-25073439 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145576744 17:25076125-25076147 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145576932 17:25078841-25078863 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145577123 17:25081554-25081576 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145577302 17:25084270-25084292 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145577486 17:25086986-25087008 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145577640 17:25089192-25089214 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145577766 17:25091054-25091076 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145577960 17:25093769-25093791 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145578110 17:25095972-25095994 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145578262 17:25098175-25098197 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145578417 17:25100378-25100400 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145578600 17:25103095-25103117 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145578788 17:25105810-25105832 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145578973 17:25108526-25108548 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145579127 17:25110731-25110753 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145579292 17:25113111-25113133 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145579436 17:25115148-25115170 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145579589 17:25117363-25117385 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145579779 17:25120078-25120100 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145579932 17:25122280-25122302 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145580085 17:25124483-25124505 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145580283 17:25127369-25127391 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145580423 17:25129404-25129426 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145580609 17:25132120-25132142 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145580796 17:25134837-25134859 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145580979 17:25137553-25137575 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145581225 17:25141118-25141140 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145581376 17:25143321-25143343 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145581526 17:25145526-25145548 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145581678 17:25147729-25147751 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145581870 17:25150446-25150468 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145582054 17:25153159-25153181 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145582421 17:25158423-25158445 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145582573 17:25160627-25160649 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145582727 17:25162830-25162852 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145582877 17:25165033-25165055 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145583018 17:25167069-25167091 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145583205 17:25169785-25169807 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145583374 17:25172334-25172356 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145583564 17:25175055-25175077 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145583716 17:25177258-25177280 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145583900 17:25179974-25179996 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145584053 17:25182177-25182199 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145584195 17:25184215-25184237 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145584471 17:25188290-25188312 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145584624 17:25190494-25190516 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145584796 17:25193042-25193064 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145584986 17:25195756-25195778 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145585159 17:25198306-25198328 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145585346 17:25201020-25201042 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145585499 17:25203223-25203245 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145585682 17:25205939-25205961 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145585833 17:25208143-25208165 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145586024 17:25210861-25210883 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145586184 17:25213066-25213088 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145586336 17:25215272-25215294 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145586488 17:25217475-25217497 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145586640 17:25219679-25219701 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145586829 17:25222395-25222417 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145586981 17:25224598-25224620 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145587137 17:25226802-25226824 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145587327 17:25229522-25229544 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145587479 17:25231725-25231747 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145587678 17:25234612-25234634 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145587830 17:25236816-25236838 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145587993 17:25239198-25239220 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145588177 17:25241912-25241934 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145588392 17:25244964-25244986 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145588546 17:25247167-25247189 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145588707 17:25249535-25249557 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145588859 17:25251738-25251760 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145589044 17:25254453-25254475 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145589407 17:25259715-25259737 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145589585 17:25262263-25262285 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145589783 17:25265147-25265169 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145589970 17:25267863-25267885 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145590155 17:25270578-25270600 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145590340 17:25273294-25273316 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145590492 17:25275497-25275519 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145590677 17:25278213-25278235 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145590831 17:25280416-25280438 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145591030 17:25283300-25283322 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145591217 17:25286013-25286035 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145591367 17:25288217-25288239 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145591552 17:25290933-25290955 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145591872 17:25295686-25295708 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145592024 17:25297889-25297911 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145592177 17:25300092-25300114 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145592330 17:25302295-25302317 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145592515 17:25305010-25305032 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145592666 17:25307213-25307235 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145592818 17:25309416-25309438 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145593017 17:25312301-25312323 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145593172 17:25314506-25314528 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145593355 17:25317221-25317243 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145593540 17:25319937-25319959 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145593693 17:25322142-25322164 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145593835 17:25324178-25324200 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145594020 17:25326894-25326916 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145594206 17:25329610-25329632 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145594403 17:25332493-25332515 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145594573 17:25335041-25335063 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145594721 17:25337244-25337266 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145595083 17:25342676-25342698 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145595274 17:25345391-25345413 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145595460 17:25348107-25348129 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145595642 17:25350824-25350846 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145595875 17:25354217-25354239 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145596028 17:25356420-25356442 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145596209 17:25359135-25359157 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145596557 17:25364224-25364246 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145596744 17:25366939-25366961 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145596930 17:25369652-25369674 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145597081 17:25371857-25371879 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145597452 17:25377293-25377315 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145597609 17:25379667-25379689 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145597763 17:25381870-25381892 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145597971 17:25384927-25384949 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145598124 17:25387132-25387154 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145598277 17:25389336-25389358 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145598462 17:25392052-25392074 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145598615 17:25394255-25394277 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145598774 17:25396631-25396653 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145598957 17:25399347-25399369 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145599141 17:25402062-25402084 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145599291 17:25404265-25404287 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145599475 17:25406980-25407002 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145599638 17:25409360-25409382 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145600001 17:25414792-25414814 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145600185 17:25417506-25417528 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145600372 17:25420222-25420244 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145600529 17:25422598-25422620 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145600683 17:25424802-25424824 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145600823 17:25426841-25426863 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145601010 17:25429556-25429578 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145601161 17:25431761-25431783 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145601348 17:25434475-25434497 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145601500 17:25436678-25436700 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145601651 17:25438883-25438905 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145601840 17:25441597-25441619 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145602025 17:25444315-25444337 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145602214 17:25447030-25447052 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145602364 17:25449233-25449255 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145602549 17:25451950-25451972 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145602743 17:25454831-25454853 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145602930 17:25457543-25457565 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145603041 17:25459072-25459094 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145603227 17:25461788-25461810 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145603413 17:25464503-25464525 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145603595 17:25467220-25467242 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145603779 17:25469934-25469956 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145603964 17:25472651-25472673 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145604151 17:25475365-25475387 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145604337 17:25478080-25478102 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145604492 17:25480283-25480305 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145604679 17:25482997-25483019 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145604856 17:25485544-25485566 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145605045 17:25488262-25488284 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145605231 17:25490978-25491000 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145605383 17:25493181-25493203 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145605570 17:25495897-25495919 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145605752 17:25498612-25498634 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145605894 17:25500649-25500671 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145606046 17:25502852-25502874 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145606231 17:25505566-25505588 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145606416 17:25508284-25508306 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145606603 17:25510999-25511021 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145606798 17:25513882-25513904 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145606979 17:25516598-25516620 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145607132 17:25518801-25518823 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145607320 17:25521516-25521538 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145607471 17:25523720-25523742 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145607657 17:25526435-25526457 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145607826 17:25528814-25528836 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145608018 17:25531531-25531553 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145608181 17:25533907-25533929 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145608324 17:25535945-25535967 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145608479 17:25538149-25538171 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145608671 17:25540865-25540887 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145608845 17:25543413-25543435 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145609031 17:25546129-25546151 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145609171 17:25548164-25548186 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145609347 17:25550711-25550733 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145609651 17:25555119-25555141 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145609836 17:25557834-25557856 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145610022 17:25560550-25560572 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145610174 17:25562752-25562774 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145610343 17:25565123-25565145 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145610497 17:25567326-25567348 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145610701 17:25570382-25570404 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145610951 17:25573948-25573970 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145611126 17:25576496-25576518 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145611313 17:25579212-25579234 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145611500 17:25581928-25581950 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145611651 17:25584133-25584155 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145611804 17:25586338-25586360 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145611984 17:25589057-25589079 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145612318 17:25593977-25593999 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145612507 17:25596692-25596714 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145612697 17:25599409-25599431 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145612847 17:25601612-25601634 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145612998 17:25603815-25603837 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145613195 17:25606698-25606720 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145613377 17:25609416-25609438 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145613562 17:25612132-25612154 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145613701 17:25614168-25614190 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145613851 17:25616371-25616393 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145614005 17:25618575-25618597 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145614159 17:25620779-25620801 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145614329 17:25623326-25623348 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145614515 17:25626042-25626064 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145614701 17:25628757-25628779 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145615025 17:25633508-25633530 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145615212 17:25636224-25636246 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145615394 17:25638941-25638963 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145615581 17:25641658-25641680 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145615769 17:25644373-25644395 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145615982 17:25647425-25647447 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145616134 17:25649631-25649653 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145616294 17:25652009-25652031 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145616476 17:25654724-25654746 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145616664 17:25657439-25657461 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145616849 17:25660159-25660181 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145617012 17:25662539-25662561 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145617198 17:25665256-25665278 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145617389 17:25667970-25667992 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145617563 17:25670683-25670705 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145617713 17:25672886-25672908 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145617874 17:25675258-25675280 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145618070 17:25678141-25678163 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145618257 17:25680856-25680878 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145618456 17:25683740-25683762 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145618673 17:25686842-25686864 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145618861 17:25689559-25689581 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145618995 17:25691595-25691617 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145619176 17:25694314-25694336 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145619512 17:25699068-25699090 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145619684 17:25701619-25701641 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145619872 17:25704332-25704354 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145620025 17:25706540-25706562 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145620164 17:25708577-25708599 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145620352 17:25711292-25711314 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145620539 17:25714009-25714031 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145620726 17:25716727-25716749 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145620921 17:25719610-25719632 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145621102 17:25722327-25722349 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145621255 17:25724530-25724552 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145621456 17:25727415-25727437 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145621639 17:25730128-25730150 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145621823 17:25732845-25732867 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145621993 17:25735394-25735416 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145622228 17:25738539-25738561 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145622416 17:25741256-25741278 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145622598 17:25743973-25743995 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145622749 17:25746176-25746198 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145622932 17:25748892-25748914 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145623285 17:25753990-25754012 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145623436 17:25756194-25756216 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145623585 17:25758400-25758422 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145623773 17:25761115-25761137 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145623916 17:25763152-25763174 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145624104 17:25765868-25765890 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145624301 17:25768583-25768605 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145624457 17:25770786-25770808 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145624597 17:25772823-25772845 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145624780 17:25775540-25775562 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145624934 17:25777744-25777766 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145625265 17:25782664-25782686 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145625446 17:25785380-25785402 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145625636 17:25788094-25788116 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145625827 17:25790805-25790827 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145625979 17:25793010-25793032 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145626169 17:25795726-25795748 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145626334 17:25798108-25798130 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145626518 17:25800823-25800845 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145626676 17:25803028-25803050 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145626862 17:25805743-25805765 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145627011 17:25807945-25807967 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145627161 17:25810148-25810170 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145627348 17:25812863-25812885 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145627498 17:25815066-25815088 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145627862 17:25820333-25820355 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145628005 17:25822368-25822390 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145628191 17:25825083-25825105 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145628375 17:25827801-25827823 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145628561 17:25830512-25830534 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145628747 17:25833229-25833251 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145628922 17:25835777-25835799 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145629097 17:25838326-25838348 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145629282 17:25841042-25841064 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145629459 17:25843588-25843610 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145629644 17:25846303-25846325 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145629825 17:25849017-25849039 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145630010 17:25851734-25851756 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145630197 17:25854449-25854471 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145630383 17:25857162-25857184 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145630566 17:25859878-25859900 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145630741 17:25862425-25862447 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145630931 17:25865140-25865162 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145631119 17:25867857-25867879 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145631309 17:25870571-25870593 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145631500 17:25873288-25873310 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145631684 17:25876003-25876025 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145631869 17:25878718-25878740 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145632010 17:25880755-25880777 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145632192 17:25883468-25883490 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145632366 17:25886017-25886039 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145632554 17:25888734-25888756 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145632739 17:25891450-25891472 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145632937 17:25894333-25894355 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145633121 17:25897049-25897071 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145633259 17:25899086-25899108 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145633449 17:25901800-25901822 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145633637 17:25904516-25904538 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145633833 17:25907399-25907421 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145634016 17:25910116-25910138 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145634192 17:25912666-25912688 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145634332 17:25914702-25914724 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145634460 17:25916565-25916587 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145634636 17:25919112-25919134 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145634915 17:25922362-25922384 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145635055 17:25924398-25924420 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145635242 17:25927111-25927133 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145635392 17:25929317-25929339 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145635580 17:25932032-25932054 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145635733 17:25934235-25934257 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145635922 17:25936953-25936975 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145636113 17:25939668-25939690 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145636288 17:25942215-25942237 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145636464 17:25944758-25944780 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145636653 17:25947473-25947495 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145636827 17:25950024-25950046 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145637013 17:25952740-25952762 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145637202 17:25955458-25955480 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145637390 17:25958170-25958192 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145637565 17:25960717-25960739 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145637753 17:25963433-25963455 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145637949 17:25966316-25966338 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145638138 17:25969033-25969055 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145638323 17:25971749-25971771 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145638511 17:25974467-25974489 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145638701 17:25977182-25977204 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145638890 17:25979898-25979920 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145639065 17:25982444-25982466 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145639256 17:25985159-25985181 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145639625 17:25990592-25990614 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145639811 17:25993306-25993328 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145639999 17:25996023-25996045 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145640190 17:25998736-25998758 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145640344 17:26000940-26000962 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145640493 17:26003143-26003165 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145640677 17:26005859-26005881 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145640866 17:26008576-26008598 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145641053 17:26011288-26011310 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145641225 17:26013836-26013858 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145641413 17:26016550-26016572 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145641595 17:26019263-26019285 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145641779 17:26021978-26022000 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145641964 17:26024688-26024710 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145642148 17:26027404-26027426 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145642300 17:26029607-26029629 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145642485 17:26032324-26032346 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145642668 17:26035040-26035062 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145642834 17:26037417-26037439 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145643027 17:26040136-26040158 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145643223 17:26043015-26043037 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145643408 17:26045733-26045755 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145643582 17:26048283-26048305 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145643765 17:26050999-26051021 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145643954 17:26053717-26053739 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145644142 17:26056433-26056455 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145644518 17:26061861-26061883 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145644664 17:26064064-26064086 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145644849 17:26066782-26066804 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145645007 17:26068985-26069007 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145645194 17:26071699-26071721 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145645351 17:26073902-26073924 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145645506 17:26076107-26076129 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145645687 17:26078823-26078845 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145645871 17:26081538-26081560 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145646056 17:26084254-26084276 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145646243 17:26086967-26086989 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145646424 17:26089681-26089703 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145646611 17:26092396-26092418 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145646761 17:26094599-26094621 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145646947 17:26097314-26097336 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145647130 17:26100031-26100053 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145647318 17:26102746-26102768 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145647505 17:26105462-26105484 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145647689 17:26108174-26108196 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145647879 17:26110891-26110913 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145648068 17:26113606-26113628 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145648251 17:26116319-26116341 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145648434 17:26119034-26119056 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145648622 17:26121750-26121772 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145648808 17:26124463-26124485 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145648993 17:26127180-26127202 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145649167 17:26129725-26129747 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145649359 17:26132439-26132461 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145649550 17:26135156-26135178 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145649734 17:26137856-26137878 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145649924 17:26140574-26140596 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145649987 17:26141424-26141446 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145650174 17:26144137-26144159 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145650363 17:26146852-26146874 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145650563 17:26149735-26149757 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145650748 17:26152452-26152474 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145650935 17:26155167-26155189 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145651127 17:26157881-26157903 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145651316 17:26160594-26160616 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145651502 17:26163313-26163335 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145651693 17:26166028-26166050 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145651883 17:26168743-26168765 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145652068 17:26171460-26171482 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145652255 17:26174174-26174196 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145652436 17:26176721-26176743 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145652627 17:26179438-26179460 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145652813 17:26182153-26182175 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145653002 17:26184867-26184889 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145653194 17:26187581-26187603 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145653380 17:26190297-26190319 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145653566 17:26193009-26193031 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145653938 17:26198439-26198461 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145654124 17:26201155-26201177 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145654309 17:26203870-26203892 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145654499 17:26206586-26206608 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145654688 17:26209299-26209321 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145654878 17:26212013-26212035 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145655061 17:26214727-26214749 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145655246 17:26217445-26217467 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145655436 17:26220160-26220182 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145655625 17:26222876-26222898 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145655809 17:26225588-26225610 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145655986 17:26228136-26228158 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145656170 17:26230849-26230871 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145656358 17:26233564-26233586 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145656545 17:26236277-26236299 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145656734 17:26238990-26239012 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145656923 17:26241705-26241727 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145657105 17:26244420-26244442 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145657292 17:26247133-26247155 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145657469 17:26249680-26249702 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145657657 17:26252394-26252416 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145657841 17:26255111-26255133 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145658028 17:26257828-26257850 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145658215 17:26260541-26260563 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145658399 17:26263258-26263280 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145658586 17:26265972-26265994 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145658772 17:26268685-26268707 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145658962 17:26271399-26271421 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145659146 17:26274115-26274137 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145659332 17:26276828-26276850 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145659523 17:26279541-26279563 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145659711 17:26282255-26282277 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145659895 17:26284970-26284992 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145660081 17:26287686-26287708 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145660265 17:26290402-26290424 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145660453 17:26293116-26293138 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145660632 17:26295831-26295853 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145660824 17:26298546-26298568 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145661390 17:26306722-26306744 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145661579 17:26309434-26309456 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145661751 17:26311980-26312002 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145661938 17:26314695-26314717 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145662126 17:26317410-26317432 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145662316 17:26320124-26320146 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145662505 17:26322840-26322862 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145662667 17:26325219-26325241 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145662855 17:26327932-26327954 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145663041 17:26330646-26330668 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145663230 17:26333361-26333383 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145663415 17:26336074-26336096 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145663567 17:26338279-26338301 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145663754 17:26340996-26341018 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145664118 17:26346432-26346454 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145664308 17:26349147-26349169 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145664494 17:26351864-26351886 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145664680 17:26354580-26354602 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145664865 17:26357297-26357319 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145665050 17:26360013-26360035 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145665234 17:26362726-26362748 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145665421 17:26365443-26365465 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145665612 17:26368157-26368179 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145665800 17:26370872-26370894 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145665975 17:26373421-26373443 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145666161 17:26376138-26376160 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145666352 17:26378853-26378875 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145666538 17:26381570-26381592 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145666727 17:26384285-26384307 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145666911 17:26386998-26387020 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145667094 17:26389714-26389736 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145667271 17:26392261-26392283 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145667454 17:26394975-26394997 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145667643 17:26397689-26397711 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145667829 17:26400407-26400429 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145668018 17:26403125-26403147 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145668190 17:26405670-26405692 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145668379 17:26408383-26408405 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145668562 17:26411095-26411117 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145668744 17:26413812-26413834 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145668930 17:26416528-26416550 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145669117 17:26419241-26419263 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145669285 17:26421622-26421644 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145669461 17:26424169-26424191 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145669649 17:26426885-26426907 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145669837 17:26429601-26429623 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145670027 17:26432317-26432339 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145670216 17:26435029-26435051 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145670399 17:26437745-26437767 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145670585 17:26440462-26440484 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145670782 17:26443179-26443201 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145670968 17:26445895-26445917 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145671141 17:26448448-26448470 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145671329 17:26451161-26451183 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145671518 17:26453878-26453900 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145671702 17:26456595-26456617 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145671888 17:26459311-26459333 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145672074 17:26462025-26462047 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145672255 17:26464741-26464763 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145672441 17:26467456-26467478 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145672628 17:26470167-26470189 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145672813 17:26472883-26472905 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145672998 17:26475595-26475617 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145673182 17:26478309-26478331 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145673552 17:26483742-26483764 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145673734 17:26486458-26486480 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145673920 17:26489173-26489195 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145674111 17:26491890-26491912 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145674297 17:26494606-26494628 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145674484 17:26497320-26497342 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145674664 17:26500034-26500056 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145674851 17:26502752-26502774 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145675039 17:26505465-26505487 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145675403 17:26510728-26510750 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145675593 17:26513446-26513468 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145675768 17:26515994-26516016 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145675953 17:26518711-26518733 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145676138 17:26521428-26521450 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145676324 17:26524142-26524164 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145676511 17:26526860-26526882 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145676693 17:26529576-26529598 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145676882 17:26532293-26532315 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145677061 17:26535010-26535032 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145677248 17:26537726-26537748 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145677442 17:26540443-26540465 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145677626 17:26543159-26543181 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145677813 17:26545872-26545894 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145678001 17:26548588-26548610 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145678193 17:26551303-26551325 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145678380 17:26554022-26554044 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145678557 17:26556571-26556593 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145678925 17:26562001-26562023 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145681175 17:26594510-26594532 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145681838 17:26604035-26604057 TTTGTGGTTTGTGGTGGAAAAGG + Intergenic
1145687306 17:26684799-26684821 CTTGTGGCTTGTGGTGGAAAAGG + Intergenic
1145707425 17:26885803-26885825 TTTGTGGTTTGTGGTGGAAAAGG - Intergenic
1145867032 17:28248031-28248053 GGTGTGGTGGGGGGTGGAAGAGG + Intergenic
1146547136 17:33749281-33749303 CTTGGGGTTGGGGGAGCAGCTGG - Intronic
1146977168 17:37123517-37123539 CTTGGGGTTGGGGCTGGGATGGG + Intronic
1147980839 17:44272960-44272982 CTGGGGGATGGGGCTGGAACTGG + Intergenic
1148670098 17:49403877-49403899 CTTCGGGTTGGGGATGGATCTGG + Intronic
1148719335 17:49739647-49739669 CTTGTGGTTGGAAGATGAACTGG + Intronic
1150590897 17:66561241-66561263 CTTGTGTTTACGGATGGAACTGG + Intronic
1151705581 17:75765275-75765297 GTTGCGGGTGGGGGCGGAACCGG - Exonic
1151955340 17:77377297-77377319 CTTCTGGTTGGTGGAGGCACGGG + Intronic
1152255281 17:79235401-79235423 CTTGGGGTTGGGGGAGGGAAAGG + Intronic
1153951954 18:10065038-10065060 CTTGATGTTGGAGGTGGACCTGG + Intergenic
1155031801 18:21991349-21991371 CTTGTGGTTGGGGGTGGAGGTGG + Intergenic
1155513535 18:26600865-26600887 AATGTGGTTGGGGATGGAAGGGG - Intronic
1155989996 18:32270328-32270350 TTTGCGCTTCGGGGTGGAACAGG + Exonic
1158973748 18:62692179-62692201 CTGGTGGTTGGGTGTGAAGCTGG + Intergenic
1159695074 18:71546796-71546818 CCTGTCGTTGGGGGTGGAGTAGG + Intergenic
1161264542 19:3358386-3358408 TGTGTGGAGGGGGGTGGAACTGG + Intergenic
1161675019 19:5641407-5641429 CTTCTGCTTGGGGGTGGGGCAGG + Intronic
1162525159 19:11202554-11202576 CTTGTGGTTGGGGGTGGAACGGG - Intronic
1162704442 19:12544873-12544895 CTTGTGACTGTGGGTGAAACAGG - Intronic
1163051683 19:14689620-14689642 CTTGTGCTTGGGGTGGGAATGGG - Intronic
1163186807 19:15644598-15644620 CTTGTGGCTGGTGGAGGATCTGG + Intronic
1163217995 19:15894942-15894964 CTTGTGGCTGGTGGGGGATCTGG - Intronic
1163490850 19:17616468-17616490 ATTGGGGGTGGGGGTGGAAGGGG + Intronic
1165713167 19:38026458-38026480 GTTGTGGGTGGAGGTGGGACTGG - Intronic
1165728622 19:38130157-38130179 CTTGTGGTTGGGTGGGGCCCTGG - Intronic
1165775370 19:38401269-38401291 CTGGAAGTTGGGGGTGGACCAGG - Intergenic
1165798696 19:38534615-38534637 GTTGTGGATGTGGCTGGAACAGG + Intronic
1165810850 19:38610898-38610920 CTGGTGGTCGGGGGTGGTCCTGG + Intronic
1166550888 19:43665280-43665302 CTTGGGGTTGGGGATGGCAAGGG + Intronic
1166623276 19:44324820-44324842 CTTGTGCTTAGGGTGGGAACTGG + Intergenic
1166726944 19:45034328-45034350 CCTGGGGATGGGGGTGGAAAGGG - Intronic
1166781714 19:45346633-45346655 CGTGTGGCTGCGGGAGGAACTGG + Exonic
1167446956 19:49543375-49543397 CCTGGGGTTGGGGGTGTGACAGG - Exonic
1167468865 19:49664533-49664555 CTGGTGGGTGGGGCTAGAACGGG - Intronic
1167752375 19:51388709-51388731 GTTGTGGTTGGGGATGGCATTGG + Exonic
927292366 2:21417239-21417261 CTTGTTGTTGGTGGTGGTAAGGG + Intergenic
927727119 2:25434244-25434266 CCTGAGGTTGGGGGTGGGAGTGG - Intronic
927810952 2:26179905-26179927 CTTGTGGTTGGGGCAGGGGCGGG + Intronic
927845726 2:26471433-26471455 CTGGGGGTTGGGTGTGGAAGTGG - Intronic
928135043 2:28681697-28681719 CTTGGGGCTGGGGGTGGCACAGG + Intergenic
928894064 2:36240761-36240783 CTTGTGTTTGGGGGTGGGGTTGG - Intergenic
932309546 2:70728744-70728766 CTTATGCTTGTGGGTGGAAAGGG - Intronic
932316167 2:70784926-70784948 TTTGTGGTGGGGGGTGGTGCTGG - Intronic
935156041 2:100484525-100484547 CTTGTGGCTGGTGTTGGAAGTGG + Intergenic
936968753 2:118153574-118153596 CATGTGCTTGGGGGGGGAACGGG - Intergenic
937326384 2:120991832-120991854 GGTGTGGTTGGGGGTGGAAAGGG + Exonic
944822045 2:203441025-203441047 CCTGGGGTTGGGGGTGGAGGAGG + Exonic
945962081 2:216146199-216146221 GTTGTGGTTGGTGGTTGAAATGG + Intronic
946306844 2:218860881-218860903 CTTGGGGGTGGGGGTGGGGCCGG + Intronic
947536435 2:230942796-230942818 CTTGTGGATGGGGGTGGGGGTGG - Intronic
947739917 2:232480342-232480364 CTTGTGTTTGGGGTGGGATCAGG - Intronic
948133007 2:235614654-235614676 CTTGTGGTTTGGGGTGTGCCAGG + Intronic
949055812 2:241927831-241927853 CTTGTGAGTGGAGGTGGAGCGGG - Intergenic
1169004756 20:2197198-2197220 CATGAGGTTGGGGATGGAAGAGG - Intergenic
1170784908 20:19459442-19459464 CTTCTGGTTGTGGAAGGAACAGG + Intronic
1171278804 20:23879867-23879889 GAGGTGGTTGGGGGTGGAAAGGG - Intergenic
1173218078 20:41105971-41105993 GTTGTGGGTGGGGGTGGGAGGGG - Intronic
1173528568 20:43751172-43751194 ATTGGGGGTGGGGGTGGATCTGG + Intergenic
1174253084 20:49233920-49233942 CAAGTGGTTGGGAGTTGAACAGG - Intronic
1175545363 20:59774566-59774588 CTCGTGCCTGGGGGAGGAACAGG + Intronic
1175788645 20:61727830-61727852 CTTGTGGCTGGGGGTGGTCGGGG - Intronic
1176106980 20:63394056-63394078 CTTGGGGTTGGGGGAGGGCCAGG + Intergenic
1176198374 20:63848225-63848247 CTGCTGGCTGAGGGTGGAACTGG - Intergenic
1178354438 21:31898694-31898716 GTTGTGGAGTGGGGTGGAACAGG + Intronic
1179471634 21:41614273-41614295 GTTGGGGTTGCAGGTGGAACTGG + Intergenic
1179499874 21:41801461-41801483 CTTCCGGCTGGGGGTGGATCTGG + Exonic
1179950090 21:44704399-44704421 CTGGGGGTTGGGGGTGGACTTGG - Intronic
1180115835 21:45704358-45704380 ATGGTGGTTGGTGGGGGAACTGG + Intronic
1180150477 21:45944643-45944665 CATGTGGTTGTGGGTGGAACTGG - Intergenic
1180879381 22:19193066-19193088 CTTGTGGTTGGTGGGGAAGCAGG - Intronic
1180938427 22:19641333-19641355 CTTCTGGCTGGAGGTGGAACTGG - Intergenic
1180941661 22:19663611-19663633 CATGTGGCTGGGAGTGGCACGGG + Intergenic
1181012900 22:20052724-20052746 CTTGTGCTTGGGAGTGGGATGGG + Intronic
1182112411 22:27732885-27732907 CTTGGGGTGGGGGTGGGAACAGG + Intergenic
1182422966 22:30257512-30257534 CTGGAGGTGGGGGGTGGAAGTGG - Intergenic
1184308255 22:43623968-43623990 CTTGGTGGTGGAGGTGGAACAGG + Intronic
1184707393 22:46224059-46224081 TTTGTGGGTGTGGGTGGAAGAGG - Intronic
1185014975 22:48337437-48337459 CTTGGGTTTGGGGGTCGGACTGG - Intergenic
1185192396 22:49447023-49447045 CTCTGGGTTGGGGGTGGAAGGGG - Intronic
952958886 3:38577441-38577463 CTTGTGGGTGTGGGTGTAAAGGG + Intronic
953998140 3:47536318-47536340 CTTGTGCTTTGGGGGGGCACAGG - Intergenic
954665243 3:52248063-52248085 CTGGTGGTTGGAGGAGGGACTGG + Intronic
955542608 3:59993729-59993751 CTTGATGTTGGAGGTGTAACGGG + Intronic
956594475 3:70950595-70950617 CTTTTGGTTAGGGCTGGAACTGG + Intergenic
956798732 3:72738532-72738554 CTTGGGGATGGGGGTGGGATGGG + Intergenic
956880947 3:73510030-73510052 CTGGAGGTTGGGGGTGGAGGAGG + Intronic
957955952 3:87187182-87187204 CTTGGTGTTGGGGATGGAAGAGG + Intergenic
960026787 3:113019454-113019476 CATGTGGGCGGGGGTGGTACCGG - Intronic
960627978 3:119700228-119700250 CTTGTAGTTGGGGGAGGGATTGG + Intergenic
961060728 3:123826050-123826072 TTTGGGGGTGGGGGTGGTACAGG - Intronic
961125889 3:124417212-124417234 CTGCTAGTTGGTGGTGGAACTGG - Intronic
961975975 3:131025946-131025968 CTCGTGGTTAGGGGTGTAACTGG - Intronic
962459361 3:135594959-135594981 TTGGTGGTTGGGGGTGGATAGGG - Intergenic
968956070 4:3720232-3720254 CTTTTCGATGGGGTTGGAACAGG + Intergenic
970243593 4:14035086-14035108 CTTGTGGTTGGGGAGGGGACGGG + Intergenic
970330095 4:14973018-14973040 CCTGATGTTGGGGGAGGAACCGG - Intergenic
972655571 4:41060492-41060514 CTTGGGCTAAGGGGTGGAACTGG - Intronic
975697329 4:77026130-77026152 CTTGTGGTTGGGACTGGATAAGG + Intronic
975961756 4:79917341-79917363 CTTGTGGTTGGGGAAGGCTCTGG - Intronic
976137989 4:81959705-81959727 CTTCTGGTTGGGAGTGGCCCTGG + Intronic
976575190 4:86661900-86661922 CTTGGGGTTGGGGGTGTAAGAGG - Intronic
977399190 4:96510132-96510154 CTTGTGGTCTGGGGTGGCAGTGG + Intergenic
977441417 4:97072672-97072694 CTTGTGGTGTGAGGTGAAACAGG - Intergenic
979347089 4:119601231-119601253 CCAGAGGTTGGGGGTGGGACTGG - Intronic
980344228 4:131591592-131591614 CTTGTGTTTGTGCGTGGAAGTGG + Intergenic
982208899 4:153019264-153019286 CGTGTGGGTGGGGGTGGGGCTGG + Intergenic
982450845 4:155550740-155550762 CCAGGGGTTGGGGGTGAAACAGG + Intergenic
983693400 4:170499775-170499797 CTGGTGGTAGGGAGTGGAAGTGG + Intergenic
983698627 4:170564263-170564285 CTTGTGGTTGGGACTGAACCTGG + Intergenic
983772234 4:171565410-171565432 CTTGAGGTTTGGGGTTGAAGGGG - Intergenic
985481142 5:111540-111562 CTTGAGGGTGGGGGAGGAATGGG + Intergenic
985843496 5:2327209-2327231 CTTGTGGGTGAAGATGGAACTGG - Intergenic
986587281 5:9331663-9331685 CTTGTGGGTGGGGGTGGCAAGGG - Intronic
986591411 5:9374790-9374812 CTTGTGGGTGGGGGTGGGTGCGG - Intronic
991388307 5:66114579-66114601 CTGGGGGGTGGGGGTGGAAGGGG + Intergenic
993887158 5:93428225-93428247 ATTGTGGTTGTGTGTGGAAAAGG + Intergenic
994546169 5:101168828-101168850 CTTGTCGTTGGGTGGGGGACAGG + Intergenic
994856017 5:105120016-105120038 CTTGTGTTTTGGGGTTGATCTGG + Intergenic
995722536 5:115151505-115151527 GTGGTGGTAGGGGGAGGAACAGG - Intronic
996638792 5:125728489-125728511 CAAGGGGTTGGGGGTGGAAAGGG + Intergenic
997818056 5:137036909-137036931 CTTCTGGTTGGGGGGTGAATGGG - Intronic
997975215 5:138437984-138438006 CTTGCTGATGGGGGTGGAACTGG + Intergenic
998365463 5:141628019-141628041 CTTTAGGTTGGTGGTGGAAGGGG - Intronic
999363819 5:151008201-151008223 CTTGTGGGTCAGGGTGGAAAGGG - Intergenic
1000727752 5:164792849-164792871 GTAGAGGTTGGGGGTGGAAGGGG - Intergenic
1001713012 5:173793108-173793130 CTTGTGGGTGGGGGTGGGTGGGG + Intergenic
1003703235 6:8494243-8494265 CTTGTGGTTGGGCCTGCAGCTGG + Intergenic
1003888275 6:10540541-10540563 CTGGTGGTTGGGGGTGGGCAGGG - Intronic
1004098626 6:12585371-12585393 CTTGTGGTTCAGGATGGCACTGG + Intergenic
1004200128 6:13540630-13540652 CTTAGGGTTGGGAGTGGAAAAGG + Intergenic
1005194496 6:23266991-23267013 CTTTTGGTGGGGGTTGGAAGAGG + Intergenic
1005898230 6:30196127-30196149 GTTGTGGTTGGGGGTGGCTGAGG - Intronic
1006472058 6:34235202-34235224 CTGGTGGGTGGGGGTGGGGCGGG - Intergenic
1006919140 6:37616030-37616052 CTTGGGGTTGGGGGTGGGAGTGG - Intergenic
1007154450 6:39728838-39728860 CTGATGGTTGGAGGTGGAAGAGG + Intergenic
1007404938 6:41629697-41629719 CTGGGGGTTGGGGGTGTTACTGG + Intergenic
1008314584 6:50024970-50024992 CTTGCAGTTGGGGGTGGTAAGGG - Intergenic
1009843055 6:69101161-69101183 CTTGTGTTTGGGGGTTGGGCAGG - Intronic
1012033439 6:94101621-94101643 CTTGAGGTTGGGGGTGGGGGTGG + Intergenic
1017809427 6:157974353-157974375 CAGGTGGCTGGGGGTGGAGCGGG - Intergenic
1018264113 6:162003087-162003109 GTTGTTGTTGGTGGTGGAAGTGG + Intronic
1018504055 6:164444473-164444495 CCTGTGGTTGGTGCTGGAACAGG + Intergenic
1019584768 7:1793001-1793023 CTTGTAGTTGGTGGAGGAGCAGG + Intergenic
1019679868 7:2341094-2341116 CAAGTGGTTGGGGCTGCAACAGG + Intronic
1020192437 7:6010341-6010363 CCTGGGGTTGGGGGTGGAGAGGG - Intronic
1020378965 7:7521060-7521082 CTTGTATTTGGGGGTGGGAGGGG - Intronic
1020471870 7:8546720-8546742 CTTATGGTAGGGGATGGAGCAGG - Intronic
1020512608 7:9077117-9077139 TTTGTTGTTGGGGGGGGAAATGG - Intergenic
1021535747 7:21702361-21702383 CTTCTGGTTGGAGGTGAAAACGG + Intronic
1022894144 7:34732415-34732437 CTAGTGGTGGGGGCAGGAACTGG + Intronic
1022996648 7:35762778-35762800 CTTTTGGTGGGGGGTGGGAGGGG - Intergenic
1023337701 7:39187342-39187364 TTTGGGGTTTGGGGTGGAACAGG - Intronic
1026026665 7:66750745-66750767 CTCATGTTTGGGGCTGGAACTGG - Intronic
1026253351 7:68689962-68689984 GTTGTGGTTGGGGGTGGTTACGG - Intergenic
1026898254 7:74022851-74022873 ATTTTGGTGGGGGGTGGAAGTGG + Intergenic
1028751880 7:94391948-94391970 CCTGGGGATGGGGGTGGGACTGG - Intergenic
1029380922 7:100214035-100214057 CTTGAGGTAGGGAGTGGAGCTGG - Exonic
1029400296 7:100340973-100340995 CTTGAGGTAGGGAGTGGAGCTGG - Intronic
1030751005 7:113232685-113232707 GTTGTGGTTGTGGGTGGGTCAGG + Intergenic
1033113307 7:138602722-138602744 ACTGTGGTTAGGGGTGGAAATGG - Intronic
1035924392 8:3711449-3711471 CCTTTGGTTGGGGTTGGACCTGG - Intronic
1042448187 8:68913964-68913986 CTTGGGGTTGGGTGGGGACCGGG - Intergenic
1045138456 8:99249908-99249930 CTTGCGGTTGGGGGTGGTGGGGG + Intronic
1046049766 8:109009095-109009117 CTTGAGGATGGTGGTGGAAGTGG - Intergenic
1047343981 8:124009642-124009664 CTGGAGCCTGGGGGTGGAACTGG + Intronic
1048036457 8:130682039-130682061 CTTGTGGTTGGGTGGGGCAGTGG + Intergenic
1048480195 8:134782905-134782927 CTTGGGGTAGGGGGTGGAAATGG - Intergenic
1049386471 8:142345365-142345387 GCTGTGGTTTGGGGAGGAACAGG - Intronic
1050258573 9:3817690-3817712 CTCATGGTTGAAGGTGGAACAGG - Intergenic
1052334988 9:27309917-27309939 CTGGTGGTGGGGGATGGTACTGG + Intergenic
1052984879 9:34479612-34479634 CTTGTGGTTTGGGTTGGGATTGG + Intronic
1053143652 9:35697610-35697632 CTTGGGGTTGGGGAGGGGACAGG + Exonic
1056780667 9:89547825-89547847 CTTGTGGTTGTGTGTGCCACTGG + Intergenic
1057455577 9:95206995-95207017 CTGGGGGCTGGGGGTGGAGCAGG - Intronic
1057498994 9:95581908-95581930 ACTGTGTTTGGGGGTGGAAACGG + Intergenic
1058351381 9:104028758-104028780 CTTGTGGTGGGGGGTGCATCAGG + Intergenic
1059450945 9:114371149-114371171 CTTGGGGTTGGGGCAGGACCAGG - Intronic
1060055364 9:120408546-120408568 CTTGTGACTGAGGGTGGAATTGG - Intronic
1060173565 9:121480804-121480826 CTTTCGTTTGGGTGTGGAACTGG - Intergenic
1062262916 9:135671774-135671796 CTGGGGGTTTGGGGTGGGACGGG + Intergenic
1187729058 X:22234607-22234629 CTTGAGCTTGGGGGGGGAAGGGG - Intronic
1189937772 X:46087419-46087441 CTTGAGGTTGGTGGGGGAAGGGG + Intergenic
1191112137 X:56812253-56812275 CTTGTGGTTTGGGGAGGGTCGGG + Intergenic
1192805749 X:74507052-74507074 CTTGTGGTTGGGGGGGGAGCGGG - Intronic
1193673598 X:84419404-84419426 CTTGTGGTATGGGGTGGCAGTGG + Intronic
1194731634 X:97462203-97462225 ACTGTGGGTGGGGGTGCAACAGG + Intronic
1197118337 X:122860610-122860632 CTTGTGATTAAGGGTGGATCAGG - Intergenic
1197370614 X:125621707-125621729 CGTGTGGTTGCGGGTGGACTTGG - Intergenic
1199587585 X:149432392-149432414 ATTGTGGTTAAGGGTGGAGCTGG - Intergenic
1200097935 X:153672816-153672838 GTGGTGGTGGGGGGTGGCACAGG - Intronic
1200136062 X:153875396-153875418 CCTGTGGTGGGGGATGGAAGCGG + Intronic
1201440427 Y:14001811-14001833 ATTGAGGGTGGGGGTGCAACTGG - Intergenic
1201444144 Y:14040897-14040919 ATTGAGGGTGGGGGTGCAACTGG + Intergenic