ID: 1162525168

View in Genome Browser
Species Human (GRCh38)
Location 19:11202571-11202593
Sequence CACAAGGACGTGCCTCCAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 79}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162525159_1162525168 -6 Left 1162525159 19:11202554-11202576 CCCGTTCCACCCCCAACCACAAG 0: 1
1: 0
2: 3
3: 31
4: 1566
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79
1162525156_1162525168 1 Left 1162525156 19:11202547-11202569 CCCATGCCCCGTTCCACCCCCAA 0: 1
1: 1
2: 0
3: 38
4: 233
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79
1162525153_1162525168 12 Left 1162525153 19:11202536-11202558 CCCAAGGCAGCCCCATGCCCCGT 0: 1
1: 0
2: 0
3: 18
4: 238
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79
1162525158_1162525168 -5 Left 1162525158 19:11202553-11202575 CCCCGTTCCACCCCCAACCACAA 0: 1
1: 0
2: 5
3: 43
4: 306
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79
1162525149_1162525168 24 Left 1162525149 19:11202524-11202546 CCCTACTCCAGCCCCAAGGCAGC 0: 1
1: 0
2: 0
3: 26
4: 466
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79
1162525160_1162525168 -7 Left 1162525160 19:11202555-11202577 CCGTTCCACCCCCAACCACAAGG 0: 1
1: 0
2: 1
3: 49
4: 375
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79
1162525148_1162525168 25 Left 1162525148 19:11202523-11202545 CCCCTACTCCAGCCCCAAGGCAG 0: 1
1: 0
2: 3
3: 39
4: 415
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79
1162525152_1162525168 13 Left 1162525152 19:11202535-11202557 CCCCAAGGCAGCCCCATGCCCCG 0: 1
1: 0
2: 1
3: 30
4: 317
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79
1162525157_1162525168 0 Left 1162525157 19:11202548-11202570 CCATGCCCCGTTCCACCCCCAAC 0: 1
1: 0
2: 2
3: 54
4: 449
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79
1162525154_1162525168 11 Left 1162525154 19:11202537-11202559 CCAAGGCAGCCCCATGCCCCGTT 0: 1
1: 0
2: 0
3: 17
4: 183
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79
1162525150_1162525168 23 Left 1162525150 19:11202525-11202547 CCTACTCCAGCCCCAAGGCAGCC 0: 1
1: 0
2: 2
3: 56
4: 632
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79
1162525151_1162525168 17 Left 1162525151 19:11202531-11202553 CCAGCCCCAAGGCAGCCCCATGC 0: 1
1: 0
2: 3
3: 31
4: 390
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79
1162525155_1162525168 2 Left 1162525155 19:11202546-11202568 CCCCATGCCCCGTTCCACCCCCA 0: 1
1: 0
2: 2
3: 37
4: 445
Right 1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162525168 Original CRISPR CACAAGGACGTGCCTCCAGC CGG Exonic
900130538 1:1085377-1085399 CACAAGGCCGTCTCTCCAGTGGG + Intronic
900636478 1:3668624-3668646 CACCAGTACATGCTTCCAGCAGG - Intronic
900908098 1:5575019-5575041 CACATGCAAGTGCCCCCAGCTGG - Intergenic
901090439 1:6637369-6637391 CACAAGGAGGTGCCTGGAGGAGG - Intronic
901317311 1:8317959-8317981 CACCGGGACGGGCCTCCCGCGGG + Intronic
903070889 1:20726601-20726623 CAGCAGGACGAGCCTGCAGCAGG + Intronic
903669678 1:25028091-25028113 CCCATGGATGTGCCTCCAGGGGG + Intergenic
905017101 1:34785417-34785439 CACAAGGACAAGCCTCGAGGGGG + Exonic
905877194 1:41439815-41439837 CACAAGGTCTTGCTTCCAGCTGG - Intergenic
918727342 1:187942322-187942344 CACAAGGTCCTGCCTCCTGCTGG - Intergenic
1067793652 10:49305654-49305676 CCCATGGACCTGCCACCAGCGGG + Intronic
1067937675 10:50624846-50624868 CCCGAGGCCGTGCCTCCCGCGGG + Intronic
1069627587 10:69877742-69877764 CACACGTACGTGCCTCAAGAGGG + Intronic
1071928180 10:90435599-90435621 AACAAGGTGGTGCCTCCAGAAGG + Intergenic
1074394997 10:113090407-113090429 CAGAAAGCAGTGCCTCCAGCAGG + Intronic
1075773861 10:124966192-124966214 GACAGGGATGTGCTTCCAGCTGG - Intronic
1077230764 11:1457328-1457350 CCCAGGGTCATGCCTCCAGCAGG + Intronic
1078338003 11:10478792-10478814 CACAGGGTCGTGCCTCCCTCTGG + Intronic
1085159978 11:74331600-74331622 CTCAAGGACTTGCCTCCACTGGG + Exonic
1089296755 11:117473858-117473880 CACAAGCAAGTGCCCACAGCAGG - Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1102694724 12:114789866-114789888 CTCAAGGAGCTGCCTCCAGTGGG - Intergenic
1103573081 12:121857679-121857701 GACAAGGGCAGGCCTCCAGCAGG - Intronic
1103792908 12:123484199-123484221 CCCGAGGACGTCCCCCCAGCCGG - Exonic
1111929892 13:94502387-94502409 GACACGGACCTTCCTCCAGCAGG + Intergenic
1112381800 13:98897910-98897932 CCCAACCACATGCCTCCAGCTGG - Intronic
1121323105 14:93004189-93004211 CACCAGGGTGTGCCTCCTGCTGG - Intronic
1123161904 14:106286881-106286903 CACCAGGAAGCGCCTCCAGGTGG + Intergenic
1128557077 15:68639164-68639186 CACAAGGAGGTGCCTCCTTCAGG - Intronic
1130550456 15:84887364-84887386 CACAAGGACTTGCCTCTTACAGG + Intronic
1139613033 16:68072582-68072604 GTCAAGGACTTGCCACCAGCCGG + Intronic
1145976736 17:28988267-28988289 CACTAGGAAGTGCCCCCAGGAGG - Intronic
1148017156 17:44530016-44530038 CATAAGGAAGTGCAACCAGCAGG + Intergenic
1150010048 17:61494904-61494926 GAAAAGAATGTGCCTCCAGCAGG + Intergenic
1151527504 17:74681071-74681093 CCCAAGGAGCTGCGTCCAGCAGG + Intronic
1152660585 17:81540139-81540161 AACAACTAGGTGCCTCCAGCCGG - Exonic
1156505624 18:37589435-37589457 CACAGAGACGAGCCTGCAGCTGG + Intergenic
1162323694 19:9986032-9986054 CCCAAGGACATGCCCCTAGCAGG - Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1164511794 19:28903682-28903704 GGCAAGTACCTGCCTCCAGCTGG - Intergenic
1165483873 19:36083570-36083592 CACCAGGACCCTCCTCCAGCTGG - Intronic
1166735112 19:45079398-45079420 GACCAGAACGTCCCTCCAGCCGG - Intronic
928332524 2:30368585-30368607 CACAAGCCCAGGCCTCCAGCAGG - Intergenic
930442047 2:51421039-51421061 CACAGGCACATGCCACCAGCAGG - Intergenic
933199178 2:79429022-79429044 AACAATGAGGTGCCTCCAGCTGG - Intronic
936093699 2:109516420-109516442 CAGAAGCACGGGCCTACAGCTGG + Intergenic
944669109 2:201980692-201980714 CACAACCACGTGTCTCCTGCTGG - Intergenic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
1179628812 21:42664322-42664344 CACAGGGACGTGCCACCTGCAGG + Intronic
1182715255 22:32352942-32352964 CACAAGCTCCAGCCTCCAGCAGG + Intergenic
1184859021 22:47162850-47162872 CACGAGGAAGTGCCTACACCGGG - Intronic
950447559 3:13047127-13047149 CCCAAGGACCAGCCTGCAGCCGG - Intronic
950787801 3:15450410-15450432 CCCAAGGGTGTCCCTCCAGCTGG + Exonic
953470798 3:43164217-43164239 CACAAGATCGTGTCTCCTGCAGG - Intergenic
954198903 3:49012716-49012738 GACCAGGAGCTGCCTCCAGCAGG - Exonic
956174075 3:66456930-66456952 CACCAGGGAGTGCCTCCAGCTGG - Intronic
956728374 3:72175485-72175507 CACAAGGACAAGCCTCAAGTTGG + Intergenic
957090386 3:75724098-75724120 AACAAGGAAGGGCCTCCAACCGG + Intronic
960958360 3:123051098-123051120 CACAGCGTCTTGCCTCCAGCTGG + Intergenic
966771728 3:183510321-183510343 CACCAGGACCTGCCTTCAGAAGG - Intronic
971324596 4:25633700-25633722 CACAGGCACGTGTCTTCAGCTGG - Intergenic
972661596 4:41121803-41121825 CACAAAGACGTGGCTGCATCCGG - Intronic
979487230 4:121283421-121283443 CACAAGGACTAGCCTAAAGCTGG - Intergenic
985576220 5:674645-674667 CACCAGGACCTGCCAGCAGCTGG + Intronic
985795823 5:1961605-1961627 GACCAGGACGTGGCTCCACCTGG - Intergenic
998822966 5:146073415-146073437 GACACGGACATGCTTCCAGCTGG + Intronic
999309888 5:150545159-150545181 AACAAGGACTTGCCTCCAGTGGG - Intronic
1000980513 5:167811971-167811993 CACAAGGACGTCATTTCAGCTGG + Intronic
1003740765 6:8935945-8935967 CACAAGAACTTTCCTCCAACAGG + Intergenic
1004005377 6:11633095-11633117 CACAAGGACTAGCCTACACCTGG - Intergenic
1004198160 6:13524360-13524382 CACAAGGCCCTGCCGCTAGCTGG + Intergenic
1020204552 7:6104932-6104954 GACAATGACGTGCCTCCATCCGG - Exonic
1031923204 7:127615948-127615970 CAGAAGGATGAGACTCCAGCTGG + Intergenic
1033283795 7:140023931-140023953 CCCAAGGAAGTGCATCCACCTGG - Exonic
1035528853 8:335724-335746 CAAAAGGACGTGGCCACAGCAGG + Intergenic
1038733127 8:30145323-30145345 CTTAAGAACCTGCCTCCAGCTGG - Intronic
1047248654 8:123165637-123165659 CACCCTGACGTCCCTCCAGCTGG - Intergenic
1047304250 8:123640234-123640256 CAGAAGGACATGGCCCCAGCAGG - Intergenic
1048840208 8:138558950-138558972 AACAAGGCCATGCCTCCAACAGG + Intergenic
1048910751 8:139132509-139132531 CACAGGTAAGTGCCTGCAGCAGG - Intergenic
1049615191 8:143572852-143572874 CACACGGACGTGCCTACAATGGG + Exonic
1050423061 9:5487129-5487151 CAAAAGGGCGTACCCCCAGCAGG + Intergenic
1050438042 9:5629618-5629640 CTGGAGGACGTGCCTGCAGCCGG - Intronic
1053503769 9:38622368-38622390 CACAAGGAGCTGCATCCAGCAGG - Intergenic
1060187670 9:121573888-121573910 CACAGGGAGGGGCCTCCAGGTGG - Intronic
1187442553 X:19333122-19333144 CACCAGAAAGAGCCTCCAGCTGG + Intergenic
1188003279 X:25001576-25001598 CAGAATGAGGTCCCTCCAGCTGG + Intergenic
1198933025 X:141880123-141880145 CACAGGGAGCTGCCTCCAGTTGG + Intronic
1198962256 X:142195252-142195274 GACAAGGACATGCCTGCTGCTGG - Intergenic