ID: 1162526148

View in Genome Browser
Species Human (GRCh38)
Location 19:11207902-11207924
Sequence GGACCTCCATTCTGTCACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 440}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162526148_1162526150 29 Left 1162526148 19:11207902-11207924 CCTAGGTGACAGAATGGAGGTCC 0: 1
1: 0
2: 0
3: 16
4: 440
Right 1162526150 19:11207954-11207976 ATATATAATAATTTAAAAATTGG 0: 1
1: 3
2: 26
3: 395
4: 2547

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162526148 Original CRISPR GGACCTCCATTCTGTCACCT AGG (reversed) Intronic
900276302 1:1831137-1831159 GGAGCCTCATTCTGTCACCCAGG - Intronic
901697036 1:11015642-11015664 GGAGTCTCATTCTGTCACCTAGG - Intronic
902436685 1:16402580-16402602 GGACTTTCGTTCTGTCACCAAGG + Intronic
902548535 1:17205601-17205623 GGCCCTGCATTCTGACACCTAGG + Intronic
902589451 1:17463123-17463145 GGAGTTTCATTCTGTCACCCAGG + Intergenic
902782595 1:18714179-18714201 GGAGCCTCATTCTGTCACCCAGG - Intronic
903484876 1:23682175-23682197 GGAGTTTCACTCTGTCACCTAGG - Intergenic
904728777 1:32571927-32571949 GGAATCTCATTCTGTCACCTGGG + Intronic
905026556 1:34854280-34854302 GGACTCTCATTCTGTCACCCGGG - Exonic
905047718 1:35021164-35021186 GGAGTTTCATTCTGTCACCCAGG + Intronic
906250734 1:44308933-44308955 GGAGCCCCATCCTGACACCTGGG + Intronic
906424058 1:45694909-45694931 GGAGTTTCATTCTGTCGCCTAGG + Intronic
906462627 1:46047804-46047826 GGACTCTCACTCTGTCACCTAGG + Intronic
907151771 1:52295429-52295451 TGTCACCCATTCTGTCACCTGGG + Intronic
908221904 1:62015556-62015578 GGACTCTCACTCTGTCACCTAGG + Intronic
908760466 1:67507075-67507097 GGAGTTTCATTCTGTCACCCAGG + Intergenic
909630887 1:77768934-77768956 GGAGTTTCCTTCTGTCACCTAGG - Intergenic
909859425 1:80586586-80586608 GGAGTCTCATTCTGTCACCTGGG + Intergenic
910856709 1:91703017-91703039 GGAGTTTCATTCTGTCACCCAGG - Intronic
912056862 1:105611449-105611471 GGAGTCTCATTCTGTCACCTAGG - Intergenic
912792050 1:112662133-112662155 GTATCTCAACTCTGTCACCTAGG + Intronic
914805395 1:150987700-150987722 GGACTCTCATTCTGTCACCCAGG - Intronic
915198488 1:154208435-154208457 GGGCCTTTATTCTGTCACCCAGG - Intronic
916541769 1:165763642-165763664 GGGTCTCAACTCTGTCACCTAGG + Intronic
917136406 1:171792162-171792184 GGACCTTCATTCGGTCACTCTGG - Exonic
917415400 1:174804028-174804050 GGAATCTCATTCTGTCACCTAGG - Intronic
917770401 1:178271042-178271064 AAACCTCCATTCTTTTACCTGGG + Intronic
917800372 1:178564018-178564040 GGAGTTTCATTCTGTCACCCAGG - Intergenic
917841463 1:178983305-178983327 GGAGTCCCACTCTGTCACCTAGG - Intergenic
917870612 1:179238662-179238684 GGTGTTTCATTCTGTCACCTAGG + Intergenic
918174636 1:182032165-182032187 GGAGTTTCATTCTGTCACCTAGG - Intergenic
918466855 1:184829490-184829512 GGAGTTTCATACTGTCACCTGGG + Intronic
920008943 1:202853744-202853766 GGAGCTTCACTCTGTCACCCAGG - Intergenic
920522594 1:206639491-206639513 GGACTCTCACTCTGTCACCTAGG + Intronic
921231572 1:213078425-213078447 GGAGTCTCATTCTGTCACCTAGG + Intronic
921345594 1:214181341-214181363 TGGGTTCCATTCTGTCACCTGGG - Intergenic
921947818 1:220898795-220898817 AGACCTCCATTCTGTTCCTTTGG + Intergenic
922239512 1:223746502-223746524 GGAGCCTCATTCTGTCACCCAGG + Intronic
922410549 1:225370254-225370276 GGAGTTTCATTCTGTCACCCAGG - Intronic
922482285 1:225947338-225947360 TGACCTACATACTGTTACCTTGG - Intergenic
922938806 1:229443051-229443073 GGGTCTCCACTCTGTCACCCAGG + Intronic
923822312 1:237458401-237458423 GGAGTCTCATTCTGTCACCTAGG - Intronic
924453058 1:244197019-244197041 GCACCCCCATTCTGTTCCCTGGG + Intergenic
1063370173 10:5516084-5516106 AGACCTCCATGCTGGCCCCTGGG - Intergenic
1064996887 10:21303736-21303758 GGAGCCTCACTCTGTCACCTAGG - Intergenic
1065033601 10:21613878-21613900 GGAGCCTCATTCTGTCACCCAGG - Intronic
1065143093 10:22738543-22738565 GGAGCTTCACTCTGTCACCCAGG - Intergenic
1065422274 10:25558532-25558554 GCACCTCCCTGCTGTCGCCTGGG + Intronic
1065853819 10:29813789-29813811 GGAGCCTCACTCTGTCACCTAGG - Intergenic
1067222127 10:44351956-44351978 GGAACCCCATGCTCTCACCTGGG - Intergenic
1067526317 10:47040869-47040891 GAACCTGCATGCTGTCACTTAGG + Intergenic
1067857947 10:49813164-49813186 GGAGTTCCACTCTGTCACCCAGG - Intergenic
1068869528 10:61928324-61928346 GGGTCTCAACTCTGTCACCTAGG + Intronic
1069574872 10:69519392-69519414 GGGTCTCCCCTCTGTCACCTAGG - Intergenic
1069670298 10:70196796-70196818 GGAGTTTCATTCTGTCACCCAGG - Intergenic
1070561594 10:77571596-77571618 GGACCACCTGTCTGTCCCCTAGG + Intronic
1071106717 10:82106529-82106551 GGAGTCTCATTCTGTCACCTAGG + Intronic
1071214607 10:83385409-83385431 GGTTCTCCATTCTGTTACATTGG + Intergenic
1071447558 10:85762871-85762893 GGGCCTCCTGTCTGTCTCCTAGG - Intronic
1072076042 10:91974826-91974848 GGAGTTTCACTCTGTCACCTAGG - Intronic
1072530300 10:96312520-96312542 GGTTCTACATTCTGCCACCTTGG - Intronic
1073738537 10:106380306-106380328 GGAGCTTCTCTCTGTCACCTGGG + Intergenic
1075138958 10:119814359-119814381 GGAGCCTCACTCTGTCACCTAGG - Intronic
1076366393 10:129923449-129923471 GGCTCTCCATTCTGTCCCATTGG - Intronic
1077381247 11:2239521-2239543 GGAGTTTCATTCTGTCACCCAGG - Intergenic
1077459809 11:2703339-2703361 GGACCTGCCCTCTGTCACGTGGG - Intronic
1077622832 11:3743042-3743064 GGACTCCCACTCTGTCACCCAGG + Intronic
1077628217 11:3792151-3792173 GGAGTTTCACTCTGTCACCTGGG - Intronic
1077759768 11:5081072-5081094 GGTCCTCTATTCTGTCCCATTGG - Intergenic
1077768365 11:5187143-5187165 GGTCCTCCAATCAGTCATCTAGG + Intergenic
1078030582 11:7747128-7747150 GGAGTTTCATTCTGTCACCCAGG + Intergenic
1078198100 11:9153317-9153339 GGAGCCTCATTCTGTCACCCAGG - Intronic
1079082206 11:17421555-17421577 TGTCCTCCAGTCTGTCTCCTGGG - Intronic
1079787996 11:24700085-24700107 GGACTTCCACTCTGTAGCCTAGG + Intronic
1081500520 11:43662222-43662244 GGAGTTTCAATCTGTCACCTAGG + Intronic
1081592375 11:44433492-44433514 GCACCTCAATTCTGTCATCTTGG + Intergenic
1082836845 11:57657418-57657440 GGGCCTCCCTTCTGTTTCCTGGG + Exonic
1083258553 11:61510789-61510811 GTACCTCCACTCCGTCACCAGGG + Exonic
1083978935 11:66148898-66148920 GGAGCCTCACTCTGTCACCTGGG - Intronic
1084619561 11:70260242-70260264 GGAGTTTCACTCTGTCACCTAGG + Intergenic
1085108492 11:73866706-73866728 GCAGCTGGATTCTGTCACCTTGG + Intergenic
1085977663 11:81679287-81679309 GGAGTGTCATTCTGTCACCTAGG + Intergenic
1087153328 11:94878001-94878023 TGGCCTCCATTCTGACATCTGGG + Intergenic
1088158042 11:106833038-106833060 AGATCTCCATTCTCTCTCCTAGG + Intronic
1089023439 11:115242207-115242229 GGGCCTGCATTCTCACACCTGGG - Intronic
1091379260 12:45538-45560 AGAGCTCCTTTCTGTCTCCTAGG - Intergenic
1091386190 12:96834-96856 GGAGGTCCATTCAGTCAACTGGG + Intronic
1093864114 12:24204352-24204374 GGACTTCCACTCTGTCGCCCAGG + Intergenic
1094475628 12:30838530-30838552 GGCTCTCCACTCTGTCACCCAGG - Intergenic
1095902992 12:47347918-47347940 GGAGTTTCACTCTGTCACCTAGG + Intergenic
1097220613 12:57448541-57448563 GGAGTCTCATTCTGTCACCTAGG - Intronic
1099851415 12:88101631-88101653 GGAGTTTCATTCTGTCACCCAGG - Intronic
1099989269 12:89707222-89707244 GGCCCTCCATTCACTCACGTGGG + Intronic
1101361307 12:104030164-104030186 GGCCCTCTATTCTGTCCCATTGG - Intronic
1103189230 12:118986627-118986649 GGAACTTCATTCTGACACCAGGG - Intronic
1103232353 12:119342186-119342208 GGACAGCCATTTTGTGACCTGGG - Intronic
1106128505 13:26920703-26920725 GGACACCCCTTCTGTCACCATGG - Intergenic
1106323968 13:28670082-28670104 GGAGTCTCATTCTGTCACCTAGG - Intronic
1106849677 13:33776058-33776080 GGACCTCTTTTCTGTCTCTTGGG + Intergenic
1106898309 13:34329189-34329211 GGAGTTTCACTCTGTCACCTAGG + Intergenic
1107955605 13:45508041-45508063 GGACCTAGGCTCTGTCACCTAGG - Intronic
1108546478 13:51500354-51500376 GGAGAGCCATTCTGTCACCCAGG - Intergenic
1109861206 13:68201405-68201427 GGAGCCCCACTCTGTCACCCAGG - Intergenic
1111561517 13:89955143-89955165 GGACTTCCATTTTGTCCCATTGG + Intergenic
1112343276 13:98569900-98569922 GGAGTTTCACTCTGTCACCTAGG + Intronic
1112404869 13:99110284-99110306 GGATCTCAGTGCTGTCACCTAGG - Intergenic
1112540865 13:100311205-100311227 GGACTCTCACTCTGTCACCTAGG - Intronic
1112674102 13:101678523-101678545 GGAGTCTCATTCTGTCACCTAGG + Intronic
1113248230 13:108422453-108422475 GGAGTCCCATTCTGTCACCCAGG - Intergenic
1115113333 14:29850908-29850930 GGTCCTCTATTCTGTCCCATTGG - Intronic
1116780657 14:49234127-49234149 GGTCCTCCATTCTGTTTCATGGG + Intergenic
1117178648 14:53170483-53170505 TCACCTCCATTCTGACTCCTTGG - Intergenic
1118823624 14:69361397-69361419 GGCCCTCCATCCTGCCAGCTGGG - Intergenic
1121946212 14:98124997-98125019 AGATCTTCACTCTGTCACCTAGG + Intergenic
1122385168 14:101339969-101339991 GGAGGTCCATTCAGTCAGCTGGG + Intergenic
1122446390 14:101772768-101772790 GGAGTTGCATTCTGTCACCCAGG - Intronic
1122629478 14:103100759-103100781 GGGTCTCCACTCTGTCACCCAGG + Intronic
1122758323 14:104000301-104000323 GGGCTCTCATTCTGTCACCTAGG - Intronic
1202839007 14_GL000009v2_random:103027-103049 GGACTCTCATTCTGTCACCCAGG + Intergenic
1202908374 14_GL000194v1_random:93119-93141 GGACTCTCATTCTGTCACCCAGG + Intergenic
1124471224 15:29987719-29987741 GGAGTCCCACTCTGTCACCTAGG - Intergenic
1125925087 15:43556513-43556535 GGAGTTTCATTCTGTCACCCAGG - Intronic
1127892555 15:63268439-63268461 GGAGCCCCACTCTGTCACCCAGG + Intergenic
1127947122 15:63766551-63766573 GGAGTCTCATTCTGTCACCTAGG - Intronic
1128000544 15:64187213-64187235 GGAGCCTCATTCTGTCACCCAGG + Intronic
1128656636 15:69467545-69467567 GGACCTCCTTTCTGTGGACTGGG + Intergenic
1129369708 15:75083508-75083530 GGAGTTTCACTCTGTCACCTGGG + Intronic
1130604672 15:85305638-85305660 CTACCTCCAATCTGTCATCTTGG - Intergenic
1131079976 15:89526729-89526751 GTGCCTCCCTTCTGTAACCTTGG - Intergenic
1131213328 15:90516681-90516703 GGAGCCTCATTCTGTCACCCAGG + Intergenic
1131514657 15:93069133-93069155 GGAGTTTCATTCTGTCACCCAGG + Intronic
1131800350 15:96062382-96062404 GGAGTCCCATTCTGTCACCCAGG - Intergenic
1133268466 16:4599071-4599093 GGGTCTCCGCTCTGTCACCTAGG - Intronic
1133479780 16:6159100-6159122 GGAGTCTCATTCTGTCACCTAGG + Intronic
1133578935 16:7124386-7124408 AGAGTTTCATTCTGTCACCTGGG - Intronic
1134262684 16:12665150-12665172 GGACTTCCATTAGGTAACCTAGG + Intronic
1134293302 16:12921738-12921760 AGAGTTTCATTCTGTCACCTAGG - Intronic
1134791442 16:16992771-16992793 AGAGCCTCATTCTGTCACCTAGG + Intergenic
1135829425 16:25760442-25760464 GGAATTTCACTCTGTCACCTTGG + Intronic
1136389383 16:29952876-29952898 TGACATTCACTCTGTCACCTAGG + Intronic
1136750655 16:32632722-32632744 GGAGTTTCATTCTGTCACCCAGG - Intergenic
1138082533 16:54104336-54104358 GGAGTTTCACTCTGTCACCTAGG + Intronic
1138701314 16:58866480-58866502 GGATCTCAGTTCTGTCACCCAGG - Intergenic
1139043905 16:63033328-63033350 GGGAGTCCATTCTGTCAACTGGG - Intergenic
1140591246 16:76355373-76355395 TGACCTCCATTCTCTCTCCAAGG - Exonic
1141935819 16:87237110-87237132 TGAGCTCCATTGTGCCACCTGGG - Intronic
1141962113 16:87415950-87415972 GGAGTTTCACTCTGTCACCTAGG + Intronic
1142289024 16:89184270-89184292 GGACGTGCTGTCTGTCACCTGGG - Intronic
1203052783 16_KI270728v1_random:891928-891950 GGAGTTTCATTCTGTCACCCAGG - Intergenic
1203074697 16_KI270728v1_random:1113421-1113443 GGACCTCTATTCTGTTCCATTGG - Intergenic
1142710375 17:1719946-1719968 GGAGTCACATTCTGTCACCTAGG - Intronic
1142991183 17:3732048-3732070 GGAGTTTCATTCTGTCACCCAGG - Intronic
1143489625 17:7278320-7278342 GGACCCTCACTCTGTCACCTAGG + Intergenic
1146227741 17:31081660-31081682 GGAGTTTCATTCTGTCACCCAGG + Intergenic
1146684982 17:34835542-34835564 GGACTTCCTTCCTGCCACCTGGG + Intergenic
1147046123 17:37753756-37753778 GGAACCTCATTCTGTCACCCAGG + Intergenic
1147251506 17:39155169-39155191 GGATCTCCATCTTGTCTCCTGGG + Intergenic
1147343165 17:39767510-39767532 GCCTCTCCATTCTGTCAGCTTGG + Intronic
1148265188 17:46220075-46220097 GGAGCCTCACTCTGTCACCTAGG - Intronic
1148373902 17:47124941-47124963 GGACTCTCATTCTGTCACCCAGG + Intronic
1148536072 17:48440152-48440174 TGGCCTGCATTCTGTCACCATGG - Intergenic
1149024967 17:52016885-52016907 GGAGCCTCATTCTATCACCTAGG - Intronic
1149201953 17:54196647-54196669 GGAGCCTTATTCTGTCACCTGGG - Intergenic
1149735040 17:58986222-58986244 GGAGTTTCATTCTGTCACCCAGG + Intronic
1150632600 17:66890497-66890519 GGACCTCTGCTCTGTGACCTTGG + Intergenic
1150725932 17:67651485-67651507 GGAGTCTCATTCTGTCACCTGGG - Intronic
1150900022 17:69263559-69263581 GGTCCTCCATTCTGTTTCATCGG + Intronic
1151793980 17:76329708-76329730 GGAGTTTCATTCTGTCACCTAGG - Intronic
1152035195 17:77868017-77868039 GGACCTCAGTTCATTCACCTGGG - Intergenic
1152232507 17:79121157-79121179 GGCCCTCCCTTCTGTCCCCAGGG + Intronic
1154213624 18:12399817-12399839 GGAGCCTCATTCTGTCACCCAGG - Intergenic
1154272479 18:12932112-12932134 GGGCCTCCAGTCTGGCACCTGGG + Intergenic
1155963199 18:32012940-32012962 GGAATCTCATTCTGTCACCTAGG + Intergenic
1155983622 18:32206635-32206657 GGAGTCTCATTCTGTCACCTAGG + Intronic
1156408039 18:36801260-36801282 GGACTTCCAGTCTGTCTCCCTGG - Intronic
1156408047 18:36801355-36801377 GGGTCTCCACTCTATCACCTGGG + Intronic
1158722329 18:59936479-59936501 GGACATCCATTCCGTCTCTTGGG - Intergenic
1159179068 18:64878094-64878116 GGAGTTTCACTCTGTCACCTAGG + Intergenic
1161207705 19:3050333-3050355 GGAGTTTCACTCTGTCACCTAGG + Intergenic
1161336861 19:3719155-3719177 GGACACTCATTCTGTCACCCAGG - Intronic
1161557321 19:4951238-4951260 GGACTCTCATTCTGTCACCCAGG - Intronic
1162202226 19:9028979-9029001 GGAGCTCCGCTCTGTCACCCAGG + Intergenic
1162334725 19:10053246-10053268 GGAGTTTCATTCTGTCACCCAGG + Intergenic
1162526148 19:11207902-11207924 GGACCTCCATTCTGTCACCTAGG - Intronic
1163139971 19:15340938-15340960 GGAGTTTCACTCTGTCACCTAGG + Intergenic
1163570785 19:18081119-18081141 GGAGTTTCATTCTGTCACCCAGG + Intronic
1163835679 19:19572098-19572120 GGAATCTCATTCTGTCACCTAGG + Intronic
1163965674 19:20745162-20745184 GGAGTCCCACTCTGTCACCTAGG + Intronic
1164514121 19:28919906-28919928 GGAGTTTCACTCTGTCACCTGGG + Intergenic
1164967715 19:32500022-32500044 GGAATTCCACTCTGTCACCCAGG + Intergenic
1165837258 19:38766439-38766461 GGAGTTCCACTCTGTCACCCAGG - Intronic
1166164271 19:40976122-40976144 GGAACCTCATTCTGTCACCCAGG - Intergenic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1166880981 19:45929851-45929873 GGAATTCCACTCTGTCACCCAGG + Intergenic
1167024496 19:46905399-46905421 GGAGTCTCATTCTGTCACCTAGG + Intergenic
1167407505 19:49323036-49323058 GGCCCTCTATTCTGTTCCCTTGG - Intronic
1167610209 19:50503844-50503866 GGAGTTTCACTCTGTCACCTAGG + Intergenic
1167879011 19:52439729-52439751 GGAGTTTCACTCTGTCACCTAGG - Intronic
1167926662 19:52826678-52826700 GGAGCCTCATTCTGTCACCCAGG - Intronic
1167967839 19:53162213-53162235 GGAGTTTCATTCTGTCACCCAGG - Intronic
1168065481 19:53917354-53917376 TCAGCTCCATTCTGTCCCCTGGG + Intronic
1168231707 19:55036671-55036693 GGGCCTCACTTCTGTCACCCAGG - Intronic
1168246771 19:55116539-55116561 TGACCTGCATTCTCTCCCCTGGG - Intronic
1168692163 19:58383763-58383785 GGAGTCCCATTCTGTCACCCAGG + Intergenic
1202651853 1_KI270707v1_random:12487-12509 GGACTCTCATTCTGTCACCCAGG + Intergenic
1202660279 1_KI270708v1_random:63236-63258 GGACTTCCGTTCTGTCACCCAGG - Intergenic
925579543 2:5396739-5396761 GCACTTCCATTCTGTTGCCTAGG - Intergenic
925896843 2:8478795-8478817 GGACTTACATTCTCACACCTTGG - Intergenic
927283739 2:21335290-21335312 GGAGCCTCATTCTGTCACCCAGG + Intergenic
927962954 2:27251893-27251915 CCACCCCCATCCTGTCACCTGGG + Intergenic
929192691 2:39154207-39154229 GGAGTTTCATTCTGTCACCCAGG - Intergenic
930584449 2:53252992-53253014 GGGTCTCAATTCTGTCACCCAGG + Intergenic
930584666 2:53254944-53254966 GGGTCTGAATTCTGTCACCTGGG - Intergenic
932142686 2:69293727-69293749 GGTCTCTCATTCTGTCACCTAGG + Intergenic
932315038 2:70774683-70774705 GGAGCTTCACTCTGTCACCCAGG - Intergenic
932571514 2:72940843-72940865 GGACCTCCCTTCTCTCACTCAGG - Intergenic
933078386 2:77957422-77957444 GGAGTTCCACTCTGTCACCCAGG + Intergenic
934970929 2:98763447-98763469 GGACCTGCTTCCTGTCACATAGG - Intergenic
935835063 2:107041812-107041834 GGATCTCCATTCTGTTCCTTTGG - Intergenic
935884331 2:107599274-107599296 GGAATTTCACTCTGTCACCTAGG + Intergenic
936564444 2:113572048-113572070 AGAACTCCTTTCTGTCTCCTAGG + Intergenic
938039861 2:128066761-128066783 GGAGCTTCACTCTGTCACCCAGG - Intergenic
938177715 2:129151543-129151565 GGAGTTTCATTCTGTCACCCAGG + Intergenic
938623456 2:133082532-133082554 GGACCTCCTTCCTGTTTCCTTGG + Intronic
938869512 2:135460283-135460305 GGAGTTTCATTCTGTCATCTAGG + Intronic
939831855 2:147081586-147081608 GGAGTCTCATTCTGTCACCTAGG - Intergenic
941105370 2:161345915-161345937 GGGCCTCACTTCTGTCACCCAGG + Intronic
943241277 2:185387191-185387213 GGAGTCCCATTCTGTCACCCAGG - Intergenic
946228468 2:218277348-218277370 GGCCCTCCATGCCCTCACCTTGG + Exonic
946265774 2:218539982-218540004 GGAGTCCCACTCTGTCACCTAGG - Intronic
946618228 2:221532684-221532706 GGGGCTGCATTCTGCCACCTGGG + Intronic
949054507 2:241919879-241919901 GGCCCTCTATTCTGTCCCATTGG - Intergenic
1168862027 20:1052386-1052408 GGAACTCAGCTCTGTCACCTTGG + Intergenic
1169133794 20:3183345-3183367 GGACTTTCGCTCTGTCACCTAGG - Intergenic
1169729587 20:8772431-8772453 GCACCTCCATGCTGTGTCCTTGG + Intronic
1170262071 20:14420716-14420738 GGTCTCTCATTCTGTCACCTAGG + Intronic
1170364381 20:15583667-15583689 GGACTTTCACTCTGTCACCCAGG + Intronic
1172570323 20:35965206-35965228 GGAGTCTCATTCTGTCACCTAGG + Intronic
1172582038 20:36056038-36056060 GGAGTCCCACTCTGTCACCTAGG + Intergenic
1173305497 20:41844146-41844168 GGTCCTCCATTCTGGGTCCTAGG + Intergenic
1173769273 20:45644366-45644388 GGGCCTCAGTTCTGTCACCCAGG + Intergenic
1174014772 20:47478910-47478932 GGACTTTCACTCTGTCACCCAGG - Intergenic
1174214474 20:48905574-48905596 GGAATCTCATTCTGTCACCTGGG + Intergenic
1174295634 20:49543275-49543297 CCACCACCATTCTCTCACCTTGG + Intronic
1175938331 20:62525429-62525451 GGCCCTGCACCCTGTCACCTGGG + Intergenic
1176003586 20:62846735-62846757 GGGCCCTCATTCTGTCACCCAGG - Intronic
1176071479 20:63228976-63228998 GGGGCTCCATTCAGTCAACTAGG + Intergenic
1176600296 21:8787165-8787187 GGACTCTCATTCTGTCACCCAGG - Intergenic
1177043568 21:16142867-16142889 TGCCCTCTATTCTGTCACATTGG + Intergenic
1177080824 21:16636559-16636581 GGACCAGCATATTGTCACCTGGG + Intergenic
1177305475 21:19309929-19309951 GGAGTTCCACTCTGTCACCCAGG + Intergenic
1178515945 21:33247275-33247297 GGAGTTTCACTCTGTCACCTAGG + Intronic
1178966828 21:37128074-37128096 TGATTTCCATTCTGTGACCTTGG - Intronic
1180379412 22:12125515-12125537 GGACTCTCATTCTGTCACCCAGG - Intergenic
1180418076 22:12787367-12787389 GGACTCTCATTCTGTCACCCAGG + Intergenic
1181947263 22:26528043-26528065 GCACCCCCAGTCTGTCACCATGG + Intronic
1182256133 22:29039926-29039948 GGGCTTTCACTCTGTCACCTGGG - Intronic
1182809056 22:33100322-33100344 GGAGTCCCATTCTATCACCTAGG - Intergenic
1182858663 22:33540249-33540271 GAACCTCCATTCTGTGACTGGGG + Intronic
1183127016 22:35792288-35792310 GGAGTTTCATTCTGTCACCCAGG - Intronic
1183791497 22:40074204-40074226 CGACCTTCACTCTGTCACCGAGG - Intronic
1183821648 22:40351018-40351040 GGGTCTCGCTTCTGTCACCTAGG + Intronic
1184354684 22:43971140-43971162 GGAGCCTCATTCTGTCACCCAGG - Intronic
1185091028 22:48773473-48773495 GGAGCCTCATTCTGTCACCCAGG + Intronic
1185220490 22:49627096-49627118 GGAACTCCCTCCTGTCTCCTTGG - Intronic
949737641 3:7192455-7192477 TGACCTCGACTCTGTCACTTAGG + Intronic
950066803 3:10118511-10118533 AGATTTTCATTCTGTCACCTAGG + Intronic
950234527 3:11307258-11307280 GGACATCCAGGCTCTCACCTGGG + Intronic
952279034 3:31905373-31905395 GGACTCCCGTTCTGTCACCCAGG + Intronic
952448811 3:33411045-33411067 GGAGTTTCATTCTGTCACCCAGG - Intronic
954168235 3:48778543-48778565 GGAGTCCCATTCTGTCACCCAGG + Intronic
954354149 3:50070880-50070902 GAACCTCCATTCTCACACATAGG + Intronic
954462511 3:50635441-50635463 GGAGTTTCATTCTGTCATCTAGG + Intronic
955801737 3:62693757-62693779 GGAGTCCCATTCTGTCACCCAGG - Intronic
956802331 3:72771321-72771343 GGAACTGGAATCTGTCACCTAGG - Intronic
957284357 3:78198338-78198360 AGACCGCCACTCTGTCACTTTGG - Intergenic
957978010 3:87472314-87472336 GGAGTTCCACTCTGTCACCCAGG - Intergenic
959179968 3:102966417-102966439 GTACCTCCATAAGGTCACCTGGG + Intergenic
960053506 3:113259866-113259888 GGACCACCATTCTGAAAGCTAGG - Intronic
961626091 3:128264748-128264770 GGATCTCCACACTGTCACCGAGG - Exonic
962119691 3:132548643-132548665 GGATCTCACTCCTGTCACCTAGG + Intergenic
962240791 3:133749133-133749155 GGAGCCTCACTCTGTCACCTAGG - Intronic
962691548 3:137903889-137903911 GGCCCTCCATTCTGTTCCATTGG - Intergenic
963131912 3:141866061-141866083 GGAGTTTCACTCTGTCACCTAGG + Intergenic
964938713 3:162127582-162127604 GGAACTCCATTTTGTGACTTAGG + Intergenic
965267426 3:166561608-166561630 CGACCTCTAATCTGTCATCTTGG + Intergenic
965807642 3:172558635-172558657 GGAGTCCCTTTCTGTCACCTAGG + Intergenic
966024565 3:175260000-175260022 GGAGTTTCATTCTGTCACCCAGG - Intronic
966071176 3:175880561-175880583 GGAGTTTCATTCTGTCACCCAGG + Intergenic
966236729 3:177709698-177709720 GGAGCTTCACTCTGTCACCCAGG + Intergenic
966392800 3:179470568-179470590 GGAGCCTCACTCTGTCACCTAGG + Intergenic
966780616 3:183581034-183581056 GGGTCTCCATTCTGTCCCCACGG + Intergenic
966859852 3:184224697-184224719 GGAGTTTCATTCTGTCACCCAGG + Intronic
967062321 3:185883206-185883228 AGACCTTCACTCTGTCACCCAGG + Intergenic
967359519 3:188613951-188613973 GGAGTCCCATTCTGTCACCCAGG + Intronic
967378904 3:188835591-188835613 GGAGCCTCACTCTGTCACCTAGG - Intronic
968436281 4:591688-591710 GGAGCCCCACTCTGTCACCCAGG - Intergenic
968484242 4:851121-851143 GGGTCTCCACTCTGTCACCCAGG + Intronic
968879371 4:3291370-3291392 GGAGTTTCACTCTGTCACCTAGG + Intergenic
969151194 4:5170090-5170112 GAACCTTCATTCTGTCATGTGGG + Intronic
969465436 4:7353589-7353611 GTACCTCCAATCTGTTCCCTGGG + Intronic
971962150 4:33502952-33502974 GGATCTCTATTCTGTCCCATTGG + Intergenic
972211722 4:36846667-36846689 GGAGTTTCATTCTGTCACCCAGG + Intergenic
972352111 4:38245418-38245440 TGACCTCAATACTATCACCTTGG - Intergenic
972643773 4:40948861-40948883 GGATCTCACTTCTGTCACCCAGG - Intronic
973234211 4:47880398-47880420 GGATCTCAGTTCTGTCACCCAGG - Intronic
973363712 4:49189921-49189943 GGACTCTCATTCTGTCACCCAGG - Intergenic
973397365 4:49606820-49606842 GGACTCTCATTCTGTCACCCAGG + Intergenic
975136923 4:70884200-70884222 GGAGTTTCACTCTGTCACCTAGG + Intergenic
975223782 4:71845673-71845695 GGAGTCCCATTCTGTCACCTAGG + Intergenic
975524881 4:75338055-75338077 GGACCTCCGTTTTCTCATCTTGG - Intergenic
981279693 4:142943816-142943838 AGAGCTTCATTCTGTCACCCAGG + Intergenic
982449721 4:155539428-155539450 GGAGTTTCACTCTGTCACCTGGG - Intergenic
983276834 4:165628207-165628229 GGAGCCTCACTCTGTCACCTAGG + Intergenic
983746834 4:171211452-171211474 GGGTCTCCACTCTGTCACCCAGG - Intergenic
985269804 4:188183259-188183281 GGAGTTTCATTCTGTCACCCAGG - Intergenic
1202761032 4_GL000008v2_random:110997-111019 GGACTCTCATTCTGTCACCCAGG - Intergenic
985526247 5:403610-403632 GGAGTCTCATTCTGTCACCTAGG - Intronic
986938511 5:12920145-12920167 AGACCTCCAGTCTTTCACCAAGG - Intergenic
988315882 5:29627690-29627712 GGAGCGTCAGTCTGTCACCTAGG + Intergenic
988386541 5:30573337-30573359 GGAATCTCATTCTGTCACCTAGG - Intergenic
988426523 5:31071774-31071796 GGAGTCTCATTCTGTCACCTGGG - Intergenic
989151307 5:38302209-38302231 GGACTTTCACTCTGTCACCCAGG - Intronic
990388019 5:55287413-55287435 AGACCTTCACTCTGTCACCCAGG - Intronic
992796868 5:80261165-80261187 GGAGCCTCATTCTGTCGCCTAGG - Intergenic
997607603 5:135186274-135186296 AGGCCTCCATTCCGTCACTTAGG - Intronic
997914345 5:137909568-137909590 GGGTCTCCACTCTGTCACCCAGG + Intronic
999237047 5:150104902-150104924 GGAGTTTCATTCTGTCACCCAGG + Intronic
999539366 5:152554842-152554864 GGAGTCTCATTCTGTCACCTAGG - Intergenic
999999561 5:157124788-157124810 GAGTCTCCATTCTGTCACCAAGG + Intronic
1000355516 5:160390513-160390535 GGAGTTTCATTCTGTCACCCAGG - Intergenic
1002438141 5:179245925-179245947 AGTCCTCTATTCTGTCACTTTGG - Intronic
1003367522 6:5489426-5489448 GGAGTTTCATTCTGTCACCCAGG - Intronic
1003376864 6:5587795-5587817 AGATCTCCATTGTGTGACCTTGG + Intronic
1004371381 6:15055638-15055660 GGAGTCCCATTCTGTCACCCAGG + Intergenic
1005823954 6:29621066-29621088 GGACTTGCAGTCTGGCACCTGGG - Intronic
1005833702 6:29691544-29691566 GGACTCTCATTCTGTCACCCAGG + Intergenic
1006120812 6:31804332-31804354 GGAGTTTCAGTCTGTCACCTAGG - Intronic
1006185551 6:32179759-32179781 ACACCTCCAGTCTCTCACCTGGG - Exonic
1006443992 6:34068752-34068774 GGTCCCCCAGGCTGTCACCTTGG + Intronic
1009588456 6:65636832-65636854 GGATCTCAATTCTGTCACCCAGG + Intronic
1010213137 6:73378520-73378542 GGAGTTTCATTCTGTCACCTTGG - Intronic
1010976293 6:82317921-82317943 GGTTCTCTATTCTGTCACGTTGG - Intergenic
1011270905 6:85579110-85579132 GGAGTCCCATTCTGTCACCCAGG - Intronic
1011419987 6:87161446-87161468 GGGTCTCCACTCTGTCACCCAGG + Intronic
1012462289 6:99477327-99477349 GGAGTTTCACTCTGTCACCTAGG + Intronic
1014442557 6:121490272-121490294 GGAGCTTCACTCTGTCACCCAGG - Intergenic
1014892444 6:126859351-126859373 GGAGTTCCATTCTGTTACCCAGG + Intergenic
1015939183 6:138431675-138431697 GGACTTCCTTTCTGGTACCTTGG + Exonic
1016365918 6:143318292-143318314 GGATCTCCATTCTGTTCCATTGG - Intronic
1016397788 6:143644440-143644462 GGAGTCCCACTCTGTCACCTAGG - Intronic
1016748512 6:147607489-147607511 GGTTCTCCATTCTGTCCCATTGG - Intronic
1018031494 6:159845243-159845265 AGCCCTCCATCCTGTCCCCTAGG + Intergenic
1018042433 6:159936710-159936732 AAACATCCATTCTGTGACCTGGG - Intergenic
1018668867 6:166163407-166163429 GGAGTTTCATTCTGTCACCCAGG + Intronic
1019852552 7:3574140-3574162 GGAGCCTCACTCTGTCACCTGGG + Intronic
1022004493 7:26255091-26255113 GGACTCTCATTCTGTCACCCAGG + Intergenic
1022402477 7:30052612-30052634 GGGTCTCCACTCTGTCACCCAGG - Intronic
1023545062 7:41310188-41310210 GGTCCTCCTTTCTCTCAACTTGG - Intergenic
1024345969 7:48313804-48313826 GGACTTACATTCTGTCTCCAAGG - Intronic
1024419186 7:49142245-49142267 GGAGTTTCACTCTGTCACCTAGG + Intergenic
1024557270 7:50614418-50614440 GGACCCCCAGCCTGTCACCTGGG - Intronic
1025746901 7:64250612-64250634 GGAGCCCCATTCCGTCACCCAGG + Intronic
1025901441 7:65748335-65748357 ATACTTCCATTATGTCACCTTGG + Intergenic
1026600286 7:71772025-71772047 GGAGTCTCATTCTGTCACCTAGG + Intergenic
1026625739 7:71990476-71990498 TTTTCTCCATTCTGTCACCTAGG + Intronic
1026637734 7:72098867-72098889 TGCCTTCCATTCTGTCCCCTGGG + Intronic
1026861919 7:73796385-73796407 GGAGTCTCATTCTGTCACCTAGG + Intergenic
1026935268 7:74251174-74251196 GGGTGTCCACTCTGTCACCTAGG + Intronic
1028156527 7:87435946-87435968 GTACCTTCATTATGTAACCTTGG + Intronic
1028569276 7:92268501-92268523 GGCCCTCCACTCTGTCGCCCAGG + Intronic
1029280584 7:99433013-99433035 GGAGCCTCACTCTGTCACCTAGG - Intronic
1029931445 7:104375310-104375332 GGAATCCCATTCTGTCACCCAGG - Intronic
1030514082 7:110519480-110519502 GGACCTGCCTTCTTTCACCCAGG + Intergenic
1032019997 7:128402126-128402148 GGAGCCTCATTCTGTCACCCAGG + Intronic
1033076013 7:138251336-138251358 GGAGCTTCACTCTGTCACCCAGG + Intergenic
1033124927 7:138699124-138699146 GGAGTTTCACTCTGTCACCTAGG - Intronic
1033561048 7:142530970-142530992 GGATCTCTATTCTGTTACATTGG + Intergenic
1034157133 7:148965030-148965052 GGAGTCTCATTCTGTCACCTAGG - Intergenic
1034255945 7:149724750-149724772 GGACCTGCATCCTGTCAGCCTGG + Exonic
1034411435 7:150944382-150944404 GGACCTCACTTGTATCACCTTGG - Intergenic
1035994617 8:4532175-4532197 GCACCTCCATTCAGTCACTCCGG + Intronic
1036273621 8:7331176-7331198 GGGCCTCACTACTGTCACCTGGG + Intergenic
1036347726 8:7979176-7979198 GGGCCTCACTACTGTCACCTGGG - Intergenic
1036742581 8:11377754-11377776 GGATTTCCATTCTGTCAAATAGG + Intergenic
1037341333 8:17848626-17848648 TGACCTCTGTTCTGTCATCTTGG - Intergenic
1038010898 8:23475099-23475121 GGACCTCCCTTATGGCACCAGGG - Intergenic
1038333666 8:26629461-26629483 CGGCTTCCATTCTGTCATCTGGG - Intronic
1039986952 8:42455622-42455644 GGAGTGTCATTCTGTCACCTAGG - Intronic
1040928048 8:52706382-52706404 GGACTTTCACTCAGTCACCTAGG + Intronic
1040999223 8:53433520-53433542 GGAGCCCCACTCTGTCACCCAGG - Intergenic
1041651521 8:60307802-60307824 GGACCACCATTCTGTTATATGGG - Intergenic
1041832647 8:62173043-62173065 GGATCTCCATTCTGTTCCATTGG + Intergenic
1042133808 8:65615679-65615701 GGAGCCTCATTCTGTCACCCAGG - Intronic
1042145266 8:65721832-65721854 GGAGTTTCATTCTGTCACCCAGG + Intronic
1042169300 8:65976677-65976699 GGAGTCTCATTCTGTCACCTAGG - Intergenic
1042177643 8:66052939-66052961 GGGCCTCACTTCTGTCACCCAGG + Intronic
1043301425 8:78738813-78738835 AGAACTTCATGCTGTCACCTAGG - Intronic
1044103498 8:88171850-88171872 GGAGTCTCATTCTGTCACCTAGG + Intronic
1044371594 8:91418665-91418687 GGACCTCCCTGGTGTAACCTAGG - Intergenic
1044917623 8:97132319-97132341 CCAGCTCCATTGTGTCACCTGGG + Intronic
1045520058 8:102895730-102895752 GGAGCCTCATTCTGTCACCCAGG + Intronic
1045833337 8:106490783-106490805 AGCCTTCTATTCTGTCACCTTGG + Intronic
1046168395 8:110471209-110471231 GGCTCTCCATTCTGTTACATTGG - Intergenic
1046748347 8:117900030-117900052 GGACCTCCGTGTAGTCACCTCGG - Intronic
1048724034 8:137361113-137361135 GGAGCCTCATTCTGTCACCCAGG - Intergenic
1048813520 8:138309883-138309905 GGAGCTCCACTCTGTCACCCAGG + Intronic
1049849390 8:144822697-144822719 GGACCTCCATGTTGTCATATTGG - Intergenic
1051249301 9:15143417-15143439 GGATCTCACTTCTGTCACCCAGG + Intergenic
1051250475 9:15153735-15153757 GGGCTTCCAAGCTGTCACCTGGG - Intergenic
1051254837 9:15202684-15202706 GGAGCCTCATTCTGTCACCCAGG - Intronic
1052929411 9:34044063-34044085 GGAGTTTCATTCTGTCACCCAGG - Intronic
1053564912 9:39239109-39239131 TGACCTCCATTCTCTCTCCAAGG + Exonic
1053830689 9:42076985-42077007 TGACCTCCATTCTCTCTCCAAGG + Exonic
1054132238 9:61379930-61379952 TGACCTCCATTCTCTCTCCAAGG - Intergenic
1054599870 9:67110452-67110474 TGACCTCCATTCTCTCTCCAAGG - Intergenic
1054927865 9:70606123-70606145 GGGCCTCCATTCTGTAACATGGG + Intronic
1056090735 9:83203299-83203321 GGACTCTCATTCTGTCACCCGGG + Intergenic
1056160983 9:83893209-83893231 AGACCTCAACTCTGTCACCCAGG - Intronic
1056359145 9:85836026-85836048 AGACCTCCACTCTGTCACCCAGG + Intergenic
1057001741 9:91516382-91516404 GGAGCTTCACTCTGTCACCCAGG + Intergenic
1057110499 9:92465856-92465878 GGAGTTTCATTCTGTCACCCAGG + Intronic
1057757408 9:97849002-97849024 GTTCCTCCATCCTGTCCCCTGGG + Intergenic
1062036319 9:134384204-134384226 GACCCTCCATACTGTCACCCCGG + Intronic
1062205204 9:135332678-135332700 GAACCTCCATGCTCACACCTAGG + Intergenic
1062251111 9:135594366-135594388 GGAGTCTCATTCTGTCACCTAGG - Intergenic
1062299176 9:135855015-135855037 GGAGCTTCACTCTGTCACCCAGG + Intronic
1203541802 Un_KI270743v1:95882-95904 GGACTCTCATTCTGTCACCCAGG - Intergenic
1186684068 X:11906171-11906193 GGAGTTTCATTCTGTCACCCAGG + Intergenic
1186836799 X:13446564-13446586 GGAGTCTCATTCTGTCACCTAGG + Intergenic
1187457486 X:19455368-19455390 GGGTCTCCATTCTGCCACCCAGG + Intronic
1188112280 X:26206747-26206769 GGTTCTCTCTTCTGTCACCTAGG + Intergenic
1188549489 X:31346974-31346996 GGAGCCTCATTCTGTCACCCAGG - Intronic
1188706702 X:33342509-33342531 GGCCCTCCATTCTGTTGCATTGG + Intergenic
1189111015 X:38288805-38288827 GGAGTTTCATTCTGTCACCTAGG + Intronic
1189864488 X:45311660-45311682 GGAGTCCCACTCTGTCACCTAGG + Intergenic
1190011227 X:46786703-46786725 GGACTTTCACTCTGTCACCCAGG + Intergenic
1190202865 X:48379052-48379074 GGATTTTCACTCTGTCACCTAGG + Intergenic
1190207673 X:48416361-48416383 GGATTTTCACTCTGTCACCTAGG - Intergenic
1191162357 X:57343941-57343963 GGATCTCCATTCTGTTCCATTGG + Intronic
1191824029 X:65344380-65344402 GGATCTCCATTCTGTTCCATTGG - Intergenic
1193310928 X:80009793-80009815 GGCTCTCTATTCTGTCACATTGG + Intergenic
1193421520 X:81289085-81289107 GGTTCTCTATTCTGTCACCTTGG - Intronic
1193490040 X:82137861-82137883 GGTTCTCCATTCTGTTCCCTTGG - Intergenic
1193562126 X:83031430-83031452 GGAGTCCCACTCTGTCACCTAGG + Intergenic
1193782320 X:85718795-85718817 AGACCTCCATTCTGTTCCATTGG - Intergenic
1194985027 X:100480780-100480802 GGAGTTTCACTCTGTCACCTAGG - Intergenic
1195253204 X:103068103-103068125 GGAGTCTCATTCTGTCACCTGGG - Intergenic
1195500284 X:105589709-105589731 GGACCTCTATTCTGTTCCTTTGG + Intronic
1196397696 X:115283706-115283728 GGAATCTCATTCTGTCACCTAGG + Intergenic
1197622018 X:128761510-128761532 GGAGTTTCATTCTGTCGCCTAGG + Intergenic
1197755674 X:129992422-129992444 GGGTCTCAACTCTGTCACCTGGG - Intronic
1197839701 X:130732660-130732682 GGATCTCCATTCTGTGCCATTGG - Intronic
1199610485 X:149608354-149608376 GGAGTTTCATTCTGTCACCCAGG + Intronic
1199999030 X:153047346-153047368 GAACCACCATTCAGTCACCCAGG + Intergenic
1201164235 Y:11193134-11193156 GGACTCTCATTCTGTCACCCAGG + Intergenic
1201329280 Y:12800297-12800319 AGCCTTCCATTCTCTCACCTGGG - Intronic