ID: 1162527387

View in Genome Browser
Species Human (GRCh38)
Location 19:11214368-11214390
Sequence TGCCCCCAAGACGCTCTCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162527384_1162527387 5 Left 1162527384 19:11214340-11214362 CCAGGCTGTACAGCACAACCTTC 0: 1
1: 0
2: 0
3: 17
4: 122
Right 1162527387 19:11214368-11214390 TGCCCCCAAGACGCTCTCCCGGG 0: 1
1: 0
2: 2
3: 19
4: 200
1162527383_1162527387 6 Left 1162527383 19:11214339-11214361 CCCAGGCTGTACAGCACAACCTT 0: 1
1: 0
2: 0
3: 25
4: 160
Right 1162527387 19:11214368-11214390 TGCCCCCAAGACGCTCTCCCGGG 0: 1
1: 0
2: 2
3: 19
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162527387 Original CRISPR TGCCCCCAAGACGCTCTCCC GGG Exonic