ID: 1162527387

View in Genome Browser
Species Human (GRCh38)
Location 19:11214368-11214390
Sequence TGCCCCCAAGACGCTCTCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162527383_1162527387 6 Left 1162527383 19:11214339-11214361 CCCAGGCTGTACAGCACAACCTT 0: 1
1: 0
2: 0
3: 25
4: 160
Right 1162527387 19:11214368-11214390 TGCCCCCAAGACGCTCTCCCGGG 0: 1
1: 0
2: 2
3: 19
4: 200
1162527384_1162527387 5 Left 1162527384 19:11214340-11214362 CCAGGCTGTACAGCACAACCTTC 0: 1
1: 0
2: 0
3: 17
4: 122
Right 1162527387 19:11214368-11214390 TGCCCCCAAGACGCTCTCCCGGG 0: 1
1: 0
2: 2
3: 19
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162527387 Original CRISPR TGCCCCCAAGACGCTCTCCC GGG Exonic
900014174 1:137391-137413 TGCCCCCACGGCGGCCTCCCGGG - Intergenic
900044037 1:492593-492615 TGCCCCCACGGCGGCCTCCCGGG - Intergenic
900065447 1:727499-727521 TGCCCCCACGGCGGCCTCCCGGG - Intergenic
900438525 1:2642424-2642446 TGCACCCTAGCCCCTCTCCCTGG + Intronic
900616396 1:3567527-3567549 TGCCCCCCCCAGGCTCTCCCAGG + Intronic
901091481 1:6644602-6644624 TGCACCCAAAACGCTGTGCCTGG + Exonic
902305222 1:15532536-15532558 TGCCCTCAAGACTCTCTCTTTGG + Intronic
903541219 1:24097372-24097394 AGCCCCCAAGTTGCTCTCTCAGG - Intronic
903818056 1:26079504-26079526 AGCCCCCAAGACTGTCTCCCAGG - Intergenic
904869054 1:33605098-33605120 TGTCACCAGGACCCTCTCCCTGG + Intronic
904922521 1:34020187-34020209 TGGCCCCAAAGCCCTCTCCCTGG - Intronic
905315249 1:37078805-37078827 CGCCCCCATAACACTCTCCCAGG - Intergenic
905492486 1:38355340-38355362 TGCATCCATGAGGCTCTCCCTGG + Intergenic
905580567 1:39080974-39080996 CGCCCCCCAGTCGCTCTCTCAGG - Intergenic
906147308 1:43567682-43567704 CGCCCCCCAGTCGCTCTCCCTGG + Intronic
907126719 1:52056620-52056642 TGCCGCCCAGACCCTGTCCCAGG + Intronic
907433708 1:54430385-54430407 TTCCCACAAGACTCTATCCCGGG - Intergenic
911159678 1:94671994-94672016 TGCTTCCCAGACCCTCTCCCAGG + Intergenic
914195344 1:145445575-145445597 TGTCCCCACCACACTCTCCCTGG + Intergenic
916726243 1:167526493-167526515 TGCTCCCAAGGGGCCCTCCCAGG + Intergenic
917797422 1:178542226-178542248 TGCCGCCCAGTGGCTCTCCCGGG - Intronic
920237219 1:204516248-204516270 GGGCCCCACGACTCTCTCCCCGG + Intergenic
920265787 1:204721573-204721595 TCCCCCCGAGATGCTCACCCTGG - Intergenic
920937225 1:210446771-210446793 TGCCCCAAAGAAGCTGTCCTTGG + Intronic
922153456 1:223023568-223023590 TGCACCCAATATTCTCTCCCTGG - Intergenic
922734415 1:227971691-227971713 TGCCCCCATGGCGGCCTCCCGGG + Intergenic
922734704 1:227972823-227972845 TGCCCCCATGGCGGCCTCCCGGG + Intergenic
924545264 1:245020494-245020516 TGCCCCCAAGACCCTTTCCGGGG + Intronic
1066732615 10:38449138-38449160 TGCCCCCACGGCGGCCTCCCGGG + Intergenic
1067281808 10:44879135-44879157 TGCCCCCAACCCTCTCTACCGGG + Intergenic
1068561224 10:58516264-58516286 TGCCCCCAGGACAGTCTCTCTGG - Intronic
1070793695 10:79204593-79204615 TGCCCCCAAGGAGCTCAACCTGG - Intronic
1073048448 10:100653590-100653612 AGCCCCCAAGACCCTCTCCCTGG + Intergenic
1074256333 10:111806301-111806323 TTCCCCCAGGTCTCTCTCCCAGG + Intergenic
1075787176 10:125057923-125057945 GGCCCCCAAGAGGGTCTCACGGG + Intronic
1076043141 10:127268720-127268742 TTTCCCCAAGTCGCTCTGCCAGG + Intronic
1077140760 11:1023847-1023869 TGCCCACAGGCCCCTCTCCCTGG - Intronic
1077151505 11:1075006-1075028 TGCCCCCAGGACACTCTGCCAGG - Intergenic
1078363839 11:10691028-10691050 TGCCCCTCAGCCGCTCTCTCTGG - Intronic
1079164219 11:18023126-18023148 TACCCCCAAGATCCTCTCCATGG + Intronic
1083721818 11:64607231-64607253 TGCCCCCAAGACGCCCAGCAAGG - Exonic
1083723729 11:64617729-64617751 TGCCGCCCAGAGCCTCTCCCAGG - Intronic
1084416509 11:69035796-69035818 TACCCCCAACCCCCTCTCCCGGG + Intergenic
1084546495 11:69817622-69817644 TGTCCCCAGGACGCCCTCTCAGG + Intronic
1086449025 11:86897942-86897964 TGTCCTCAAGGAGCTCTCCCTGG + Intronic
1089214118 11:116825414-116825436 TGCCCCCCAGCCACACTCCCTGG + Intergenic
1089417598 11:118305181-118305203 TGCTCCCCGAACGCTCTCCCAGG - Intronic
1091637034 12:2205040-2205062 TGTGGCCAAGACCCTCTCCCTGG - Intronic
1091695141 12:2623336-2623358 TGCCCCCACGAGCCTCTCCATGG + Intronic
1091829951 12:3542435-3542457 TGCCCCCAAGAGCCTCTCACAGG - Intronic
1092406369 12:8224511-8224533 TGCCCCCAAGAGTCTCTCAAGGG + Intronic
1092951154 12:13504781-13504803 TGACCCCACGCAGCTCTCCCAGG - Intergenic
1097154995 12:57006204-57006226 TGCCCCCAACAGGCTCACCCGGG - Intronic
1098091863 12:66911075-66911097 TACCCTCAAGGGGCTCTCCCTGG + Intergenic
1100005550 12:89890996-89891018 TGCCCCCAAGAATCTTTCCAAGG - Intergenic
1103781981 12:123404919-123404941 TGCCACCAAGCAGTTCTCCCGGG + Exonic
1104717233 12:131024168-131024190 TCCCCCCAGGCCGCTCTGCCGGG - Intronic
1104787236 12:131457532-131457554 TGCCCCCGAGCTGCTCTCCATGG - Intergenic
1105217621 13:18298367-18298389 TGCCACCAAGCAGTTCTCCCGGG + Intergenic
1110565972 13:76957814-76957836 TGCCTCCAAGATGCTGTCCTGGG + Exonic
1114257588 14:21016649-21016671 TGCCACAAAGGCCCTCTCCCAGG + Intergenic
1114668878 14:24398611-24398633 TACCCCCAACAGCCTCTCCCAGG - Intergenic
1114736559 14:25049324-25049346 TGCCCCCAGGGCGCTGGCCCTGG - Intronic
1119439641 14:74619647-74619669 TGCCCCCAATACCCTCTCTAGGG + Intergenic
1122346696 14:101065386-101065408 AGCCTCCAAGACGGCCTCCCTGG - Intergenic
1122359915 14:101153069-101153091 TGCCCCCGAGCCCCTCCCCCAGG + Intergenic
1122969901 14:105148271-105148293 TGCCCCCAGGACCCTGGCCCTGG - Intronic
1125653588 15:41337837-41337859 TGCCCCCAGGGCTCTCTTCCTGG + Intronic
1128771892 15:70289136-70289158 TGCCCCCAATTCTCTCTCCATGG - Intergenic
1130435777 15:83897914-83897936 AGCCCCCAACATGCTCTCCGCGG - Exonic
1130840261 15:87693397-87693419 TGCCACCAATACCCTATCCCAGG + Intergenic
1133242864 16:4425970-4425992 TGCCCCCACCACGCCCTCCCTGG - Exonic
1133315882 16:4883773-4883795 TGACCTCAAGAGGCTCTCCAAGG - Exonic
1133324690 16:4935860-4935882 TGCCCCCAAGCTGCTCTCACTGG - Intronic
1133556257 16:6908948-6908970 TCCCCCCAACACGCTCTCTCTGG + Intronic
1137556348 16:49472839-49472861 TGCGCCCAAGCCCCTCACCCAGG + Intergenic
1140868667 16:79087057-79087079 TGACCCCAAGACCCTCTACCAGG + Intronic
1141626429 16:85263992-85264014 TGCCTCCTAGAAGCCCTCCCCGG - Intergenic
1142126803 16:88414499-88414521 TGCCCTCACGGCTCTCTCCCGGG - Intergenic
1142223611 16:88866806-88866828 TACCTCCAGGACACTCTCCCTGG + Intergenic
1142449877 16:90168414-90168436 TGCCCCCACGGCGGCCTCCCGGG + Intergenic
1142457209 17:63432-63454 TGCCCCCACGGCGGCCTCCCGGG - Intergenic
1142814021 17:2411326-2411348 TGCCTCCACGACCCTCTCACTGG - Intronic
1145754584 17:27381253-27381275 GGCCCCCAAGAGGCTCAACCGGG - Intergenic
1147384273 17:40072335-40072357 TGCCCCCAGGACCTGCTCCCCGG + Intronic
1147684715 17:42280242-42280264 TTCCCCCAAGCCTCTCTCCTGGG - Intergenic
1148212066 17:45814634-45814656 TCCCCCCAAGTCCCTGTCCCCGG + Intronic
1150108204 17:62477963-62477985 TGCCCCCAAGGTACTCTCCCCGG - Intronic
1151475962 17:74344513-74344535 TGCCCCCACCACGCTGACCCTGG + Intronic
1152887312 17:82860042-82860064 TGGCCCCAAGACAGTGTCCCTGG - Intronic
1157111696 18:44826520-44826542 TGCCCCCAACTCTCTCACCCTGG - Intronic
1160647568 19:200537-200559 TGCCCCCACGGCGGCCTCCCGGG - Intergenic
1161696446 19:5771226-5771248 GGCCCCCAGGGCCCTCTCCCTGG + Intronic
1161715464 19:5873837-5873859 GTGCCCCAAGACTCTCTCCCTGG + Intronic
1162141872 19:8589978-8590000 TGCCCCCAGGACTGTCCCCCTGG - Exonic
1162328676 19:10013578-10013600 TGACCCCAAGAAGCGCTACCAGG + Exonic
1162460334 19:10810828-10810850 TGCCCCCACCCCGCTCCCCCCGG + Intronic
1162508889 19:11105218-11105240 AGCCCCCAAGACGTGCTCCCAGG + Exonic
1162527387 19:11214368-11214390 TGCCCCCAAGACGCTCTCCCGGG + Exonic
1163764637 19:19155994-19156016 CTCCCCCAAGAAGCTCTCCTGGG - Intronic
1164637478 19:29802020-29802042 TGCCCTCAAGATGCTTACCCCGG - Intergenic
1164866986 19:31612648-31612670 AGCCCCCAGGATGCTCTCTCCGG - Intergenic
1167103677 19:47418875-47418897 TGCCCCCAAGTGTCTCTTCCTGG - Intronic
1167625610 19:50586461-50586483 TCACCACGAGACGCTCTCCCTGG + Intergenic
1168406574 19:56113629-56113651 TGCCCACAAGAGGCACACCCCGG + Intronic
1168487352 19:56775434-56775456 TGACCCCAAGACCCTCACTCCGG - Exonic
928199668 2:29239613-29239635 TGCCTCCAAGAGGCCTTCCCGGG + Intronic
932986499 2:76731955-76731977 TGCCCGCAAGATGTTCTTCCTGG + Intergenic
935121273 2:100185635-100185657 TGCCCCGAAGGCTCTCCCCCTGG - Intergenic
938307613 2:130265919-130265941 TGCACACAAGAAGCTGTCCCAGG + Intergenic
938447719 2:131390923-131390945 TGCACACAAGAAGCTGTCCCAGG - Intergenic
938583698 2:132669792-132669814 TGCCCCCAAGGCGCCCACCTCGG - Intronic
942188047 2:173443421-173443443 TGCCCCCAGGAACCTCTCCAAGG - Intergenic
948187774 2:236034899-236034921 TGCTCCCAAGCCCCACTCCCAGG - Intronic
948828987 2:240588323-240588345 CTCCCCCGAGACACTCTCCCAGG - Intronic
1170596180 20:17807247-17807269 TGCCCTCAAGCGGCTTTCCCAGG - Intergenic
1171988308 20:31676104-31676126 TGCCCCCAAGCCCATCACCCTGG - Intronic
1172109787 20:32538226-32538248 TGCCCCCCAAAGGCTCTCCCAGG - Intronic
1172222728 20:33284830-33284852 TACCCCCAAGCTCCTCTCCCTGG + Intronic
1172613196 20:36266744-36266766 TGCCCCCGAGACCCTGACCCAGG + Intronic
1172620317 20:36314119-36314141 TGCTCCCAGCACGCTGTCCCTGG - Intronic
1173868870 20:46329751-46329773 TGCCCCCATGCCGGGCTCCCTGG + Intergenic
1176067381 20:63205317-63205339 TGACCACAAGCAGCTCTCCCTGG + Intronic
1176177844 20:63737105-63737127 TGCCCCCAAGCCGCTCGCTGCGG - Intronic
1177331070 21:19663885-19663907 TGCCCCCCAGACTCTCTAGCTGG - Intergenic
1180859731 22:19070928-19070950 TGGCCCCCAGACTCTCCCCCAGG - Intronic
1181801171 22:25348800-25348822 TGCCCCCAAGAGGCCTTCCAGGG + Intergenic
1181814765 22:25429772-25429794 TGCCCCCAAGAGGCCTTCCAGGG + Intergenic
1182289596 22:29267639-29267661 TGGCCCCGAGACCCTATCCCCGG - Intronic
1183540472 22:38426749-38426771 TGCCCACAAGAGCCTCTGCCGGG - Exonic
1184272434 22:43392465-43392487 TGCCATCAAGTCCCTCTCCCTGG - Intergenic
1185403622 22:50632151-50632173 TGCCCCCAAAATTCACTCCCAGG - Intergenic
950428162 3:12935761-12935783 CGCCCCCAAGAGCCTCCCCCGGG - Exonic
950441914 3:13015470-13015492 AGCCCCCAAGACCCTCACCACGG + Intronic
950624706 3:14236531-14236553 TGTCCCCAAGTAGCTCTCTCTGG + Intergenic
951522390 3:23621753-23621775 TGCACCCCAGAGCCTCTCCCTGG + Intergenic
954200441 3:49020733-49020755 TGCCCCCAGGTCACTCGCCCTGG + Intronic
954752300 3:52820512-52820534 TGCCCCCAACAGACTCCCCCTGG - Intronic
961376507 3:126469648-126469670 TGGCCCTGAGAGGCTCTCCCAGG + Intronic
964404163 3:156331036-156331058 TGCCCACAAGAACCTCTTCCTGG - Intronic
966287430 3:178314252-178314274 TGCCCCCAGGAAGCTCTCAGGGG + Intergenic
968464512 4:743809-743831 TGCCCCCCAGACACTCTCGGGGG - Intronic
969508869 4:7605784-7605806 CACCCCCAAGACCCCCTCCCAGG - Intronic
969717027 4:8872674-8872696 TGCCCCCAAGACCTTCGCCCAGG - Intergenic
972879339 4:43405001-43405023 TGCCCCCAAAACTCTCTCCCTGG - Intergenic
975008141 4:69315852-69315874 TGCCCCTACAACACTCTCCCAGG + Intronic
980165780 4:129225306-129225328 TGCTGCCATGACTCTCTCCCTGG - Intergenic
986015600 5:3754535-3754557 TGACCCCCAGCCTCTCTCCCAGG - Intergenic
989473244 5:41845292-41845314 CTCCCCAAAGAAGCTCTCCCTGG + Intronic
989500312 5:42158716-42158738 TGCTCCCAAGGAGCTCTCTCAGG - Intergenic
992411122 5:76506220-76506242 TGCCCTCAAGTAGCTCTCTCGGG - Intronic
998001061 5:138626343-138626365 GGCCCCCAAGACCCTCTCAAGGG - Intronic
1000359253 5:160432492-160432514 TGCCCCCACCACTCTCTCTCTGG - Intergenic
1000702912 5:164475069-164475091 TGCCCCCAAGAGGGTCCACCTGG + Intergenic
1002729806 5:181326336-181326358 TGCCCCCACGGCGGCCTCCCGGG + Intergenic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1003400525 6:5786848-5786870 GGCCCCCAAGGCCCTCTCTCGGG - Intergenic
1006168353 6:32079147-32079169 TGCCCCCAACACGCACCGCCCGG + Intronic
1008203867 6:48628438-48628460 TGCCCACAACCAGCTCTCCCAGG - Intergenic
1013267979 6:108518923-108518945 TGCACCTAAGACGCTCCCCAGGG - Intronic
1013790451 6:113830365-113830387 TGACCCAAAGAAGCTCTGCCTGG - Intergenic
1018471597 6:164101977-164101999 ATCTCCCAAGACGCTTTCCCTGG + Intergenic
1019470109 7:1215000-1215022 TGCACCCAAGACCCTTTTCCTGG + Intergenic
1022530604 7:31064738-31064760 TCCCCCCAAGACACTGCCCCTGG + Intronic
1024197028 7:47069360-47069382 TACCCCCAAAAAGGTCTCCCTGG + Intergenic
1024984416 7:55182856-55182878 GGCACACAAGACCCTCTCCCAGG - Intronic
1026829692 7:73603159-73603181 TGCCCCCAAGAGCCTCCCACTGG - Intronic
1028584137 7:92436398-92436420 TGCCCCCATGAAGGTGTCCCAGG - Intergenic
1031134686 7:117872870-117872892 CTCCCCCAAGCTGCTCTCCCGGG + Intronic
1032012154 7:128353731-128353753 TGTCCCCAAGAGTTTCTCCCTGG - Intronic
1032037251 7:128530497-128530519 TGCCCCCAAGGTACTCTCCCCGG - Intergenic
1032051522 7:128653457-128653479 TGCCCCCACGGCGGCCTCCCGGG + Intergenic
1034944124 7:155250971-155250993 TGGCCCCAGGCCTCTCTCCCTGG - Intergenic
1035284703 7:157798922-157798944 TGCCCTCCAGTCCCTCTCCCAGG + Intronic
1036263357 8:7257203-7257225 TGCCCCCAAGAGTCTCTCAAGGG - Intergenic
1036264660 8:7264825-7264847 TGCCCCCAAGAGTCTCTCAAGGG - Intergenic
1036265959 8:7272447-7272469 TGCCCCCAAGAGTCTCTCAAGGG - Intergenic
1036267261 8:7280069-7280091 TGCCCCCAAGAGTCTCTCAAGGG - Intergenic
1036268564 8:7287691-7287713 TGCCCCCAAGAGTCTCTCAAGGG - Intergenic
1036269868 8:7295313-7295335 TGCCCCCAAGAGTCTCTCAAGGG - Intergenic
1036298025 8:7551741-7551763 TGCCCCCAAGAGTCTCTCAAGGG + Intergenic
1036299330 8:7559390-7559412 TGCCCCCAAGAGTCTCTCAAGGG + Intergenic
1036300635 8:7567039-7567061 TGCCCCCAAGAGTCTCTCAAGGG + Intergenic
1036301940 8:7574684-7574706 TGCCCCCAAGAGTCTCTCAAGGG + Intergenic
1036303238 8:7582333-7582355 TGCCCCCAAGAGTCTCTCAAGGG + Intergenic
1036315401 8:7715742-7715764 TGCCCCCAAGAGTCTCTCAAGGG - Intergenic
1036316705 8:7723390-7723412 TGCCCCCAAGAGTCTCTCAAGGG - Intergenic
1036318012 8:7731038-7731060 TGCCCCCAAGAGTCTCTCAAGGG - Intergenic
1036319319 8:7738686-7738708 TGCCCCCAAGAGTCTCTCAAGGG - Intergenic
1036320628 8:7746333-7746355 TGCCCCCAAGAGTCTCTCAAGGG - Intergenic
1036321938 8:7753981-7754003 TGCCCCCAAGAGTCTCTCAAGGG - Intergenic
1036323247 8:7761629-7761651 TGCCCCCAAGAGTCTCTCAAGGG - Intergenic
1036324546 8:7769276-7769298 TGCCCCCAAGAGTCTCTCAAGGG - Intergenic
1036351488 8:8015031-8015053 TGCCCCCAAGAGTCTCTCAAGGG + Intergenic
1036352796 8:8022677-8022699 TGCCCCCAAGAGTCTCTCAAGGG + Intergenic
1036354085 8:8030325-8030347 TGCCCCCAAGAGTCTCTCAAGGG + Intergenic
1036846746 8:12175450-12175472 TGCCCCCAAGAGTCTCTCAAGGG + Intergenic
1036868111 8:12417769-12417791 TGCCCCCAAGAGTCTCTCAAGGG + Intergenic
1037884753 8:22590035-22590057 TTCCTCCAAGAAGCCCTCCCTGG - Intronic
1039887160 8:41661446-41661468 TGACCCCGAGCCGCTCTCCTTGG - Intronic
1040296776 8:46152948-46152970 TGCCACCAGGAGGCTGTCCCAGG + Intergenic
1040555247 8:48472402-48472424 TGCCCCCAAGACAGCCTACCTGG + Intergenic
1040661216 8:49578015-49578037 TGCCCATAATACGCTCTTCCTGG + Intergenic
1046718728 8:117595477-117595499 TACCCTCAAGATCCTCTCCCAGG - Intergenic
1046777595 8:118180427-118180449 TGCCCCCAACCCGCTGACCCTGG + Intergenic
1049228665 8:141470713-141470735 GGCCCCCAAGGAGCTCTCCCAGG - Intergenic
1049349896 8:142158952-142158974 GGCCCCCAACCCGCTCTGCCTGG + Intergenic
1057506896 9:95641937-95641959 TGCTCGCAAGACACTCTCCCTGG - Intergenic
1061087210 9:128406066-128406088 TACCCCCAAGAGGCTCTGCCCGG + Intergenic
1061207428 9:129173079-129173101 TCCCCCCAACACACTCCCCCAGG - Intergenic
1062525854 9:136977868-136977890 TGCCCGCGAGAAGCCCTCCCTGG + Intronic
1062631611 9:137465514-137465536 TGTCCCGAGGACGCTGTCCCTGG + Intronic
1062699321 9:137890775-137890797 TGTCCCCACCACACTCTCCCTGG - Intronic
1062754218 9:138278848-138278870 TGCCCCCACGGCGGCCTCCCGGG + Intergenic
1203577778 Un_KI270745v1:21605-21627 TGCCCCCACGGCGGCCTCCCGGG + Intergenic
1186286955 X:8055272-8055294 TGGCCCCAAGCTGCTTTCCCTGG - Intergenic
1187507125 X:19887210-19887232 TGCCCCCGGGGCGCCCTCCCGGG + Intronic
1192452211 X:71251639-71251661 TGCCCTCACCACCCTCTCCCCGG + Intronic
1198221399 X:134605704-134605726 TGTGCCCAAGACCATCTCCCCGG + Intronic
1198807514 X:140505636-140505658 CGTCTCCAAGAAGCTCTCCCTGG + Intergenic
1199981991 X:152926113-152926135 TGCTCCCCAGACGCTCTGCCAGG - Intronic
1200129519 X:153833347-153833369 TTCCTCCCGGACGCTCTCCCAGG - Intergenic