ID: 1162530406

View in Genome Browser
Species Human (GRCh38)
Location 19:11232773-11232795
Sequence CTGTGTAGGTATATGCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162530399_1162530406 17 Left 1162530399 19:11232733-11232755 CCCATGTACATATATGCATAGGG No data
Right 1162530406 19:11232773-11232795 CTGTGTAGGTATATGCATGTGGG 0: 1
1: 0
2: 4
3: 28
4: 296
1162530401_1162530406 16 Left 1162530401 19:11232734-11232756 CCATGTACATATATGCATAGGGT No data
Right 1162530406 19:11232773-11232795 CTGTGTAGGTATATGCATGTGGG 0: 1
1: 0
2: 4
3: 28
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162530406 Original CRISPR CTGTGTAGGTATATGCATGT GGG Intronic
900414505 1:2528841-2528863 CTGTGTGGGTGGATGCGTGTGGG - Exonic
900489185 1:2938097-2938119 CTCTGTATGTGTGTGCATGTGGG - Intergenic
900802240 1:4744612-4744634 GTGTGTGTGCATATGCATGTGGG - Intronic
900952999 1:5868728-5868750 ATGTGTGGGTGCATGCATGTGGG - Intronic
900953014 1:5868897-5868919 ATGTGTGGGTGCATGCATGTGGG - Intronic
900953029 1:5869070-5869092 ATGTGTGGGTGCATGCATGTGGG - Intronic
900978214 1:6030824-6030846 ATGTGTAAGTATATGTGTGTAGG + Intronic
902538370 1:17135055-17135077 GTGTGTGTGTATGTGCATGTGGG - Intergenic
903197120 1:21699032-21699054 CTGTGCATGTACATGCATTTGGG - Intronic
904331687 1:29761900-29761922 CTGTTTATGAATGTGCATGTTGG + Intergenic
905174355 1:36126484-36126506 CTGTGTGCGTGTGTGCATGTAGG + Intergenic
905246103 1:36614948-36614970 GTGTGTGTGTATATGTATGTAGG + Intergenic
906838236 1:49107633-49107655 CTGTGTGTATATATGCCTGTGGG + Intronic
906885811 1:49647395-49647417 CTGTGGAGGTTTTTGCTTGTAGG - Intronic
907222049 1:52914354-52914376 CTGTGTGTGTGCATGCATGTTGG + Intronic
907288634 1:53398150-53398172 CAGTGTAAGTATTTGCATGATGG - Intergenic
908821160 1:68087891-68087913 CTTTGTAGGTATATGGATGAAGG - Intergenic
908934179 1:69354531-69354553 GTGTGTGTGTGTATGCATGTGGG - Intergenic
909940636 1:81607678-81607700 CTATGTAACTATATGCATTTTGG + Intronic
910811277 1:91239327-91239349 GTATGTAGGTATTTGTATGTAGG + Intergenic
911618102 1:100037302-100037324 ATGTGTATGTATATGTAGGTGGG - Intergenic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
913426910 1:118742070-118742092 GTGTGTATGTATATGCATAACGG + Intergenic
913714721 1:121521883-121521905 GTGTGTAGGTCTATACATCTAGG - Intergenic
915047011 1:153026270-153026292 GTGTGTATGTGTATGCATGTGGG + Intergenic
915788879 1:158646110-158646132 CTGTGTGTGTATGTGTATGTTGG - Intronic
919654253 1:200181979-200182001 CAGAGGAGGTATATGCATGTGGG - Intergenic
920742048 1:208590271-208590293 CTGTAAAGGGATGTGCATGTTGG - Intergenic
921586532 1:216952987-216953009 CTGCATATGTATATGTATGTGGG + Intronic
922571462 1:226636999-226637021 CTGTGAAGGTGTGTGCATGTAGG + Intronic
922881890 1:228987232-228987254 CTGTGTGTGTGTATGCGTGTGGG - Intergenic
923199276 1:231695589-231695611 GTGTGTATGTGTGTGCATGTAGG + Intronic
923851481 1:237800887-237800909 GGGTGCTGGTATATGCATGTAGG - Intronic
1067466976 10:46508180-46508202 GGGTGTAGGGATATACATGTGGG + Intergenic
1067574135 10:47397156-47397178 CTGTGCCTGGATATGCATGTAGG + Intergenic
1067620210 10:47876425-47876447 GGGTGTAGGGATATACATGTGGG - Intergenic
1068416053 10:56724170-56724192 TTGTGTATGTGTTTGCATGTAGG + Intergenic
1071889307 10:89985301-89985323 CTGTGAAGGTACATGGAGGTGGG - Intergenic
1072544527 10:96425110-96425132 GTGTATAGGTATATTCATTTTGG + Intronic
1074463453 10:113660188-113660210 ATGTATATGTACATGCATGTGGG - Intronic
1075311659 10:121419475-121419497 GTGAGTAGGTATTTGCATTTTGG + Intergenic
1080137141 11:28868531-28868553 CTGTCTAGGAATATTTATGTGGG + Intergenic
1081515263 11:43822630-43822652 CTGTGTAGGGACATGGATGAAGG - Intronic
1083256229 11:61497191-61497213 GTGTGTGGGTATATGAGTGTGGG + Intergenic
1084908690 11:72369763-72369785 CTGTGTGTGTGTATGTATGTGGG + Intronic
1084959151 11:72707160-72707182 CTGTGCAGGTGTGTGCATGGGGG - Exonic
1085184511 11:74564045-74564067 TTGTGTATGAATGTGCATGTAGG - Intronic
1085365551 11:75939534-75939556 CTATGTATGTATATGTATGGGGG - Intronic
1087869903 11:103279960-103279982 CTGTGTAGGTTTAAACATATGGG - Intronic
1088899896 11:114107677-114107699 ATGTGGAGATATATGCATCTTGG + Intronic
1089728415 11:120503558-120503580 CTGTATAGGTATTTGTATATAGG + Intergenic
1090466474 11:126939125-126939147 CTGTGGGGGTCTGTGCATGTTGG + Intronic
1091196925 11:133739142-133739164 GTGTGTGGGTATATGTGTGTGGG + Intergenic
1091683858 12:2547543-2547565 CTGTGTGTGTAAATGCGTGTGGG + Intronic
1094253122 12:28389222-28389244 CACTGTAGGTATATGCAGGATGG - Intronic
1094747296 12:33359650-33359672 CATTGTAGATATATGCTTGTAGG + Intergenic
1099147584 12:79066041-79066063 TTGTGTATGTTCATGCATGTGGG - Intronic
1101841986 12:108334333-108334355 CTGTGTGAATAAATGCATGTGGG - Intronic
1102362127 12:112297071-112297093 TGGTGTAGGTGTATGGATGTAGG + Intronic
1102795954 12:115688917-115688939 TTGTGTTGGTATCTTCATGTTGG - Intergenic
1102866076 12:116375371-116375393 ATGTGTGGGAGTATGCATGTGGG + Intergenic
1106585541 13:31053580-31053602 CTGTGAGGGTCTATGCATTTGGG - Intergenic
1106602896 13:31202261-31202283 CCGTGTCTGTATATGCATGTGGG - Intronic
1108034322 13:46272835-46272857 CTGTGTATGTATGTGTCTGTGGG - Intronic
1108260292 13:48649036-48649058 GTGTGTATGTATGTGTATGTGGG + Intergenic
1108835495 13:54541704-54541726 GTGTGTGTGTGTATGCATGTTGG + Intergenic
1109528607 13:63608794-63608816 CTGTGTATGTATATGTGTTTTGG + Intergenic
1109774458 13:67021902-67021924 ATGTGTATATATATGTATGTAGG + Intronic
1109883082 13:68507344-68507366 GTGTGTAGGCAAATGAATGTGGG - Intergenic
1111279511 13:86001845-86001867 ATGTGTAAGAATCTGCATGTTGG + Intergenic
1111295363 13:86270015-86270037 CTGTGTAGTTGTGTGCAGGTAGG + Intergenic
1111550862 13:89810245-89810267 CCATATATGTATATGCATGTGGG + Intergenic
1114073482 14:19133198-19133220 CTGTGTGGCTAGATGCATTTCGG + Intergenic
1114088783 14:19266785-19266807 CTGTGTGGCTAGATGCATTTCGG - Intergenic
1114263917 14:21059964-21059986 CTCTGTATGTATATGCATATGGG - Intronic
1114496693 14:23137805-23137827 CTGTGTGGGCATCTGGATGTTGG - Intronic
1115524132 14:34262515-34262537 ATTTGTATGTATATGAATGTGGG - Intronic
1118658952 14:67986042-67986064 CTGTGTGTGTATGTGCATTTGGG + Intronic
1118667216 14:68084013-68084035 GTGTGTACGTGTGTGCATGTTGG + Intronic
1119058602 14:71449819-71449841 CTTTGTTGGTATTTGCTTGTAGG + Intronic
1119878232 14:78078360-78078382 GTGTGTAGTTATATGAATTTAGG + Intergenic
1120526442 14:85582256-85582278 ATGTGTTTGTATATGCATGCAGG + Intronic
1128222274 15:65977764-65977786 GTGTGTGTGTGTATGCATGTAGG + Intronic
1130162695 15:81417406-81417428 GTGTGTATGTATATGTAAGTGGG - Intergenic
1130289500 15:82584699-82584721 CTGTGTAGATAGATGCATTATGG - Intronic
1130710871 15:86279753-86279775 CTGTGTAGGTATAGGGATAGTGG - Exonic
1132998580 16:2837457-2837479 CTGTGTGGGTATTTGCATGGGGG - Intronic
1133013487 16:2928041-2928063 CTGTGTCTGGATGTGCATGTAGG + Intronic
1133707356 16:8367630-8367652 TTGTTTAGGTATGTGAATGTAGG - Intergenic
1136126604 16:28187274-28187296 CTGTGTAGGAAAATTCATGAAGG - Intronic
1137720317 16:50623862-50623884 GTGTGTAGGGGTATGTATGTAGG + Intronic
1138585284 16:57965214-57965236 GTGTGTGTATATATGCATGTTGG - Intronic
1139092737 16:63668455-63668477 CTGTGAAGGTATTTTCCTGTCGG + Intergenic
1139373934 16:66485170-66485192 CAGTGTGTGTATGTGCATGTGGG - Intronic
1140722940 16:77787863-77787885 CTGTGTATGTGCATGCATGTTGG + Intergenic
1141524151 16:84600641-84600663 TTGTGTGGGTATCTGCGTGTAGG + Intronic
1141783394 16:86180678-86180700 ATGTGTATATACATGCATGTGGG - Intergenic
1141783399 16:86180774-86180796 GTGTGTATATAAATGCATGTGGG - Intergenic
1144507713 17:15846860-15846882 ATGTGTAGGTGTATGTGTGTAGG - Intergenic
1145107443 17:20130736-20130758 CTTTGTAGGTATATTTATATGGG - Intronic
1145171837 17:20664477-20664499 ATGTGTAGGTGTATGTGTGTAGG - Intergenic
1146492888 17:33294568-33294590 CTGTGTGGATGTATGTATGTGGG - Intronic
1148754859 17:49968174-49968196 CAGTGTAGGTACCTCCATGTTGG + Intergenic
1149350068 17:55777519-55777541 AGGTGTAGGTATCTTCATGTAGG + Intronic
1150325762 17:64256098-64256120 CTGAGTAGGTGTATCCATGGAGG - Intronic
1151948732 17:77334958-77334980 ATATGTACGTATATACATGTAGG + Intronic
1152028763 17:77828497-77828519 GTGTGCATGTATATGCATGTGGG + Intergenic
1152028767 17:77828564-77828586 GTGTGTATGTATATGCATGTGGG + Intergenic
1152028776 17:77828662-77828684 GTGTGCATGTATATGCATGTGGG + Intergenic
1152028782 17:77828778-77828800 GTGTGCATGTATATGCATGTGGG + Intergenic
1152028792 17:77828877-77828899 GTGTGCACGTATATGCATGTGGG + Intergenic
1152028798 17:77828991-77829013 GTGTGCATGCATATGCATGTGGG + Intergenic
1152028806 17:77829088-77829110 GTGTGCATGTATATGCATGTGGG + Intergenic
1152028811 17:77829202-77829224 GTGTGCATGTATATGCATGTGGG + Intergenic
1152028817 17:77829244-77829266 GTGTCCACGTATATGCATGTGGG + Intergenic
1152158841 17:78654355-78654377 GTGTGTATGTGTATGTATGTGGG - Intergenic
1152575417 17:81138226-81138248 GTGTGTGGGTATGTGCGTGTGGG - Intronic
1152575457 17:81138567-81138589 GTGTGTGGGTATGTGCGTGTGGG - Intronic
1154351908 18:13590310-13590332 GTGTGTTGGTATGTGTATGTGGG + Intronic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1155689275 18:28597995-28598017 GTGTGTGTGTGTATGCATGTAGG + Intergenic
1155780837 18:29832583-29832605 GAGTGTATGTATATACATGTGGG - Intergenic
1155783366 18:29868350-29868372 GTGTGTGGGTATATGTATCTAGG + Intergenic
1156918278 18:42487366-42487388 CTTTGTAGGTAAATGCAGGTAGG - Intergenic
1157069296 18:44387133-44387155 CTGTGTACATGTATGTATGTTGG - Intergenic
1157700913 18:49761253-49761275 CTGTGTAGGGGTATGAGTGTAGG - Intergenic
1159554660 18:69932780-69932802 CAGTGTATGTGTGTGCATGTGGG - Intronic
1161226516 19:3149070-3149092 GTGTGTGGGTGTGTGCATGTGGG - Intronic
1162530406 19:11232773-11232795 CTGTGTAGGTATATGCATGTGGG + Intronic
1162530418 19:11232854-11232876 CTGTGTATGTATATGCATGGGGG + Intronic
1168049020 19:53814866-53814888 CTGTGTAGATGAATACATGTAGG + Intronic
925483389 2:4301725-4301747 ATTTGTAGGTATATGTGTGTGGG + Intergenic
925788294 2:7454454-7454476 GTGTGTAGGTTTCTGTATGTAGG + Intergenic
925788311 2:7454580-7454602 GTGTGTGGGCATCTGCATGTGGG + Intergenic
925788315 2:7454629-7454651 GCATGTAGGTATCTGCATGTTGG + Intergenic
925788318 2:7454657-7454679 GTGTGTAGGTGTCTGTATGTGGG + Intergenic
925788321 2:7454699-7454721 GCATGTAGGTATCTGCATGTCGG + Intergenic
925788324 2:7454727-7454749 GTGTGTAGGTGTCTGTATGTGGG + Intergenic
925788358 2:7455028-7455050 GCGTGTGGGTATCTGCATGTGGG + Intergenic
926293316 2:11548383-11548405 ATGTGTATGTGTATGTATGTGGG - Intronic
927362204 2:22249223-22249245 CTGTGTAAGTAGATTCCTGTAGG - Intergenic
928126362 2:28619381-28619403 CTCTGGTGGTATTTGCATGTGGG + Intronic
928582621 2:32724343-32724365 CTGTGTTGATATTTGCATATTGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930601526 2:53449267-53449289 CTCTGGAGGTATATGCATGTTGG + Intergenic
933009714 2:77044815-77044837 GTGTGAATATATATGCATGTAGG + Intronic
933144202 2:78831227-78831249 CTGTGTAGATATTTGCATTGTGG - Intergenic
933222823 2:79710413-79710435 CTGTCTAGGAATATGCATGAAGG + Intronic
933556154 2:83833405-83833427 ATGTGTACGTATATGTATATAGG - Intergenic
934928532 2:98399975-98399997 GTGTGTATGTATATATATGTTGG + Intergenic
935715602 2:105936514-105936536 CTGTGTAGATGTATGCATGTTGG - Intergenic
936792992 2:116171925-116171947 GTGTGTGTGTATGTGCATGTGGG + Intergenic
938605825 2:132891601-132891623 CTGTGTGTGCATATGCATATGGG + Intronic
939027190 2:137028028-137028050 ATGTGTAGATATATACATATAGG - Intronic
940216149 2:151305499-151305521 CTGGGCATGTAGATGCATGTTGG - Intergenic
941469420 2:165865874-165865896 CTGTATATGCATATGTATGTAGG + Intronic
941878886 2:170461818-170461840 GTGTGTATGTATATGTATGGAGG + Intronic
942795809 2:179817789-179817811 CTGTGTGTGTGCATGCATGTTGG + Intronic
943497302 2:188637805-188637827 CTGTGTTGGTTTCTGAATGTTGG + Intergenic
945503824 2:210613111-210613133 GTGTGTATGTGTGTGCATGTGGG + Intronic
945633487 2:212316267-212316289 GTGTGTGTGTACATGCATGTGGG - Intronic
1169833362 20:9850586-9850608 ATGTATATGTATATGTATGTAGG - Intergenic
1171249043 20:23634880-23634902 CTGTGTGTGTGTGTGCATGTGGG - Intronic
1173310133 20:41889954-41889976 CAATGTAGGGAAATGCATGTTGG + Intergenic
1173941712 20:46916382-46916404 GTGTGTGAGTATATGAATGTGGG + Intronic
1174104686 20:48153803-48153825 ATGTGGAGGCAGATGCATGTTGG + Intergenic
1176200285 20:63857166-63857188 CTCTGTACGTATATGTTTGTAGG + Intergenic
1176254484 20:64144121-64144143 ATATGCATGTATATGCATGTGGG + Intergenic
1176254489 20:64144209-64144231 ATATGCATGTATATGCATGTGGG + Intergenic
1176377765 21:6095084-6095106 ATGCGTAGGTGTGTGCATGTGGG - Intergenic
1177499891 21:21940200-21940222 GTGTGTGTGTGTATGCATGTTGG + Intergenic
1179745709 21:43443160-43443182 ATGCGTAGGTGTGTGCATGTGGG + Intergenic
1180491924 22:15855551-15855573 CTGTGTGGCTAGATGCATTTCGG + Intergenic
1181437877 22:22920922-22920944 GTGTGTATGTATTTGCATGCAGG - Intergenic
1183062155 22:35342802-35342824 CTGTGTAGGTGTATGAGTGTAGG - Intronic
1183062267 22:35343571-35343593 GTGTGTAGGTGTATGAGTGTAGG - Intronic
1183062301 22:35343827-35343849 GTATGTAGGTGTATGAATGTAGG - Intronic
1183062322 22:35343994-35344016 GTGTGTAGGTGTATGAGTGTAGG - Intronic
1183708571 22:39489401-39489423 CTCTGTAAGTAGATGCATTTGGG + Exonic
949497438 3:4645847-4645869 GTGTGTAGGTGTGTGTATGTGGG - Intronic
949726473 3:7052550-7052572 CTGTGTGTGTATATGGAGGTGGG - Intronic
954381687 3:50222209-50222231 GTGTGTATGTGTATGCATGGGGG - Intergenic
954553752 3:51502783-51502805 GTGTGTGGCTATGTGCATGTTGG - Intergenic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
955883945 3:63577607-63577629 GTGTGTAGGTGTATGAATGTAGG + Intronic
958506971 3:94992240-94992262 GTGTGTCTGTATATGTATGTGGG + Intergenic
958836042 3:99146249-99146271 CTGTGCAGGTATTAGCAAGTGGG + Intergenic
958900792 3:99884142-99884164 CTGTTCAGGGATATGCATATGGG + Intronic
959389915 3:105760984-105761006 GTGTGTAGGTATTTACATTTCGG - Intronic
959557350 3:107736916-107736938 CTGTGTAGTTGTATGACTGTTGG + Intronic
960446335 3:117753462-117753484 GTGTGTACGTATATGTGTGTCGG + Intergenic
960737960 3:120801239-120801261 CTGTGGAGGTAAAGGCAAGTGGG + Intergenic
961137398 3:124524701-124524723 ATGTGTATGTATGTGCATATAGG + Intronic
962662231 3:137614625-137614647 ATGTGCATGTATGTGCATGTTGG - Intergenic
963332011 3:143925127-143925149 CTGTGTGTGTATGTGAATGTGGG - Intergenic
967158519 3:186714995-186715017 CTGTGTGTGTGTATGCATATGGG - Intergenic
967290364 3:187913918-187913940 ATGTGTTTGTGTATGCATGTAGG + Intergenic
969230286 4:5825880-5825902 GTCTGTATGTGTATGCATGTGGG - Intronic
970025770 4:11622516-11622538 ATGTGTATGTGTATGCATGATGG - Intergenic
970333138 4:15004181-15004203 CTGTTGAGGTATATTCATGGCGG - Exonic
970668667 4:18368832-18368854 GTGTGTGTGTATATACATGTAGG - Intergenic
970732006 4:19116396-19116418 TTGTGTAGATATATGCATTGGGG - Intergenic
973042145 4:45482659-45482681 GTGTGTAGGTATGAGCACGTAGG + Intergenic
973866648 4:55120860-55120882 GTGTGTGTGTGTATGCATGTTGG + Intronic
976484778 4:85589125-85589147 TTCTGTGGGTATTTGCATGTAGG + Intronic
977321483 4:95521604-95521626 ATGTGTTGGTATTTGGATGTGGG - Intronic
977765168 4:100788780-100788802 CCGTGTAGGTATAGCCCTGTGGG - Intronic
978982537 4:114966262-114966284 GTGAATATGTATATGCATGTGGG - Intronic
979854430 4:125613381-125613403 CTGTGTGTGTATGTGTATGTGGG - Intergenic
979991869 4:127384333-127384355 ATGTGTATGTATATGTATATAGG - Intergenic
981212119 4:142119489-142119511 CTTTGTAGGGATATGGATGAAGG + Intronic
981460690 4:145010516-145010538 CTTTGTAGGGACATGCATGAAGG + Intronic
982477957 4:155876252-155876274 CTGTGTAGTTATATATGTGTTGG - Intronic
983224556 4:165073801-165073823 CTGTGTCCGGATGTGCATGTAGG - Intergenic
984984669 4:185316406-185316428 CTTTGGAGGTAGATACATGTAGG - Intronic
985095167 4:186406171-186406193 GCGTGTAGGTGTGTGCATGTGGG - Intergenic
986418460 5:7551921-7551943 TTCTGTATGTATATGCCTGTGGG + Intronic
987953626 5:24708108-24708130 GTGTGTATGTATATGTATTTAGG + Intergenic
991101461 5:62797994-62798016 CTGTGCAGGTCTATAGATGTAGG - Intergenic
993037866 5:82776960-82776982 ATGTGTATGTATATGCGAGTGGG - Intergenic
994548052 5:101193968-101193990 GTGTGTGTGTATATGTATGTAGG - Intergenic
995397228 5:111699780-111699802 ATGTGTATGTATATGTTTGTGGG + Intronic
995787706 5:115847925-115847947 CTGTGAACGTATAAGCATTTGGG - Intronic
996191702 5:120551669-120551691 CTGTGCATGTATATAAATGTAGG + Intronic
996229265 5:121041047-121041069 CTTTGTAGGAATATGGATGAAGG - Intergenic
996496870 5:124168298-124168320 CTTTGTAGGGACATGCATGGAGG - Intergenic
996965187 5:129299689-129299711 GTGTGTTGGTGTATGCATGATGG - Intergenic
998542769 5:142998497-142998519 CTGTGTTTGTAAATGTATGTTGG + Intronic
1000433730 5:161182153-161182175 CTTTGTAGTTATATGTATCTAGG - Intergenic
1001009036 5:168081316-168081338 CTGTGTGTGTCTCTGCATGTGGG + Intronic
1001079134 5:168654098-168654120 CCGTTTAGGTAAATGCATATCGG - Intergenic
1001209035 5:169793196-169793218 CTGTGTAAGCATATGCATTTTGG - Intronic
1002394917 5:178945228-178945250 CTGTGTGTGTATTTGTATGTTGG + Intronic
1003322033 6:5060381-5060403 CTTTGCAGGTACATTCATGTAGG + Intergenic
1003654332 6:7991766-7991788 GTGTGCATGTATATGCATGCAGG - Intronic
1004064539 6:12230127-12230149 AAATGTAGGTATATGCATTTTGG + Intergenic
1005531939 6:26716440-26716462 CTGTGTCCTTATATGCATTTGGG - Intergenic
1005538856 6:26785225-26785247 CTGTGTCCTTATATGCATTTGGG + Intergenic
1008130748 6:47718260-47718282 CTGTGTAGCTATATCAGTGTGGG + Intronic
1008178422 6:48297272-48297294 GTGTGTATGTATATACTTGTTGG - Intergenic
1009009703 6:57827452-57827474 CTGTGTCCTTATATGCATTTGGG + Intergenic
1012272154 6:97226699-97226721 GTGTGTATATATATGTATGTAGG + Intronic
1013895299 6:115080945-115080967 GTGTGTGTGTATATGTATGTAGG - Intergenic
1013895363 6:115081588-115081610 GTGTGTGGGTGTATGTATGTAGG + Intergenic
1014077717 6:117256005-117256027 TTGTATAGGTATATGTATATGGG - Intergenic
1014167453 6:118241609-118241631 CTGTGTAGTTCTATGCACTTTGG + Intronic
1014347956 6:120299469-120299491 TTGTGTAGTTATGTGCATTTTGG - Intergenic
1015420180 6:132998585-132998607 ATGTGTGCTTATATGCATGTAGG - Intergenic
1015667270 6:135646156-135646178 CTGTGGAGGTTTCTGCTTGTGGG - Intergenic
1016453603 6:144209391-144209413 CTGTGTACGTTCATGCAAGTGGG + Intergenic
1016866788 6:148775534-148775556 ATGTGTATGTGTGTGCATGTGGG + Intronic
1017635951 6:156443250-156443272 CTGTGTAGGCATAGGCAGGTAGG - Intergenic
1018765586 6:166930454-166930476 GTGTGTGTGTACATGCATGTGGG - Intronic
1018765597 6:166930793-166930815 ATGTGTGTGTACATGCATGTGGG - Intronic
1018765599 6:166930832-166930854 ATGTGTGTGTACATGCATGTGGG - Intronic
1018940076 6:168303370-168303392 CTGTGTTGGTCTATTCATGAGGG - Intronic
1019553807 7:1618615-1618637 GTGTGTAGGTGTGTGCGTGTAGG + Intergenic
1019553863 7:1618984-1619006 GTGTGTAGGTGTGTGTATGTGGG + Intergenic
1019553915 7:1619308-1619330 GTGTGTAGGTGTATGTGTGTCGG + Intergenic
1020597435 7:10225851-10225873 CTTTATAGCTATATGCATTTAGG + Intergenic
1021430707 7:20555803-20555825 CTTTGTAGGGATATGGATGAAGG + Intergenic
1023847223 7:44129213-44129235 CTGTGTGTGTATGTGCATGTGGG - Intergenic
1023870026 7:44258294-44258316 GTGTGGAGGTGTGTGCATGTGGG - Intronic
1024529886 7:50382924-50382946 CTGTGTGTGTATGTGCATGGGGG - Intronic
1024659237 7:51477329-51477351 GTGTGTAGGTATGTGAATATGGG + Intergenic
1028309688 7:89316011-89316033 GTGTGTCTGTGTATGCATGTGGG + Intronic
1028825484 7:95268234-95268256 CTATTTATGTGTATGCATGTTGG - Intronic
1029016238 7:97317653-97317675 CTGTGTGGGCTTTTGCATGTAGG + Intergenic
1029842534 7:103381565-103381587 GTGTGTGTGTATATGTATGTAGG - Intronic
1031194397 7:118593566-118593588 GTGTGTATGTGCATGCATGTTGG - Intergenic
1031194899 7:118600877-118600899 GTGTGTATATACATGCATGTGGG - Intergenic
1031391274 7:121217903-121217925 CTGTGTAGATGTGTGCATATAGG + Intronic
1031798656 7:126213501-126213523 AAGTGTAGGAGTATGCATGTGGG - Intergenic
1032869373 7:135966420-135966442 CTGCTTAGGGATATGCATGATGG - Intronic
1033423436 7:141222392-141222414 CTGTCTAGGTATATGACTCTTGG + Intronic
1034759824 7:153660902-153660924 CTGTGCAGGTGTTTGCATGAGGG + Intergenic
1034986926 7:155522072-155522094 CTGTGTGTGTGGATGCATGTGGG - Intronic
1035317839 7:158007809-158007831 GTGTGTGGGTATATACATGTGGG + Intronic
1035397848 7:158546802-158546824 CTGTGTGTGCATCTGCATGTTGG - Intronic
1037172218 8:15906348-15906370 CAGTGTAGGTATTTGCAAGAAGG + Intergenic
1042067429 8:64893519-64893541 TTGAGTATGTATATGCATGCTGG - Intergenic
1042413980 8:68498193-68498215 ATGTGTGTGCATATGCATGTGGG - Intronic
1043144044 8:76629211-76629233 CTGTGGAGGTTTCAGCATGTGGG - Intergenic
1044793153 8:95868547-95868569 CTGTATAGTTACATGCATATTGG + Intergenic
1048361439 8:133700516-133700538 TTGTGTAGGCATCTGCCTGTTGG + Intergenic
1048852848 8:138661063-138661085 GTGTGTATGTATGTGTATGTGGG - Intronic
1051781679 9:20695533-20695555 CTGTGTACGTGTATAAATGTAGG - Intronic
1052662387 9:31450683-31450705 ATGTATATGTGTATGCATGTAGG - Intergenic
1056768298 9:89458845-89458867 GTGTGTATGTGTATCCATGTGGG - Intronic
1056804345 9:89717168-89717190 GTGTGTGAGTATATGTATGTGGG - Intergenic
1058664786 9:107302133-107302155 CTGTATATCTTTATGCATGTAGG + Intronic
1060288954 9:122282474-122282496 CTGTATAGTTTTATACATGTTGG - Intronic
1060560491 9:124538505-124538527 CTCTATGGGTATATGAATGTTGG + Intronic
1060951658 9:127607837-127607859 CTTTGTAGATGTATGCATGGTGG + Intergenic
1061861373 9:133470221-133470243 GTGTGTATGTATATGTGTGTGGG + Exonic
1062288505 9:135784392-135784414 CTGTGTGTGTGTATGCATGAGGG + Intronic
1185487384 X:493180-493202 CTGTACACGTATATGCATATGGG - Intergenic
1186057877 X:5670784-5670806 GCGTGTAGATATATACATGTAGG + Intergenic
1186082806 X:5951791-5951813 CTGTGTAGGTATTTGGAAGTGGG - Intronic
1187477422 X:19624432-19624454 TTGTGTAGGCATATGCACCTGGG + Intronic
1188279691 X:28249921-28249943 CTGTGTAGATATATAAAAGTGGG + Intergenic
1188453387 X:30334013-30334035 ATATGTAGGTATATATATGTAGG - Intergenic
1188541873 X:31259843-31259865 CTGTGTAGGTATACGTAAGTGGG - Intronic
1189376793 X:40472758-40472780 CTTTGTATTTATATACATGTAGG + Intergenic
1189379323 X:40490784-40490806 GTGTGTAGGTATGTGTATGTAGG - Intergenic
1190342524 X:49308833-49308855 GTGTGTAGGTGTGTGAATGTGGG + Intronic
1190375450 X:49784486-49784508 ATGTGTAAGTATGGGCATGTGGG + Intergenic
1190620206 X:52279827-52279849 CTGTGTAACTATAGACATGTTGG - Intergenic
1190812852 X:53901319-53901341 GTGTGTGCTTATATGCATGTGGG - Intergenic
1191111792 X:56809638-56809660 CTGTGTGTGTCTTTGCATGTGGG + Intergenic
1192173483 X:68871638-68871660 CTGTGCCGGGATGTGCATGTGGG + Intergenic
1192188061 X:68969224-68969246 ATATGTAGGTACTTGCATGTTGG - Intergenic
1194265567 X:91749511-91749533 GTGTGTTTGCATATGCATGTTGG - Intergenic
1195825984 X:109001421-109001443 CTGTGGAAGTTTATGCTTGTGGG - Intergenic
1195985807 X:110628575-110628597 CTGTGTGTGTCTTTGCATGTGGG - Intergenic
1196644710 X:118105056-118105078 GTGTGTTGGTATATGTGTGTGGG - Intronic
1196819298 X:119690332-119690354 GTGTGTATGTGTATGTATGTGGG - Intronic
1196874788 X:120147451-120147473 CTGTGTATGTGTGTGAATGTGGG + Intergenic
1197111131 X:122776148-122776170 CTGTGTGGTTACATGCATGTTGG + Intergenic
1198133955 X:133728161-133728183 GTGTGTAGCTGTTTGCATGTGGG - Intronic
1198286797 X:135199071-135199093 CTGTTTAGATAGATGCACGTAGG - Intergenic
1198612284 X:138415400-138415422 CTTTGTAGGTTTATGTGTGTAGG - Intergenic
1200229801 X:154438204-154438226 CTGCGTAGGTAGATGCCTCTCGG + Intronic
1200582718 Y:4969959-4969981 GTGTGTTTGCATATGCATGTTGG - Intergenic
1200843580 Y:7808748-7808770 GTGAGTACATATATGCATGTAGG - Intergenic
1200928575 Y:8676489-8676511 CTGTATGTGTGTATGCATGTGGG - Intergenic
1201475343 Y:14375690-14375712 CTGTATAGGAATATACAGGTTGG + Intergenic
1201512487 Y:14780506-14780528 CTGTGTAGGTATTTGGAAGTGGG + Intronic
1201746031 Y:17374894-17374916 GTGTGCATGTATATGCCTGTGGG + Intergenic