ID: 1162531590

View in Genome Browser
Species Human (GRCh38)
Location 19:11239352-11239374
Sequence ATGGAGAAACAGGCTCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 712
Summary {0: 1, 1: 3, 2: 23, 3: 91, 4: 594}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162531586_1162531590 5 Left 1162531586 19:11239324-11239346 CCATCATCATTGCGATGCCTATT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG 0: 1
1: 3
2: 23
3: 91
4: 594

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162531590 Original CRISPR ATGGAGAAACAGGCTCAGCA TGG Intronic
902181004 1:14688283-14688305 AATGAGAAACAGGCCCAGCGAGG - Intronic
902357589 1:15916834-15916856 ATGAAGCAGCAGGCTGAGCATGG + Intronic
902405179 1:16178918-16178940 TTGAAGAAACAGGCTCAGGGAGG - Intergenic
902443752 1:16448425-16448447 ATGGAGGAGCAGGCCCAGAAAGG - Intronic
902540341 1:17149838-17149860 GTGGAGTAACAGGCTCAGGGAGG + Intergenic
902741380 1:18440966-18440988 AGGGAGACACAGGGTCAGCCAGG - Intergenic
903124517 1:21238528-21238550 ATGGGGAAACACACTCGGCACGG + Intronic
903221755 1:21873261-21873283 ATGAAGAAACAGGCTCGGACAGG + Intronic
903390745 1:22962055-22962077 AAGGAGACAGAGGCTCAGAAAGG - Intronic
903469204 1:23573758-23573780 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
903549754 1:24149740-24149762 CTGGAGAAACAGACTCAGAGTGG + Intergenic
903610728 1:24610082-24610104 ATCAGGAAACAGGTTCAGCAAGG + Intergenic
903891905 1:26575339-26575361 ATGGGGAAACAGGCTCAAGTTGG + Intergenic
903974231 1:27138684-27138706 ATGGAGGAACAGGCCTGGCAAGG + Intronic
904195174 1:28780174-28780196 TAGGAGAAACAGGCCGAGCACGG - Intergenic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
904473907 1:30752270-30752292 ATGGGAAAACAGGTCCAGCAGGG - Intronic
904562233 1:31406653-31406675 ATAGAGAAACAGGCCCAGAAAGG + Intergenic
904846349 1:33420919-33420941 ATGAAGAAACAGGCTCAAAGAGG - Intronic
904894413 1:33803435-33803457 ATGGAGGAACATGCTTTGCAGGG - Intronic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
905093567 1:35449626-35449648 ATGGAGAAACAAACTCAGAGAGG - Intronic
905133292 1:35777914-35777936 ATGGAGAGAAAGGCTGAGCCTGG - Intergenic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
905431989 1:37931359-37931381 ATGGAGCAACAGGCCCAGAGAGG + Intronic
905476873 1:38235200-38235222 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
905546338 1:38803197-38803219 ATGGAAAAACAGGCACAGAGAGG - Intergenic
905646388 1:39627309-39627331 ATGGGGAGACAGGCTCAGAGAGG - Intronic
905652927 1:39668521-39668543 ATGGGGAAACAGGCCCAGAAAGG + Intronic
906282465 1:44563674-44563696 ATGGTGAAACAGGTTCAGAGAGG - Intronic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906674216 1:47681517-47681539 ATGAGGAAACTGGCTCAGAAAGG - Intergenic
906689639 1:47784130-47784152 ATGAGGAAACAGGCTCAGTGAGG + Intronic
906873214 1:49507213-49507235 GTTGAGAAATAGGCTCAGCTGGG - Intronic
907159381 1:52359641-52359663 TAGGGGAAACAGGCTCAGAAAGG - Intronic
907782201 1:57577560-57577582 ATAAAGAAACAGGCTCAGAGAGG + Intronic
908028725 1:59977315-59977337 ATGAGGAAATAGGCACAGCATGG + Intergenic
908156673 1:61360414-61360436 AGGGAGACACAGGCTCAGAGAGG - Intronic
908797987 1:67850566-67850588 ATGAAGAAAGAGGCTCAGAGAGG - Intergenic
909504542 1:76373286-76373308 ATGAGAAAACAGGCCCAGCAAGG - Intronic
909661016 1:78082150-78082172 ATGTGGAAACAGGCTCAGGAAGG + Intronic
909776161 1:79488045-79488067 AAGGATAAACAGGCCAAGCATGG - Intergenic
909848670 1:80432858-80432880 ATCTAGAAATAGCCTCAGCATGG - Intergenic
910039715 1:82835073-82835095 ATTGAGAAAAAGGCTGAGCGGGG + Intergenic
910262132 1:85303069-85303091 ATGAAGAAACTGGCCAAGCAGGG + Intergenic
910452050 1:87357389-87357411 ATAGAGAAACAGGCCCAGAGAGG - Intergenic
910667207 1:89738766-89738788 ATGGAGGAAAAGGCTCATGAAGG + Intronic
912310664 1:108617796-108617818 ATGAAGAAACGGCCTCAGAAAGG + Intronic
912553432 1:110499151-110499173 ATGGAAACAGAGGCTCAGCAGGG + Intergenic
912587730 1:110782016-110782038 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
913445131 1:118943059-118943081 ATGAAGAAATTGGCTCAGAAAGG - Intronic
913511579 1:119567426-119567448 GTAGAGAAACAGGCAGAGCATGG - Intergenic
913515816 1:119604752-119604774 GTAGAGAAACAGGCAGAGCATGG - Intergenic
913539462 1:119804975-119804997 GTGAGGAAACAGGCTCAGGATGG + Intronic
914447147 1:147759727-147759749 ATGAAGAAACAGACTCAGTGAGG - Intronic
914965016 1:152248630-152248652 ATGAGGAAACAGACTCAGAAAGG - Intergenic
915507977 1:156369296-156369318 CTGGAGGAAGAGGCACAGCAGGG - Exonic
915614755 1:157028874-157028896 ATGGAGAAACTGGCTGGGCGTGG + Intronic
915943677 1:160135027-160135049 CAGGGGAAGCAGGCTCAGCAGGG + Intronic
916996795 1:170309876-170309898 AAGGGGAAACAGTCTCAGTAGGG - Intergenic
917013349 1:170500696-170500718 ATACAGAAACAGGTTCAGAAAGG - Intergenic
917347206 1:174040562-174040584 ATGAGGAAACAGGCACAGAAGGG + Intergenic
917965281 1:180174867-180174889 ATGAAGAAACAGGCTCGGCCAGG + Intronic
918044325 1:180932352-180932374 ATGGAGAAAGAGGCCCACGAAGG - Intronic
918162615 1:181915352-181915374 CAGGAGAAACATGCTCAGCTAGG - Intergenic
918345179 1:183601565-183601587 ATGGTGAATCAGGCTGAGCACGG + Intergenic
918346571 1:183612633-183612655 ACGAAGAAACAGGCTCAGAAAGG + Intergenic
919516853 1:198535757-198535779 CTGAGGAAACAGGCACAGCAAGG + Intronic
919561876 1:199131332-199131354 ATGAAGAAACATGCTCAGTGAGG + Intergenic
919743868 1:200996524-200996546 ATGATGAAACAGGCTCAGAGAGG - Intronic
919975232 1:202606215-202606237 ATGGGGAAACAGGTTCAGAGAGG + Intronic
920548900 1:206841584-206841606 ATGCAGATTCTGGCTCAGCAGGG + Intronic
920697374 1:208191627-208191649 ATGAAGAAACAGGCACAGAGAGG + Intronic
920786417 1:209046451-209046473 TTGCAGAAACAGGCTGGGCACGG - Intergenic
920904105 1:210143643-210143665 TTGGAGAAACTGGGTCGGCAGGG + Intronic
922057758 1:222057652-222057674 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
922532585 1:226355800-226355822 ATGTGGAAACAGGCTCAGAGAGG - Intergenic
923248265 1:232154858-232154880 CTGCAGAATCAGGTTCAGCAAGG + Intergenic
924818112 1:247460630-247460652 ATGGTGGAACAGGCTAGGCATGG + Intergenic
1063194574 10:3729512-3729534 AAGGAGAAAAGGGCTCAGAATGG - Intergenic
1063604372 10:7509272-7509294 ATGGGCAAACAGGCTCAGAGAGG + Intergenic
1064893354 10:20205806-20205828 ATGAGGAAACAGGCTTAGAAAGG + Intronic
1065675822 10:28173148-28173170 AAGGAGAACCAGGGTGAGCAGGG + Intronic
1066203051 10:33160301-33160323 GTGGAGAAACAGGTCAAGCACGG - Intergenic
1066721163 10:38341024-38341046 CAGGAGAAAGAGGCACAGCATGG - Intergenic
1067067963 10:43114244-43114266 ATGGAGACAGAGGCTCAGAGAGG - Intronic
1067509322 10:46882336-46882358 TTGGAGCAACAGATTCAGCATGG + Intergenic
1067652931 10:48169519-48169541 TTGGAGCAACAGATTCAGCATGG - Intronic
1068638181 10:59370739-59370761 GTGGAGAGACAGGCCCTGCAGGG - Intergenic
1068874304 10:61980189-61980211 ATGGAGGAAGGGGCTCAGGAGGG + Intronic
1069441539 10:68433148-68433170 AAGGAGCATCAGGTTCAGCAGGG - Intronic
1069820265 10:71223116-71223138 TTGGGGAGACAGGTTCAGCAGGG + Intronic
1070317480 10:75329035-75329057 ATGGAAAGACAGGCCGAGCACGG - Intergenic
1070828818 10:79406441-79406463 GTGAAGAAGCAGGGTCAGCAGGG - Intronic
1071162985 10:82772993-82773015 ATACGGAAACAGGCTCTGCAGGG - Intronic
1071164398 10:82787636-82787658 TTGCAGAAGCAGCCTCAGCATGG - Intronic
1072728448 10:97829038-97829060 TGGGAGAAACAGGTTCTGCATGG - Intergenic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074087916 10:110222703-110222725 ATGGGGAAACAGGAAAAGCAAGG - Intronic
1074275965 10:112002391-112002413 ATAGAGAAGCAAGCTAAGCATGG - Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074751264 10:116589592-116589614 ATGGAGAAACAGGCTAGACTTGG - Intergenic
1074790801 10:116885878-116885900 ATGGAGAAACTGCAGCAGCATGG - Exonic
1075060684 10:119254762-119254784 ATGGAAAAACAGGCCGGGCACGG + Intronic
1075721608 10:124590765-124590787 ACAGAGAAGCAGGCTCAGGAAGG - Intronic
1075733248 10:124648690-124648712 ATGAGCAAACAGGCTCAGAAAGG + Intronic
1075922414 10:126224464-126224486 AGGGAGAAACAAGCACAGGAAGG + Intronic
1076150318 10:128157064-128157086 ATCGGAAAACAGGCTGAGCATGG - Intergenic
1078730245 11:13966813-13966835 ATGGAGAAATTGGCTCAGAGAGG - Intronic
1079138889 11:17794448-17794470 ATGAAGAACCAGGCTCAGAGAGG + Intronic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080804033 11:35635578-35635600 ATGGGGAAACAGGCACAGAGTGG + Intergenic
1081631411 11:44692537-44692559 CTGGCAAAACAGGCACAGCAGGG - Intergenic
1081651296 11:44825805-44825827 ATGGAGAAACAAGCCCACCAGGG - Intronic
1081982581 11:47277585-47277607 ATGTAGAAAGAGGCTGGGCACGG - Intronic
1082015709 11:47485074-47485096 ATGAGGAAACAGGCACAGAATGG - Intronic
1082740065 11:56901008-56901030 ATGAAGAAACAGACTCACAAAGG + Intergenic
1082792981 11:57359982-57360004 ATGGAAAAACAGACTCAGAGAGG + Intronic
1082806496 11:57454984-57455006 ATGGAGAAACAGGCTCAGAGAGG - Intergenic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083262920 11:61532836-61532858 CTGGAGAGCCAGGCCCAGCATGG - Intronic
1083841902 11:65309349-65309371 ATGGAGAAACACCCAGAGCAGGG - Intergenic
1083935801 11:65869527-65869549 AAGAAGAAACAGGCTCAGAGAGG + Intronic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084155161 11:67309190-67309212 ATGGGGAAACAAGCCCAGCAGGG + Intronic
1084392406 11:68886448-68886470 TTGGAGAAACAGACTCAAAAAGG - Intergenic
1084912354 11:72401037-72401059 ATGAAGAAACAGGCTGTCCATGG + Intronic
1084949477 11:72656826-72656848 ATGGGGAAACAGGCCCAGGGTGG - Intronic
1085021807 11:73214729-73214751 GTAGAGAAACAGGTTCAGAAAGG - Intergenic
1085025757 11:73235631-73235653 ATGGAGAAACAGGCCCAGAGAGG + Exonic
1085392286 11:76188675-76188697 ATGGGGAAACAGACACAGAAGGG + Intronic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1086070853 11:82797410-82797432 ATGGAGGACCAAGGTCAGCAAGG + Intergenic
1086286689 11:85259685-85259707 ATGGAGAGACAGGTTCAGATGGG - Intronic
1086957761 11:92951222-92951244 ATGGAGAGACAGGCTGGGCATGG + Intergenic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087321132 11:96660235-96660257 TTAAAGAAACAGACTCAGCAAGG - Intergenic
1088392162 11:109326492-109326514 ATGAAGAAACAGTCCCAGAAAGG - Intergenic
1089399322 11:118155353-118155375 ATGAAGAAAGAGGCTCAGAGAGG + Intergenic
1089654732 11:119938962-119938984 GTGGAGACACAGGCTCAGTGTGG + Intergenic
1089791378 11:120947111-120947133 AGGGAGAAATAGGCTGGGCACGG + Intronic
1089854743 11:121533301-121533323 ATGAGAAAACAGGCTCAGCAAGG + Intronic
1090024423 11:123155529-123155551 ATGGAGAAACCAGCTCAGAGGGG + Intronic
1090132289 11:124157285-124157307 ATTGAGAAACAGTATCAGCAAGG - Intergenic
1090376016 11:126290173-126290195 ATGGAGAAACGAGTTTAGCAAGG + Intronic
1090568205 11:128018959-128018981 TTGGAGAAAGAGCCTGAGCATGG - Intergenic
1091538316 12:1434811-1434833 ATGACGAAAGAGGCTCAGCATGG - Intronic
1092145554 12:6212252-6212274 ATGAAGAAACAGGCTCCGAGAGG - Intronic
1092370185 12:7910413-7910435 ATGGATAAACAGGCTGGGCGCGG + Intergenic
1095704995 12:45227477-45227499 CTGAAGAAACAGGCTCAGAGAGG - Intronic
1096194198 12:49638770-49638792 ATGAGGAAACAGGGTCAGAAAGG - Exonic
1096403960 12:51329360-51329382 AGGGAAAAACAGGTTCAGAAAGG - Intronic
1096834935 12:54344087-54344109 ATGTAGAAAATGGCTCAGCTTGG + Intronic
1097880409 12:64681403-64681425 ATGAGGGAACAGGCTCAGAAAGG + Intronic
1098655621 12:73026032-73026054 AAACGGAAACAGGCTCAGCAAGG - Intergenic
1098862135 12:75722054-75722076 ATATAGAAACAGGCTCGGAAAGG + Intergenic
1099664768 12:85613877-85613899 ATGGAGGAACAGTGTCACCATGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100657167 12:96659592-96659614 ATGGAGAAATAGACTCATGAAGG + Intronic
1101041412 12:100759737-100759759 ATGGGGAAACGGGCTCAAAATGG - Intronic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101467669 12:104964299-104964321 GTGGAGAAAAACTCTCAGCAGGG - Intergenic
1101608460 12:106268438-106268460 ATGGAGAAATAGGAACAGAAAGG + Intronic
1101625810 12:106440174-106440196 ATAGAGAAAAAGGGTCAGGACGG - Intronic
1101775033 12:107785924-107785946 ATTCAGAAACAGGCCAAGCATGG - Intergenic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101846668 12:108368358-108368380 ATGGAGAAACAGGCCCAGAAGGG + Intergenic
1102035029 12:109766160-109766182 GTGGGAAAACAGGCTCAGCTGGG + Intronic
1102442049 12:112970976-112970998 AGAGAGAAACAGGCTGAGCACGG - Exonic
1102522494 12:113487347-113487369 AAGGAACAACAGGCTCAGAAGGG - Intergenic
1102570555 12:113824736-113824758 TTGAAGAAACAGGCTCAGAGAGG - Intronic
1102746865 12:115256610-115256632 ATGCAAAAACAGGTTGAGCAGGG + Intergenic
1103040105 12:117687914-117687936 CTGGAGACCCAGGCTCAGAAAGG - Intronic
1103181408 12:118915117-118915139 AAGAAGAAACAGGCTCTGAAAGG + Intergenic
1103744774 12:123115048-123115070 ATGGAGACCCAGCCTCAGAAGGG - Intronic
1104047506 12:125173547-125173569 ATGGAGCAGCAAGCACAGCATGG - Intergenic
1104360919 12:128132482-128132504 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG + Intronic
1105260432 13:18775247-18775269 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105262637 13:18791101-18791123 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105311944 13:19219927-19219949 ATGAAGAAACGTGCTCAGAAAGG - Intergenic
1105494128 13:20915611-20915633 ATGGACAAAGGGGCTGAGCACGG + Intergenic
1106150307 13:27094211-27094233 GTGGAGAAACTGGCCCAGCACGG + Intronic
1106193472 13:27474139-27474161 ATGAAGAAACAGGCCCAGACAGG + Intergenic
1106373044 13:29155544-29155566 ATGAAGAGGCAGGCTCAGGATGG + Intronic
1108379773 13:49844635-49844657 ATGTAGAAACAGGCTCACAGAGG - Intergenic
1108393899 13:49974432-49974454 ATGGAGAAACAGGCCGGGTACGG - Intergenic
1109761162 13:66831091-66831113 ATAGAGAATCAGGCTCTCCATGG + Intronic
1110568275 13:76977920-76977942 ATGCAGATACAGGCTGGGCATGG + Intergenic
1112086628 13:96038992-96039014 ATGGAGAGACAGGCATAGGATGG + Intronic
1112461594 13:99607633-99607655 ATGAAAAAACAGGGTCAGAAAGG + Intronic
1112497504 13:99916370-99916392 ATGGAGAAGTAGGCTCATCGGGG - Intergenic
1112826362 13:103397155-103397177 ATGGTGAAACAGGCACAGAATGG + Intergenic
1114535305 14:23418676-23418698 AGAGGGAAACAGGCTCAGAAAGG + Intronic
1115631173 14:35247044-35247066 ATGATGAAACAGGCTCAGAGAGG + Intronic
1115976751 14:39005269-39005291 TTCTAGAAACAGGCTCAGGAGGG - Intergenic
1117019094 14:51550822-51550844 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1117505675 14:56400553-56400575 CTGGAAAAACAAGCTCAGCAAGG + Intergenic
1118561214 14:67085571-67085593 CCAAAGAAACAGGCTCAGCATGG - Intronic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1118671405 14:68132009-68132031 AGGAAGAATCAGGCTCAGAAAGG + Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119726605 14:76925212-76925234 ATGAAGACACAGCCTCAGAAAGG - Intergenic
1119859913 14:77928748-77928770 ATGCAAAAACAGGCTGGGCACGG - Intronic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1121495480 14:94389047-94389069 ATGAGGAAACAGGCTCAGAGCGG + Intronic
1121745109 14:96282680-96282702 TTGGACAAACAGCCTCTGCAGGG + Exonic
1121808272 14:96852433-96852455 AAGGAGAAACAGTCACAGGAAGG + Intronic
1121813007 14:96907939-96907961 ATGGAGAAAAAGGCACATCATGG + Intronic
1121942654 14:98087547-98087569 ATTGAGAAACAGGCTTTACAAGG - Intergenic
1122045205 14:99018009-99018031 ATGAGGAAACAGGCTCAGCAAGG - Intergenic
1122229716 14:100299716-100299738 CAGGAGAAACAGGCTCAGTGAGG + Intronic
1124490891 15:30154559-30154581 ATGGGGAAACAGGTTCAGAGAGG + Intergenic
1124625867 15:31307199-31307221 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1124752642 15:32383772-32383794 ATGGGGAAACAGGTTCAGAGAGG - Intergenic
1125577291 15:40764363-40764385 GTGGAGAAGCGGGCTCAGCTCGG + Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126407619 15:48337433-48337455 ATGAGGAAACAGGCTCAGAAAGG - Intronic
1126644868 15:50865437-50865459 ATGAAGAAACAGCCTCATAAAGG + Intergenic
1127267844 15:57376089-57376111 AGGGGGAAAAAGGCTAAGCAGGG + Intronic
1127317036 15:57806814-57806836 AAGGAGAAACAGACTCATAAAGG - Intergenic
1127764149 15:62168300-62168322 ATGCAGAAACAGGCTCACAAAGG + Intergenic
1127772729 15:62244081-62244103 ATGGGGAGTCAGGCTCATCATGG + Intergenic
1128252489 15:66172802-66172824 ATGAGGAAACAGGCTCAGACAGG + Intronic
1128576879 15:68782360-68782382 ATGAAGAAATAGGCTCAGAAAGG + Intronic
1128705869 15:69837095-69837117 ATGGAGACTGAGGCTCAGAAAGG + Intergenic
1128907211 15:71477792-71477814 AAGGAGAAGCAGGTTCAGCATGG - Intronic
1128937476 15:71759380-71759402 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1129713380 15:77832944-77832966 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1129852061 15:78798996-78799018 ATGAGGAAACAGGCTCAGAGGGG - Intronic
1130250942 15:82300091-82300113 ATGAGGAAACAGGCTCAGAGGGG + Intergenic
1130551894 15:84894796-84894818 ATGAGGAAACAGGCTCAGTGAGG + Intronic
1130649817 15:85756156-85756178 CTGAGGAAACATGCTCAGCATGG - Intergenic
1131002387 15:88949311-88949333 ATGGGGAAACAAGCTCATCCAGG + Intergenic
1131758509 15:95593358-95593380 CTGGAGAAAAATGTTCAGCAAGG + Intergenic
1131864010 15:96687533-96687555 ATGAGGAAACAGGCTCAGGGAGG + Intergenic
1132001979 15:98189842-98189864 ATAGGGAAACAGACTTAGCAAGG + Intergenic
1132153339 15:99477609-99477631 TTGAAGAAACAGGCTCAGGGAGG + Intergenic
1133013132 16:2925721-2925743 ATGGAGGAACAGGCTGGGCCGGG + Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133398854 16:5470095-5470117 AAAGGGAAACAGACTCAGCAGGG + Intergenic
1133901333 16:9978063-9978085 ATGGAAGAAAAGGCTCAGAAAGG - Intronic
1134572425 16:15302668-15302690 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1134729957 16:16453373-16453395 GTGAAGAAACAGGCTCAGAGAGG + Intergenic
1134937476 16:18258527-18258549 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1135074763 16:19383639-19383661 ATGAGAAAACAGGCTCAGAAAGG - Intergenic
1135323861 16:21513645-21513667 AGCCAGAAACAGGCTCGGCAGGG + Intergenic
1135351348 16:21731813-21731835 ATGGTCACACATGCTCAGCAGGG + Intronic
1135449831 16:22547939-22547961 ATGGTCACACATGCTCAGCAGGG + Intergenic
1135748428 16:25036973-25036995 AAGGAGAAATGGGCACAGCATGG - Intergenic
1136063452 16:27742614-27742636 AGGAGGAAACAGGCTCAGCAGGG - Intronic
1136071277 16:27788841-27788863 ATGAGGAAACAGGCACAGAAAGG + Exonic
1136363315 16:29795978-29796000 ATGGAGGTACAGGCTGGGCAGGG + Intronic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1136518328 16:30781189-30781211 ATGGAGGAAGATGCTCAGCTGGG - Exonic
1137269845 16:46896044-46896066 GAGGAAAAACGGGCTCAGCAAGG - Intronic
1138005739 16:53335377-53335399 ATGAATAAACAAGCTTAGCAAGG + Intergenic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138498161 16:57421316-57421338 ATGGAGAAATAGGCTCAGGCAGG - Intergenic
1138811510 16:60156133-60156155 AGGGAGGAATAGGCACAGCACGG + Intergenic
1138879035 16:60988468-60988490 ATGAAGAACCAGGCCCGGCACGG + Intergenic
1139278569 16:65750267-65750289 ATGAGGAAACAGGCCCAGCAAGG + Intergenic
1139528379 16:67529838-67529860 ATGCAGAAACAGGCCCAGAGAGG + Exonic
1140525747 16:75621454-75621476 ATGAGGAAACAGACCCAGCAAGG - Intronic
1141000450 16:80302666-80302688 ATGGACAAGCAGGCTGGGCATGG - Intergenic
1141191648 16:81829397-81829419 ATGGTGAAACTGGCTAGGCACGG - Intronic
1141290759 16:82716287-82716309 ATGGAAAAGCAGGCTCGGGATGG - Intronic
1141760171 16:86023031-86023053 ATGAGGAAACAGGCTCAGATAGG + Intergenic
1141768625 16:86075039-86075061 ATGGAGAAACAGGCCCAGGGTGG - Intergenic
1141990526 16:87606597-87606619 ATGAAGAAACAAGCTCAGAGAGG - Intronic
1142001721 16:87668132-87668154 AAGGAGGAACAGGCTCAGGCAGG - Intronic
1142150290 16:88509658-88509680 GTGGAGAAACAGGCCCAGGGAGG + Intronic
1142326125 16:89415853-89415875 ATGGAGAACCAGCCTCAGTGAGG + Intronic
1143295053 17:5864799-5864821 GTGCAGATACAGGATCAGCATGG - Intronic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143554800 17:7653345-7653367 AGGAGGAAACAGGGTCAGCAGGG - Intronic
1144583808 17:16475754-16475776 TTGTAGAAACGGGCTGAGCACGG + Intronic
1144753018 17:17663103-17663125 AGGGGGAAACAGGCTGAGAAAGG + Intergenic
1144822078 17:18082292-18082314 ATGTAGAAACAGGCTCAGAGAGG + Intergenic
1144962195 17:19051078-19051100 ATGAAGAAACAGGCCAGGCATGG + Intergenic
1144972966 17:19123442-19123464 ATGAAGAAACAGGCCAGGCATGG - Intergenic
1146287168 17:31581796-31581818 ATGAGGCAACAGGCTCAGCAGGG - Intergenic
1146610243 17:34298653-34298675 AGGAAGAAAAAGGCTGAGCATGG - Intergenic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1147846186 17:43405437-43405459 ATGAAGAAACTGGCTGGGCACGG + Intergenic
1147976746 17:44252371-44252393 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1148049633 17:44763282-44763304 ATGGAGAAACAGGCACAGAGAGG + Intronic
1149344767 17:55723600-55723622 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1149575079 17:57706095-57706117 GTGGAAGAGCAGGCTCAGCAGGG - Intergenic
1150218030 17:63481032-63481054 ATGAAGAAGCAGGCACAGCCAGG + Intergenic
1150225336 17:63521718-63521740 ATAGACAAGGAGGCTCAGCAAGG - Intronic
1150655962 17:67039843-67039865 AGCAAGAAACAGGCTCAGAAAGG + Intergenic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1151759655 17:76093369-76093391 TTGGAGAAACAGGCAGAGCAGGG - Intronic
1151916456 17:77121713-77121735 ATGAGGAAACGGGCTCAGAATGG + Intronic
1152036213 17:77874712-77874734 AAGAGGAAACAGGCTCAGGATGG - Intergenic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1152218381 17:79047580-79047602 ATGGCAAAACAGGCTCAGCAGGG + Exonic
1152293257 17:79452763-79452785 GTGGAGAAGCAGGCCCGGCAGGG + Intronic
1153247711 18:3089737-3089759 ATGAAGAAATAGGCTTAGGAAGG + Intronic
1153923174 18:9809144-9809166 AGGTAAAAACAGGCTCAGGATGG - Intronic
1154073141 18:11173509-11173531 ATAGAGAAAAAGGCTGGGCACGG + Intergenic
1154425587 18:14269548-14269570 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428321 18:14289133-14289155 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428803 18:14292607-14292629 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154431083 18:14308952-14308974 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433279 18:14324789-14324811 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433753 18:14328261-14328283 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1156675739 18:39525185-39525207 ATGGAGAAAGAGGCTTCTCAAGG - Intergenic
1157155927 18:45266041-45266063 AAGGAGAATCAGGCTCACCAGGG + Intronic
1157655262 18:49380746-49380768 ATGAAGAGACAGGCTCAGAAAGG + Intronic
1160137415 18:76284225-76284247 GTGGAGGAACAGGCACACCAAGG + Intergenic
1160162476 18:76484168-76484190 ATGGAGAAAAAGGCTAAGCTGGG + Intronic
1160293558 18:77617230-77617252 AAGGGGAGACAGGATCAGCAAGG + Intergenic
1160578912 18:79872741-79872763 GTGAGGAAACAGGCTCAGAATGG - Intronic
1160928810 19:1560111-1560133 GTGAAGAAACAGGCATAGCAAGG - Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1162757627 19:12869729-12869751 ATGAAGAAACAGTCTCGGCCAGG - Intronic
1162796611 19:13090542-13090564 CTGGGGAGACAGGCTCAGCTGGG - Intronic
1163597497 19:18228701-18228723 ATGGAGAAAGAGTCACAGCAAGG + Intronic
1163785187 19:19271295-19271317 AGGAAGAAACAGCCTGAGCAAGG - Intronic
1166288945 19:41849434-41849456 ATAGAAAAACAGGCTCAGAGAGG - Intronic
1166351738 19:42202050-42202072 ATGGGGAAACAGGCTCAGAGAGG - Intronic
1166763675 19:45239857-45239879 GTGGAGAAACAGGCTGAGAGGGG + Intronic
1166867676 19:45850527-45850549 AAAGGGAAACAGGCTCAGAATGG - Intronic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
1168307670 19:55444196-55444218 AGGGAGATACAGGCTGAGAAAGG + Intergenic
1168679380 19:58303116-58303138 AAGAAGAAACAGGCTAGGCAAGG + Intronic
925881915 2:8359871-8359893 CTGGAGAATCAGGCACAGGATGG + Intergenic
926046718 2:9715399-9715421 TTGGAGAAACAGACTCAACAAGG - Intergenic
927815323 2:26210718-26210740 ATGGAGAAAAAGTCTCAACTTGG + Intronic
928309478 2:30197625-30197647 CTGGAGAAACTGGCTCAGGCAGG + Intergenic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
928644037 2:33332978-33333000 TGGGAGAGAGAGGCTCAGCAAGG + Intronic
929046770 2:37798192-37798214 GTGGAGAAACAGGCACAGACAGG - Intergenic
929870166 2:45752549-45752571 ATGAGGAAACAGGCTCAGAGAGG - Intronic
929943034 2:46349275-46349297 ATGGACAGCCAGGCTCAGGAGGG - Intronic
930755826 2:54970996-54971018 AAGGGGAAAAAGGCTCAGGAAGG + Exonic
931173227 2:59827110-59827132 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
931215513 2:60238823-60238845 ATCAAGATACAGGCCCAGCATGG - Intergenic
932823830 2:74922790-74922812 ATGAGGAAACAGGCTCAAAAAGG + Intergenic
933512710 2:83261725-83261747 GTGGAGAAACAAGCTCTGCTGGG + Intergenic
933588975 2:84210668-84210690 ATGAAGAAACAGGCACAGAGAGG - Intergenic
933853285 2:86388496-86388518 ATTTAAAAACAGGCTAAGCATGG - Intergenic
935183172 2:100707836-100707858 ACGGCAAAATAGGCTCAGCAGGG + Intergenic
935853486 2:107248888-107248910 AGAGAGAAACATGCTCATCAGGG - Intergenic
936742988 2:115537367-115537389 AAGTAGAAATAGGCTTAGCATGG + Intronic
937086614 2:119176011-119176033 ATGGAGAATTAGGGCCAGCATGG - Intergenic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
937885690 2:126898685-126898707 TTGGAGTCACATGCTCAGCAGGG - Intergenic
937962118 2:127468097-127468119 TTGAAGAAGCAGGCTCAGAAAGG - Intronic
938214023 2:129492870-129492892 AGGGAGCAAAAGGCCCAGCATGG + Intergenic
939378859 2:141407999-141408021 ATCCAGAAAGAGGCTCAGCCTGG + Intronic
941530845 2:166668889-166668911 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
942242471 2:173975691-173975713 ATCAAGAAGCAGGCTAAGCATGG + Intergenic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
943177281 2:184492901-184492923 ATAGAGAAACAGGCCAGGCATGG + Intergenic
944669706 2:201984737-201984759 ATTAGGAAACAGGCCCAGCAAGG + Intergenic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
945130168 2:206562746-206562768 TTGGAGAAAAAGGCTTTGCAAGG + Intronic
945464473 2:210151645-210151667 AAGAAGAAACAGACTCAGCATGG - Intronic
946106774 2:217377495-217377517 ATGGAGAAAAAAGCAAAGCAGGG + Intronic
946153665 2:217793056-217793078 ATGTGGAAACAAGCACAGCAGGG + Intergenic
946245406 2:218384433-218384455 TTGGAGAAACATGGCCAGCAGGG - Intronic
946571472 2:221028622-221028644 CTGGACAAAAGGGCTCAGCAAGG - Intergenic
947768409 2:232652035-232652057 ATGGAGAAACAGGCCCACCAAGG - Intronic
947835739 2:233173971-233173993 AGGCTGAAACAGGCTCAGGATGG + Intronic
948452332 2:238083824-238083846 AGAGAGAAACAGGAACAGCATGG + Intronic
948880891 2:240856616-240856638 ATGCAGCAGCAGGCTCAGCATGG + Intergenic
948988514 2:241540352-241540374 GAGGAGAAACAGGCCCAGCGAGG - Intergenic
949081272 2:242101818-242101840 ATAAAGAAACAGGCTGGGCACGG - Intergenic
1168731134 20:82027-82049 AAGGAGAAATAGGCTGGGCATGG + Intergenic
1168749676 20:273583-273605 ATGCAGAATCAGGCTGGGCATGG + Intronic
1169294485 20:4381980-4382002 ATGGGAAAACAGGCTGAGAATGG - Intergenic
1169557855 20:6768623-6768645 ATGGCGAAGCAGGCTCCGCTGGG - Exonic
1170543261 20:17410196-17410218 ATAAGGAAACAGGCTCAGAAGGG + Intronic
1170586680 20:17740062-17740084 GAGGAGACAGAGGCTCAGCAAGG - Intergenic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1171040631 20:21759186-21759208 AGAAGGAAACAGGCTCAGCATGG - Intergenic
1171400637 20:24871225-24871247 ATGCAGGGACAGGCTGAGCATGG + Intergenic
1172004145 20:31806171-31806193 AGGAAGAAACAGTCTCTGCAAGG - Intergenic
1172024062 20:31935983-31936005 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1172527864 20:35611379-35611401 ATGGAGAAATAGGCAGAACAGGG - Intergenic
1172610701 20:36249725-36249747 ATGAGGAAGCAGGCTCAGGAAGG + Intronic
1172963148 20:38812916-38812938 ATGCAGAAACTGACTCAGTAGGG + Intronic
1173542387 20:43863860-43863882 ATGAGGAAACAAGCTCAGAAAGG - Intergenic
1173565329 20:44034466-44034488 ATGGAGTACCAGGAGCAGCATGG + Intronic
1173613861 20:44390215-44390237 ATGGAGAAACACGCTCAGAAAGG + Intronic
1173671186 20:44800006-44800028 ATGAGGAAACAGGCTCAGGGAGG + Intronic
1173868087 20:46325529-46325551 ATGAAGAAACATGCTCAGAGAGG - Intergenic
1173943281 20:46930375-46930397 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1174057614 20:47809549-47809571 CTGGGGAAACAGGCTCAGGGAGG + Intergenic
1174145994 20:48453043-48453065 ACGCAGAAACAGGCCCAGAAAGG + Intergenic
1174298469 20:49565734-49565756 AGGAGGAAACAGGCTCAGAAAGG - Intronic
1174307280 20:49622649-49622671 ATGAGGAAACATGCTCAGCAAGG - Intergenic
1174462686 20:50694010-50694032 AGAAAGAAACAGGCTGAGCATGG + Intergenic
1174526468 20:51175940-51175962 ATGGAGATTCTGGTTCAGCAGGG - Intergenic
1175987404 20:62770848-62770870 ATGGGGAAACAGGCTGGGAAAGG + Intergenic
1176261691 20:64185267-64185289 ATGGACAAGCTGGCTCAGCAGGG + Intronic
1176843280 21:13857483-13857505 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176843768 21:13860968-13860990 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176846444 21:13880288-13880310 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176848699 21:13896360-13896382 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1178582964 21:33851277-33851299 ATGGAGACCCAGCCTCAGGAGGG + Intronic
1181116053 22:20633100-20633122 CTGGAGAAACAGGCCAGGCAAGG + Intergenic
1181631731 22:24155259-24155281 GATGAGAAACAGGCTCAGGAGGG - Intronic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1181937282 22:26447997-26448019 ATGAGGAAACAGGCTCAGAGCGG + Intronic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182438145 22:30344499-30344521 AAGCAGAAACAGGCTCAGAAAGG - Intronic
1182857478 22:33530713-33530735 CTGGAGACTCAGGCTCTGCAGGG - Intronic
1183207661 22:36430848-36430870 TTGAAGAAACTGGCTGAGCACGG - Intergenic
1183221273 22:36515007-36515029 AAGGAGAAGCAGGCACATCATGG - Intronic
1183321628 22:37168521-37168543 ATGCAGAAACAGGCTCAGAGAGG - Intronic
1183902522 22:41017269-41017291 ATGCAGAAGCAGGCTGGGCACGG - Intergenic
1184095470 22:42314081-42314103 AGGCAGATACAGGCTCAGCAGGG + Intronic
1184232573 22:43166573-43166595 CTGGAGCCACAGGCTCAGCCTGG - Intergenic
1184391100 22:44204133-44204155 AAGAAGAAACAGGCTAGGCACGG - Intronic
1184410612 22:44323982-44324004 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1184444117 22:44537259-44537281 ATGAGGAAACAGGCTCAGAGGGG + Intergenic
1184569838 22:45315602-45315624 ATGGAGAAACAGGTTTAGAGAGG + Intronic
1184933797 22:47703519-47703541 ATGGAGACTCAGGCTGTGCATGG - Intergenic
1185235068 22:49707558-49707580 CTGGAGAAGCTGGCCCAGCAGGG - Intergenic
950185650 3:10943829-10943851 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
950458591 3:13107481-13107503 ATGGAGAAACAGGCTCAGAGCGG + Intergenic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
951429415 3:22588810-22588832 ATGGAAACCCAGGGTCAGCATGG + Intergenic
952515728 3:34103361-34103383 ATGAGGAAACAGCCTCAGAAAGG - Intergenic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
953957646 3:47244145-47244167 ATGCAGAAACAGGCACAGAGCGG + Intronic
953961948 3:47273312-47273334 ATGAGGAAACAGGCTCAGTGTGG + Intronic
954085834 3:48243156-48243178 ATGTAAAAACTGGCCCAGCATGG + Intronic
954460973 3:50626746-50626768 ATGCAGAGACAGGTTCAGAAAGG + Intronic
954792351 3:53142776-53142798 ATGGGGAAACAGGCTCTGCAGGG - Intergenic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955209250 3:56925661-56925683 ATGAGGAAAGAGGCTCAGAAGGG + Intronic
956302239 3:67784831-67784853 ATGAGGAAACAGGCTTAGAAAGG + Intergenic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956687061 3:71839892-71839914 ATAGAGAAACAGGCTTAGAGAGG + Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959751002 3:109834962-109834984 ATGAAGAAACAGGCTTAGAGAGG + Intergenic
960579556 3:119264582-119264604 AAGAAGAAATAGGCTGAGCACGG + Intergenic
960701288 3:120441854-120441876 ATGGGGAAACAGGCTCAGAGAGG + Intronic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961457131 3:127029803-127029825 ATGGGGAAACAGGCTCGGGCGGG + Intronic
961661680 3:128472168-128472190 ATGGAGGAGCAGCCCCAGCATGG + Intergenic
961827020 3:129604443-129604465 ATGAAGAAACAGGCACAGAGAGG - Intronic
962088430 3:132217204-132217226 AGAGAGGAACATGCTCAGCAGGG + Intronic
962451857 3:135525950-135525972 TCTGAGAAACAGGCTCAGAAAGG - Intergenic
962803708 3:138911947-138911969 CTGGAGAAACAGGCACATTAAGG - Intergenic
962851936 3:139314418-139314440 AAGGGGAGAAAGGCTCAGCAAGG + Intronic
962859112 3:139381163-139381185 ATAAATAAAGAGGCTCAGCATGG + Intronic
963092109 3:141492575-141492597 AAGGAAATACGGGCTCAGCAAGG - Intronic
964204464 3:154157442-154157464 ATGGTGAAAATGCCTCAGCAGGG - Intronic
964419090 3:156482461-156482483 ATGGAGAAACAAACTAATCATGG + Intronic
964478913 3:157122744-157122766 ATGAGAAAACAGGCTCAGAAGGG + Intergenic
964672881 3:159246455-159246477 GAGGAAAAACAGGCTCAGCGAGG + Intronic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
964961718 3:162436190-162436212 TTGGAGAAACAGGGCCAGGAAGG + Intergenic
965648091 3:170905800-170905822 ATGAGAAAACAGGCTCAGAAAGG + Intronic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
966660998 3:182414807-182414829 ATGGAGAAACAGACCCAGTTTGG + Intergenic
967789073 3:193527827-193527849 ATGGACAAACAGGCCCAGACAGG - Intronic
967980773 3:195063896-195063918 ATGAAGAAACAGGCCCAGAGAGG + Intergenic
968077094 3:195821969-195821991 ATGGAGACTGAGGCTCAGCTAGG - Intergenic
968236108 3:197030611-197030633 AAGGAGAAACAGGCGGAGAAGGG + Intergenic
968580370 4:1388344-1388366 ATGAATAAACAAGTTCAGCAAGG - Intergenic
968631045 4:1651712-1651734 AGGGACACGCAGGCTCAGCAAGG + Intronic
968631055 4:1651752-1651774 AGGGACACACAGGCTCAGCAAGG + Intronic
968631066 4:1651792-1651814 AGGGACACGCAGGCTCAGCAAGG + Intronic
968729065 4:2261341-2261363 CTGGGGAAACAGGCTCAGCCAGG - Intronic
968812853 4:2807940-2807962 AGGGAGAGACAGGCTCCACAAGG - Intronic
969212903 4:5701422-5701444 AGGGAGAAAGGGGCTCACCATGG - Intronic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
970375505 4:15452981-15453003 ATTGAGAAATAGCCTCAACATGG + Intergenic
971570646 4:28206347-28206369 AAGTAGAAAGAGGCTAAGCATGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972428408 4:38956794-38956816 ATGGGGAAGCAGGCGCAGTAGGG - Intergenic
973570967 4:52239310-52239332 ATGAAGAAACCAGCACAGCAAGG + Intergenic
973977631 4:56279108-56279130 ATGGGGAAACAGGCTCAAAGAGG + Intronic
974034619 4:56807033-56807055 AAGAAGAAACAGGCTGGGCACGG + Intergenic
975691815 4:76972910-76972932 ATGAGAAAACAGGCTCAGAAAGG + Intronic
975765387 4:77662227-77662249 ATGAAGAAACAGGATTCGCAAGG - Intergenic
977133092 4:93267443-93267465 ATGGAGAAAGAGGTGCAGCCTGG + Intronic
977172528 4:93780799-93780821 AGGGAGAAACAGGCTCTTAAAGG + Intergenic
977191996 4:94012540-94012562 ATGAGGACACAGGCTCAGCATGG + Intergenic
978202074 4:106033788-106033810 ATGGAAACTGAGGCTCAGCAAGG + Intergenic
978545269 4:109865184-109865206 ATGAGAAAACAGGCTCAGCAAGG + Intronic
979121088 4:116902670-116902692 ATAAAGAAACAGGTTCAACAAGG + Intergenic
979713627 4:123810404-123810426 ATAGGGAAACTGGCTCAGCCTGG - Intergenic
981546191 4:145896382-145896404 ATGGACAATCCAGCTCAGCAGGG + Intronic
982185402 4:152791974-152791996 ATGGATAAACAGGAACAGAATGG - Intronic
982230985 4:153207931-153207953 ATGGATAAGCATGATCAGCAAGG - Intronic
982364551 4:154560938-154560960 ATGGTGAAACAGGTTCAGAGAGG - Intergenic
983301737 4:165934303-165934325 ATGGAGAATGAGGCCAAGCATGG - Intronic
984081696 4:175255242-175255264 TTGCAGAAACAGGCCCACCAAGG + Intergenic
984632565 4:182076181-182076203 AAGGAGAAAGAGGCTGGGCATGG - Intergenic
984820826 4:183880277-183880299 ATGGATAAAGAAACTCAGCAGGG - Intronic
985238331 4:187901536-187901558 ATGGAGAAACTGGCTCTCCTAGG + Intergenic
986369605 5:7066930-7066952 ATGGAGAGACAGCGCCAGCAAGG + Intergenic
986492142 5:8304215-8304237 AAGGAGAAACAAGGTTAGCAAGG - Intergenic
986681829 5:10240541-10240563 ATGAGAAAACAGGCTCAGCAAGG - Intronic
987172023 5:15269125-15269147 ATGAAGAAACAGGCTAAGCAGGG + Intergenic
987431094 5:17834125-17834147 ATGGAGAAACATGCTATGAATGG - Intergenic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
990220850 5:53586811-53586833 AGGAAGAAACAGGCTGGGCACGG - Intronic
990446324 5:55897138-55897160 ATAAAGAAACAGGCTGGGCATGG - Intronic
990707568 5:58547102-58547124 ATGTAGAAACAGGCCCGGCGCGG + Intronic
991341457 5:65615190-65615212 ATAGAGAAATAGGCTGGGCACGG - Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992510241 5:77425633-77425655 ATGAAGAAATAGGCTCAGCAAGG - Intronic
992947758 5:81826100-81826122 ATGAGGACACAGGCTCAGGAGGG + Intergenic
993133663 5:83930127-83930149 ATGGAGAAAAATCCTCAACATGG + Intergenic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
993824921 5:92671612-92671634 ATGGAGGACAAGGCTCAGCTGGG + Intergenic
994603545 5:101938732-101938754 ATGGATAAACAGTCTTAGTAAGG - Intergenic
996439805 5:123477477-123477499 ATCGAGAAACAGGCCAAGAAGGG - Intergenic
996685175 5:126271989-126272011 ATGCTGAAACAGGCACAGCCTGG - Intergenic
997648019 5:135494018-135494040 TTTGAGAAACAGGCTCCACAGGG + Intergenic
997851603 5:137337962-137337984 ATAGAGAAACAGACTCAGGGAGG - Intronic
998229929 5:140354589-140354611 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
998423009 5:142004786-142004808 AGTGAGTAACAGGGTCAGCAGGG + Intronic
998742586 5:145221780-145221802 ATGGAGAAACAAGCACAGAGAGG - Intergenic
998930361 5:147174562-147174584 AAGAAGAAACAGGCTTAGAAAGG + Intergenic
999115481 5:149159883-149159905 ATGGAGAAACAGCATTTGCAAGG - Intronic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999665024 5:153904039-153904061 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
999689441 5:154134102-154134124 CTGGAGACCCAGGCTCAGCTGGG + Intronic
999696661 5:154193056-154193078 ATGGATAGACAGGCTCATCTGGG + Intronic
999704243 5:154256973-154256995 GTGTAGAAACAGGCTCGGCCAGG + Intronic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
999987251 5:157015630-157015652 ATTTAAAAACAGTCTCAGCATGG + Intergenic
1000017929 5:157294755-157294777 ATGGTAAAACAGCCTCAGCAGGG - Intronic
1000315551 5:160087084-160087106 ATGGAGACACTGGCCGAGCACGG + Intronic
1000383350 5:160648712-160648734 ATGTGGAAACAGGCTCAGAGAGG + Intronic
1000696612 5:164393610-164393632 ATGGGCAAAAAGGCCCAGCATGG - Intergenic
1001137762 5:169116718-169116740 AGGGAGAAACAGGCTAATCAGGG + Intronic
1001256407 5:170186811-170186833 ATGGAGAGATGGGCTCAGCGGGG - Intergenic
1001553855 5:172623069-172623091 ATTAAGAAACAGGCTCAGAGAGG - Intergenic
1001741022 5:174052725-174052747 GTGCAGAAACAGGCTCAGACAGG + Intronic
1001853062 5:174986131-174986153 ATGGTAAAACATGCTTAGCAGGG - Intergenic
1002281828 5:178135039-178135061 AAGGAGAAAAAGGCCCTGCATGG - Intronic
1002640165 5:180626959-180626981 ATGGGCAAACAGACACAGCAAGG - Intronic
1003239965 6:4336010-4336032 AGGGAGAAGGAGGGTCAGCATGG + Intergenic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1005184390 6:23148632-23148654 ATGGATAAATAGGCTAGGCATGG - Intergenic
1005286302 6:24330729-24330751 ATGGAGAAACAGGATCCACAGGG + Intronic
1005596435 6:27382827-27382849 ATTGAAAAGCAGGCTGAGCACGG + Intronic
1006428651 6:33981942-33981964 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1006811632 6:36824028-36824050 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1007110780 6:39312533-39312555 GTGAAGAAACAGGCTCAGAGAGG - Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007694729 6:43724998-43725020 GTGGGGAAACAGGCTCAGAGAGG + Intergenic
1008725201 6:54409069-54409091 ATGAAGAAACAGGCTCAACATGG + Intergenic
1010093785 6:72015389-72015411 ATTAATAAACAAGCTCAGCAAGG - Intronic
1010388340 6:75308397-75308419 ATGAGGAAACAGGCTCAGATGGG + Exonic
1011603244 6:89079317-89079339 CTGGGGAAACAGGCTTAGAAAGG - Intergenic
1012840636 6:104324994-104325016 ATGTAGAAACAGCCTCTGGATGG - Intergenic
1012919151 6:105203398-105203420 ATGGAGAAACAGGCTTAGAGTGG - Intergenic
1013609399 6:111779939-111779961 AAGAAGAAACAGGCTCAGAGAGG + Intronic
1013648831 6:112172815-112172837 ATGGAGATAAAGGCTCAGTGTGG + Intronic
1015073199 6:129122825-129122847 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1015170195 6:130243552-130243574 GTTAAGAAACAGGCTTAGCAAGG + Intronic
1015774375 6:136798780-136798802 ATGAAGAAACAGGTCCAGAAAGG - Intergenic
1016422133 6:143896562-143896584 ATAAGGAAACAGGTTCAGCAAGG - Intronic
1016581063 6:145629740-145629762 CTGGAGAGACAGGCACAGCAGGG - Intronic
1016682825 6:146850608-146850630 ATGGAAAGAAAGGCACAGCAGGG + Intergenic
1017761296 6:157571999-157572021 ATGCAGATTCTGGCTCAGCAGGG + Intronic
1018531026 6:164763522-164763544 ATGGCTAGACAGGCACAGCATGG - Intergenic
1019509159 7:1408645-1408667 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1020978468 7:15038004-15038026 ATGGATTAAAAGGCTCAGGAAGG - Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021601372 7:22367302-22367324 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1021800443 7:24300186-24300208 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1021974165 7:25995554-25995576 ATACAGAAACAGTCTCACCATGG + Intergenic
1022066280 7:26861349-26861371 ATGGAAAAACAGGTTTAGCCTGG - Intronic
1022202628 7:28132250-28132272 AGGGAGAACGAGGATCAGCAAGG + Intronic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1023127133 7:36965468-36965490 CTGGAGAAAATGGCTCAGTAAGG + Intronic
1023186096 7:37534695-37534717 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1024876656 7:54032608-54032630 ATGGAGCACCAGGCTCCTCAGGG - Intergenic
1025805637 7:64830611-64830633 ATGAAGATACAGGCTGGGCATGG - Intronic
1025834932 7:65085561-65085583 ATGGGGAAACGGGCTCAGAGAGG - Intergenic
1026836933 7:73645852-73645874 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
1026990526 7:74582617-74582639 ATGTGGAAACAGGCTCAGAGAGG + Intronic
1029115003 7:98232223-98232245 ATGGGGAGACAGGCTCGGGAGGG + Intronic
1029260355 7:99298109-99298131 ATGAGGAAACATGTTCAGCAAGG - Intergenic
1029843202 7:103387588-103387610 ATGCAGAAACAGGCTCTGAGAGG + Intronic
1030296532 7:107934467-107934489 AGGAAGAAACAGGCTCAGTTAGG + Intronic
1031074885 7:117202441-117202463 AAGGAGGAAGAGGCTTAGCAGGG - Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032960724 7:137030596-137030618 CTGGAGAAAGATACTCAGCATGG - Intergenic
1033179742 7:139164320-139164342 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1034077631 7:148247942-148247964 CTGAAGAAAGAGGCTGAGCATGG - Intronic
1035372435 7:158388023-158388045 CCAGAGAAACAGACTCAGCAGGG - Intronic
1036990334 8:13585271-13585293 ATGAAGAAATAGGCCTAGCATGG + Intergenic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038413683 8:27377587-27377609 AAGGAGACACTGGCTCAGAAAGG - Intronic
1039909256 8:41811120-41811142 ATAGAAAAACAAGCTAAGCATGG + Intronic
1039911380 8:41829412-41829434 ATGCAGAAAGAGGCTCAGAGAGG + Intronic
1041794261 8:61729536-61729558 ATGGAGAAACATGCTCAGAGAGG + Intergenic
1041915029 8:63130415-63130437 ATAGTGAAATAGGCTCTGCATGG + Intergenic
1042460211 8:69056874-69056896 ATGGTTCGACAGGCTCAGCATGG + Intergenic
1042892929 8:73633393-73633415 AGGGAGAGACAGGACCAGCAAGG + Intronic
1043975175 8:86577056-86577078 ATTGAGAAACAGACAGAGCAGGG - Intronic
1044481206 8:92691052-92691074 ATTATGAAACAGGCTAAGCAAGG - Intergenic
1044523320 8:93224386-93224408 ATGGAGGAAGCGGGTCAGCAGGG - Intergenic
1044803160 8:95977724-95977746 AGGAAGAAACAGGCTCAGAGAGG - Intergenic
1044857701 8:96493670-96493692 CCGGAGAAGCAGGCTCAGGAGGG + Exonic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1044938821 8:97319592-97319614 ATGAAGAAACAGGCCCAGTGAGG - Intergenic
1045061810 8:98417629-98417651 AGGGGGAAACAGGCACAGAAAGG - Intronic
1046031525 8:108787962-108787984 ATGTGGAAACAGGCTCAGAGAGG + Intergenic
1046154843 8:110274805-110274827 ACTGGGAAACAGGCTGAGCATGG + Intergenic
1046883567 8:119337606-119337628 ATTGAGAGACACACTCAGCATGG - Intergenic
1047995909 8:130335688-130335710 TGGGAGACACAGCCTCAGCAGGG - Intronic
1048470383 8:134699452-134699474 ATTAGGAAACGGGCTCAGCAGGG - Intronic
1048511973 8:135071290-135071312 ATGAAGAAATAGGATCAGAAAGG - Intergenic
1048747728 8:137633637-137633659 ATGGAGATACAGGCACTGAAAGG - Intergenic
1049048222 8:140169891-140169913 ATGCAGAAACTAGCTGAGCATGG - Intronic
1049265175 8:141664065-141664087 GTGGAGACCCAGGCCCAGCAGGG - Intergenic
1049414620 8:142489581-142489603 GTGGGGAAACAGGCTCAGAGAGG + Intronic
1049799405 8:144510800-144510822 CTGCAGACATAGGCTCAGCAAGG - Exonic
1049939666 9:533350-533372 ATGGAAAAACAGACTTAGAAAGG - Intronic
1051749715 9:20328443-20328465 ATAGAGAAAAAGTCTCAGCTGGG - Intergenic
1051901301 9:22044702-22044724 ATGGGGATACAGGCACAGGAAGG - Intergenic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1053153087 9:35755175-35755197 ATGAGGAAACAGGCTCAGAGAGG - Exonic
1053471994 9:38353192-38353214 ATGTGGAAACAGGCTCAGAGGGG - Intergenic
1053496110 9:38549293-38549315 ATGTAGAAGCAGGTTCAGAAGGG - Intronic
1053665650 9:40315683-40315705 ATGTAGAAGCAGGTTCAGAAGGG + Intronic
1053915233 9:42940730-42940752 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054376806 9:64455713-64455735 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054518964 9:66060601-66060623 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1054519394 9:66063548-66063570 ATGCAGGAACAGGTTCAGAAGGG - Intergenic
1055576119 9:77661654-77661676 GGGGACAAACAGGCTGAGCAAGG + Intergenic
1056069436 9:82970531-82970553 ATAAAGAAACAGGCTTAGCCGGG - Intergenic
1057258026 9:93566882-93566904 TTGGAGAAACTGGCTCGGCTCGG - Intergenic
1057479366 9:95432504-95432526 ATGGGGAAACAAGCTCAGGGGGG - Intergenic
1057676033 9:97136811-97136833 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1057817721 9:98307941-98307963 ATGGGGAACCAGGCTAGGCATGG + Intronic
1057900970 9:98947959-98947981 ATGGGAAAACAGGCTCAGAGTGG - Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058479786 9:105380154-105380176 ATGGAAAAACAGGCTCAGAATGG + Intronic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059352563 9:113676048-113676070 GTGGAGAAATAGGCTGGGCATGG + Intergenic
1059417749 9:114172412-114172434 CTACAAAAACAGGCTCAGCATGG - Intronic
1059431908 9:114255431-114255453 ATGGGGAGACAGGCCCAGGACGG - Intronic
1059439599 9:114299570-114299592 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1059513789 9:114874436-114874458 ATGGGAAAACAGACACAGCAAGG + Intergenic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1059691074 9:116686940-116686962 ATGGAAAAACAGATTCAGTAAGG + Intronic
1059727257 9:117021196-117021218 ATTTAAAAAAAGGCTCAGCATGG - Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1060276128 9:122184159-122184181 ATGAGGAAACAGGCTCAGTGGGG + Intronic
1060279260 9:122204951-122204973 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1060391549 9:123281766-123281788 ATAGAGAAACAGACTCAGTGGGG + Intergenic
1060444358 9:123674087-123674109 ATGGTGGTAGAGGCTCAGCATGG - Intronic
1060563461 9:124567883-124567905 AAAGAGAAACAGGCTGGGCACGG + Intronic
1060799986 9:126537837-126537859 ATAGAAAAACAGTCTCAGCTCGG - Intergenic
1060900977 9:127258012-127258034 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061106282 9:128533131-128533153 ATGATGAAACAGGCTGGGCATGG + Intronic
1061147536 9:128808676-128808698 ATGAGGAGACTGGCTCAGCAAGG + Exonic
1061485551 9:130918838-130918860 AGAGAGAAACAGACTCAGAAAGG - Intronic
1061684759 9:132266227-132266249 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1186000878 X:5009080-5009102 ATGGATAAGCAGGCTTGGCATGG + Intergenic
1186196724 X:7116535-7116557 ATGGTGAATGAGGCTGAGCAGGG - Intronic
1186202128 X:7165356-7165378 AAGGAGTAACAGGCTGGGCATGG + Intergenic
1187319590 X:18227755-18227777 AAGGGGAGACAGGCTGAGCATGG + Intergenic
1187626711 X:21122535-21122557 TTTGAGAAACAGGGTCATCAGGG - Intergenic
1187768447 X:22668926-22668948 ATGGAGAAATAAACTGAGCAAGG - Intergenic
1189141905 X:38616003-38616025 ATGCAGAAACAGGCCCAGAGAGG - Intronic
1191688971 X:63920703-63920725 ATGGGGAAACAGGATCAGACAGG - Intergenic
1191765051 X:64689204-64689226 ATAAAGAATCAGGCTCAGGAGGG + Intergenic
1192317625 X:70065464-70065486 ATGGACAAAGAGGCCCAGCTGGG + Intergenic
1192538113 X:71945901-71945923 TTGGGGAAACAGGCTCAGAGGGG + Intergenic
1192968307 X:76203203-76203225 ATGGAGACTCAGGATCATCAGGG - Intergenic
1193384455 X:80854285-80854307 ATGAAGAAAGAGGCTGGGCATGG - Intergenic
1193801122 X:85937544-85937566 ATGGAAAATCAGGCTGGGCATGG + Intronic
1194484309 X:94468861-94468883 ATAGAGAAACTGGAACAGCATGG + Intergenic
1195272162 X:103242685-103242707 CTGGAGAAAGAGGGTCAGGAGGG - Intergenic
1195385151 X:104307004-104307026 ATGGGAAAACAGGCTCAGAGTGG - Intergenic
1195510492 X:105710737-105710759 ATTTAGAAACAGGCTCAGATAGG - Intronic
1195601045 X:106749396-106749418 AGGGAAAAAGAGGCTCAACAAGG + Intronic
1195696432 X:107671049-107671071 ATGGAGACACAGGCATGGCAAGG + Intergenic
1195842434 X:109188895-109188917 AAGGTGAAACAGGCTAACCAAGG - Intergenic
1195845197 X:109220170-109220192 ATGCAGAATCAGGCTCAACTTGG + Intergenic
1196731717 X:118947582-118947604 ATGGAGAATCAGGCTGGGCATGG + Intergenic
1197067284 X:122248499-122248521 TTGGACAAACAGGCTAAGCATGG - Intergenic
1197273748 X:124453976-124453998 ATGGAGAAAAAAACTCAGCCCGG - Intronic
1197593479 X:128438735-128438757 TTGGAAAAAAATGCTCAGCAAGG + Intergenic
1197735437 X:129847380-129847402 ATGAAGAAATAGTCTCAGAAAGG - Intergenic
1197962435 X:132022018-132022040 ATGAAGAAAAAGGCTCAACCAGG - Intergenic
1198056302 X:132998915-132998937 GTGAAGAAACAGGCCCAGAAAGG + Intergenic
1198641878 X:138765112-138765134 ATGAAGAAAGAGGCTCAGTGAGG - Intronic
1198715182 X:139551111-139551133 CAGGAAAAACAGTCTCAGCACGG - Exonic
1199967599 X:152832751-152832773 AATGAGAAACAGGCTCAGAGAGG - Intronic
1200749785 Y:6934299-6934321 AAGGAGAAAAAGGCCCAGCCAGG - Intronic
1201722797 Y:17120099-17120121 ATGGATAAACAGTCTCAATAGGG - Intergenic