ID: 1162532842

View in Genome Browser
Species Human (GRCh38)
Location 19:11245763-11245785
Sequence CCCCTTCCTTCTCCTTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 387}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162532842_1162532848 -5 Left 1162532842 19:11245763-11245785 CCCCAACAAGGAGAAGGAAGGGG 0: 1
1: 0
2: 3
3: 35
4: 387
Right 1162532848 19:11245781-11245803 AGGGGAGGAAAGAGAAAAAAGGG 0: 1
1: 3
2: 39
3: 444
4: 3196
1162532842_1162532847 -6 Left 1162532842 19:11245763-11245785 CCCCAACAAGGAGAAGGAAGGGG 0: 1
1: 0
2: 3
3: 35
4: 387
Right 1162532847 19:11245780-11245802 AAGGGGAGGAAAGAGAAAAAAGG 0: 1
1: 5
2: 40
3: 478
4: 3103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162532842 Original CRISPR CCCCTTCCTTCTCCTTGTTG GGG (reversed) Intronic
901664100 1:10816794-10816816 ACCCTTCCTTGTCCATGGTGGGG + Intergenic
902100807 1:13987051-13987073 CCCCTGCCTTTTACCTGTTGTGG + Intergenic
902577487 1:17387441-17387463 CCCCCTCCTTTTCTTTTTTGAGG - Intronic
904571787 1:31471478-31471500 CCGCTTCCCTCCCCTTGTTCAGG - Intergenic
904774321 1:32897307-32897329 TCCCTGCCTTCTCCTGGCTGAGG - Intronic
904972537 1:34430372-34430394 CTCCTGCCTTCTCCCTGATGGGG + Intergenic
905357437 1:37394676-37394698 CCTCTTCATGCTCCTTGCTGGGG - Intergenic
905874236 1:41422209-41422231 CACCTTCCTTCTCCTCCTGGGGG - Intergenic
906421918 1:45676068-45676090 CCCTTGAGTTCTCCTTGTTGAGG - Intronic
907480567 1:54743113-54743135 CTCCTTCCTACTCCTGGTTTTGG + Intergenic
908964047 1:69736758-69736780 TCTCTTCTTTCTCCGTGTTGAGG + Intronic
909794929 1:79721323-79721345 TTCCTTCCTTCTGCTTGATGTGG - Intergenic
910675834 1:89815730-89815752 CCACTTCTTTCTTCTTTTTGTGG + Intronic
911682091 1:100728600-100728622 CCCCCTCCTTTTTCTTCTTGAGG - Intronic
911783363 1:101912033-101912055 CCCCCTTCTTCTCCTGGCTGAGG - Intronic
913152857 1:116062789-116062811 GCCATTCCTTGTCCTTGCTGGGG + Exonic
914744575 1:150492394-150492416 CCTCTTCTTTCTCCTAGGTGTGG + Exonic
914847814 1:151292523-151292545 GGCCTTTCTTCTCCTTGTAGGGG - Exonic
915450240 1:155999931-155999953 TCCCTTTCTTCTCCTTGAAGAGG - Intronic
915597493 1:156903944-156903966 TCCCCTCCTTCTCCTGGCTGTGG + Exonic
916192946 1:162196920-162196942 CCCATTCCTTCTGCTGGTTCAGG + Intronic
916339768 1:163718934-163718956 ACCCTTCCTTCTGTTTGTTGTGG + Intergenic
917683422 1:177391599-177391621 TCCCCTCCTCTTCCTTGTTGGGG - Intergenic
917881778 1:179344186-179344208 CCCCTTCCTTCCTGTTTTTGGGG + Intronic
919003081 1:191860069-191860091 CCCCTTCCTTCCACTTGAGGAGG + Intergenic
920079640 1:203362982-203363004 CCCATTCCTTCTCATTTTAGAGG + Intergenic
920414397 1:205788992-205789014 CCCCTTTCTACTCCTAATTGAGG + Intergenic
921284331 1:213595447-213595469 TCCATTTCTTCTCATTGTTGTGG + Intergenic
922859471 1:228803772-228803794 CTCCTGCCTCCTCCTTGATGCGG + Intergenic
922965780 1:229689687-229689709 CTCCTTCCTCCTCCTTGGTGAGG + Intergenic
923083062 1:230678540-230678562 CTCCTTCTTTCTCCTTTGTGAGG + Intronic
923519063 1:234722070-234722092 CACCTTCCTTTTCCTTCTTTGGG + Intergenic
923861783 1:237898924-237898946 TCCCTTCCTTCCCCCTGCTGTGG + Intergenic
924260980 1:242231231-242231253 CCTCTTCCTCCTCCCTGTTGAGG + Intronic
924771932 1:247087026-247087048 CTCCTTCCTTCTTGTTGCTGAGG - Intergenic
1062966921 10:1614979-1615001 GCTCTTTCTTCTCATTGTTGGGG + Intronic
1063665571 10:8058470-8058492 CCTCGTCCTCCTCCTTGTCGGGG + Exonic
1064191361 10:13208691-13208713 CCCCTTCCTCCTCTTTTTTTTGG - Intronic
1067191732 10:44075962-44075984 TTCCTTCCTTCTACTTGTTTTGG + Intergenic
1067225737 10:44374608-44374630 GCCATGCCTTCTCCTCGTTGGGG - Intronic
1069718396 10:70535007-70535029 CCTCTTCCTTGTCCTTCCTGTGG - Intronic
1070503850 10:77096100-77096122 CACCTTTCTTCTCTTTGATGTGG + Intronic
1071036888 10:81258367-81258389 CCCCTTTTCTCTCCTTTTTGGGG - Intergenic
1071089229 10:81899515-81899537 CCCCTTACCTCTCCTGGGTGAGG - Intronic
1071281867 10:84110833-84110855 CCCTTTCCCTCTCCTTTTGGGGG - Intergenic
1071310060 10:84334950-84334972 CTCCTTCCTTCCCTTTGTTATGG + Intronic
1072272356 10:93789193-93789215 CCCCCTCTTTCTCCTTCTTCTGG - Intronic
1072543679 10:96417707-96417729 CCCCTTGGTTCTCCTTCATGTGG - Intronic
1072639901 10:97204042-97204064 CCCCTTCCTTGCACTTGTAGCGG - Intronic
1072866706 10:99069899-99069921 CACTTTCCCTCTCCTTGTTATGG - Intronic
1073108466 10:101047013-101047035 TCCCCTCCTTCTCCTGGATGAGG - Intergenic
1073823453 10:107291801-107291823 CCCCTTCCTTCTGCTTGAGGTGG - Intergenic
1074002724 10:109388612-109388634 CCACTTCCTGCTCCTTGTGATGG - Intergenic
1075269815 10:121038840-121038862 TCCCTTCCTTCACCTGGCTGAGG - Intergenic
1075558088 10:123447731-123447753 CTCCTCCCTCCTCCTTGTTGGGG - Intergenic
1075869137 10:125755973-125755995 TTCCTTCCTTCTACTTGTTTTGG + Intronic
1076444865 10:130507474-130507496 CCCTCTCCTTCTCCTTGCTAGGG - Intergenic
1076865843 10:133165940-133165962 TCCCGTCCATCTCCTTCTTGCGG - Intronic
1077061425 11:619384-619406 CCCCTTCCTGCCCCAGGTTGAGG - Exonic
1077814577 11:5674476-5674498 TCCCCTCTTTCTCCTTGTGGAGG - Intronic
1080277629 11:30521026-30521048 CCACTTCCTTCTCCAAGTGGTGG + Intronic
1081627925 11:44666520-44666542 CCTCTTCCTTTTACTTGCTGGGG + Intergenic
1081964071 11:47158922-47158944 CCCCTTCCTTTTGCCAGTTGAGG + Intronic
1083484811 11:62976710-62976732 CCTCTTCCTCCTCCTTGTGTGGG + Exonic
1083953034 11:65967297-65967319 CTACCTCCTTCTCCTTCTTGCGG - Exonic
1084225127 11:67711008-67711030 CCGCTCCCTTCTCCTGGCTGGGG + Intergenic
1084262946 11:67990850-67990872 CCGCTCCCTTCTCCTGGCTGGGG + Intergenic
1084264773 11:67999256-67999278 GCCCATCCTGCTCCTTGTAGTGG + Exonic
1084693822 11:70742226-70742248 CCCCTTCCTCCTCCTTCTGCTGG + Intronic
1084810447 11:71608266-71608288 CCGCTCCCTTCTCCTGGCTGGGG - Intergenic
1084908770 11:72370503-72370525 CCCCTTCCTCATCCTTGTCCAGG - Intronic
1085018095 11:73188456-73188478 CCCCCTCCCTATCCCTGTTGGGG + Intergenic
1085287325 11:75372106-75372128 CCCCTTCCTTCTCTTTATTGGGG + Intergenic
1089257297 11:117200616-117200638 CCCCTTCCTCCTCCTGGGTCAGG - Intronic
1092060330 12:5545641-5545663 CCCCTTCCTTCTACTTCTCCTGG - Intronic
1092102961 12:5901349-5901371 TTCCTTCCTTGTTCTTGTTGGGG - Intronic
1092435374 12:8442889-8442911 CCCCTTCCCTTGCCTTTTTGCGG + Intergenic
1095962124 12:47842260-47842282 CTCCTTCCTTCTCCTTCTGATGG + Intronic
1096210752 12:49763739-49763761 CCCCTTCCCTATCCTTGCTTGGG - Exonic
1096251184 12:50033433-50033455 CCCCAGCCTCCTCCCTGTTGGGG - Intergenic
1096673588 12:53214571-53214593 CCTCTTTCTTCTTCTTGTTCCGG + Exonic
1097242077 12:57582396-57582418 CCCTTTTCCTCTCCTTGGTGAGG + Intronic
1099368319 12:81797646-81797668 CCCAGTCCTTCTCCCAGTTGGGG + Intergenic
1099509408 12:83515372-83515394 ATCCTTCCTCCACCTTGTTGAGG - Intergenic
1100465622 12:94842242-94842264 CTCCTTTCTCTTCCTTGTTGGGG - Intergenic
1100602418 12:96123117-96123139 CCTCTGGCTTCTCCTTGCTGTGG - Intergenic
1101113442 12:101508101-101508123 CTCCTTCTTTCTTCTTGTTTTGG + Intergenic
1101219696 12:102625774-102625796 CCCCTCCCTTCCCTTTTTTGAGG + Intergenic
1101534367 12:105604000-105604022 ACTCTTCCTTACCCTTGTTGTGG + Intergenic
1102050841 12:109860961-109860983 CCTTTTCATTGTCCTTGTTGCGG + Intronic
1102868556 12:116393988-116394010 CCCCTGCTTTCTCCTTGCAGCGG + Intergenic
1103583956 12:121937215-121937237 CCCCTTGCTTCTGCTGGCTGCGG + Intronic
1103629780 12:122250916-122250938 CCCGTTCCTCCTCCCTTTTGGGG + Intronic
1103915159 12:124372341-124372363 CCTCCTCCTTCTCCTCCTTGGGG + Exonic
1104271924 12:127290025-127290047 CCTCTTCTCTCTCCTTGTTGGGG + Intergenic
1104437075 12:128765058-128765080 CCACTTGCTTCTCCTGGTTGGGG - Intergenic
1104934194 12:132355809-132355831 TCGCTTCCTTCTCCTTTGTGAGG + Intergenic
1104934361 12:132356573-132356595 TCGCTTCCTTCTCCTTTGTGAGG - Intergenic
1104956789 12:132470670-132470692 CCCCTTCCTTTTCCCTTCTGTGG - Intergenic
1105630180 13:22156213-22156235 TCCCTTCCTTCTCCTGGTCCTGG + Intergenic
1106762961 13:32885093-32885115 CCCCATCAATCTCTTTGTTGTGG - Intergenic
1107072142 13:36282161-36282183 CCGATTCTTTATCCTTGTTGTGG - Intronic
1108698196 13:52921230-52921252 CACCTTCATTCTCAGTGTTGGGG + Intergenic
1109802646 13:67399575-67399597 CCCTTTCCCTCTCCTTTTGGGGG - Intergenic
1110761772 13:79238613-79238635 CCTCTTTCTTCTCCTTTTTCTGG - Intergenic
1111396360 13:87672964-87672986 TCCCTTCCTTCTCTTTGGGGCGG + Intronic
1112092098 13:96091964-96091986 CCCCTTCCTTTTCCTGGGTTTGG - Intronic
1113142776 13:107173655-107173677 CCCCTTCTTTCTCCTTTTGAGGG + Intronic
1115174905 14:30550879-30550901 CCCCTTCCTTCTCCTTTCAATGG - Intergenic
1115562880 14:34599000-34599022 CCCCTTCCTTCTGCTATGTGAGG + Intronic
1116233921 14:42253627-42253649 CCTCCTCCTCCTCCTTGTTCTGG - Intergenic
1117222617 14:53620988-53621010 CCCTTTCCTTTGCCTTTTTGAGG + Intergenic
1118546839 14:66900260-66900282 TTCATTCCTTCTCCTTGTTTGGG + Intronic
1118592913 14:67414342-67414364 CCCCTTCCTTCCCCAGGCTGTGG + Intergenic
1118668667 14:68099154-68099176 TCACTTCCTACTCTTTGTTGTGG + Intronic
1119611512 14:76067042-76067064 GCCCTTCCTTCTCTTTCTTTCGG + Intronic
1121214311 14:92235465-92235487 CCCATTCCTACTCCTTGATTAGG - Intergenic
1121433694 14:93905166-93905188 CCACTTCCTTTTCCTTGTCCAGG + Intergenic
1121690769 14:95876155-95876177 CCGCTTCCCTCTCCGCGTTGGGG - Intergenic
1122383100 14:101323976-101323998 CCCCTTCCTCTCCCTTGTTCAGG + Intergenic
1122626238 14:103086782-103086804 CCCAGCCATTCTCCTTGTTGGGG + Intergenic
1124623024 15:31289029-31289051 TTCCTTCCTTCTTCTTGTTTTGG + Intergenic
1125414424 15:39437797-39437819 CCCCTTCCATCTTATTGTTCTGG + Intergenic
1125695579 15:41634593-41634615 CCCTTTCCTTCCCCTTACTGAGG + Intronic
1126329499 15:47516625-47516647 CCCCTTCAGTGTCCTTGATGGGG + Intronic
1126583650 15:50262777-50262799 TTCCTTCCTTCTCTTTGGTGTGG + Intronic
1127044063 15:55007560-55007582 AGCTTTCCTTTTCCTTGTTGTGG - Intergenic
1127470206 15:59283216-59283238 CCCCTGCTTTCTCCGTTTTGAGG + Intronic
1127656098 15:61057678-61057700 CCCCTTGCTTCCCTGTGTTGAGG - Intronic
1127966169 15:63924400-63924422 CTCCTTCCTTCTGATTTTTGGGG - Intronic
1128332184 15:66763144-66763166 CACCTTCCATCTCCTAGTTCTGG - Intronic
1128738245 15:70065814-70065836 CCTTTTCCTACTCCTTGGTGTGG - Intronic
1129186775 15:73912131-73912153 CCATTTCCTTCTCCTTGTTTGGG + Intergenic
1129945079 15:79532782-79532804 GCCTTTTCTTCTCCTTGTTTCGG - Intergenic
1130632482 15:85582707-85582729 CTCCTTCCTTTTCCTGCTTGGGG + Intronic
1131109855 15:89758421-89758443 CCCCTTTGATCTCCTTATTGTGG + Intergenic
1131493407 15:92882466-92882488 CCCCTTCCGCCTCCTTCGTGCGG - Intergenic
1132226891 15:100149722-100149744 CCCCTTCCTCTCCCTTGTTCAGG + Intronic
1133368852 16:5232794-5232816 TCCCTGCCTTCTCCCTGGTGCGG - Intergenic
1135346304 16:21691457-21691479 ACCCTTCCCTCTCCTGGATGTGG - Intronic
1137039679 16:35599337-35599359 TCCCTTCCTTCTCCTTCCTTAGG + Intergenic
1137295395 16:47087739-47087761 CTCCTTCTTTCTCTTTGTGGCGG + Intronic
1137356184 16:47767325-47767347 TCCCTTACTTCTGCTTGTTTTGG - Intergenic
1137698692 16:50479859-50479881 CTCCTTCCATCTCCATCTTGGGG + Intergenic
1137903365 16:52293483-52293505 CCCCTCTCTTCTCCATGATGTGG + Intergenic
1139525359 16:67512449-67512471 TCCCTTCCTTCTCCTCCCTGGGG - Intergenic
1140159850 16:72478089-72478111 TTCCTTCCTTCTGCTTGTTTTGG - Intergenic
1140187575 16:72788486-72788508 CCTCTCCTTTCTCCTTCTTGGGG + Exonic
1142631868 17:1230456-1230478 CCCGTTCCATCTCCTCTTTGCGG + Intergenic
1142903171 17:3026107-3026129 TCTCTTACTTCTCCTTGTTGGGG - Exonic
1143153855 17:4823319-4823341 CTCCTTCCTTCCCCTGGTGGGGG - Exonic
1143477575 17:7211553-7211575 GCTCTTCCTTCTGCTTGGTGCGG - Intronic
1144813392 17:18016714-18016736 GCACTTCCTTCTCCTGGCTGGGG - Exonic
1146266837 17:31458423-31458445 CCCCTTCCTGCTGCTTTTGGAGG + Intronic
1146461196 17:33047219-33047241 CCCCTTCCCTCTCAGAGTTGAGG + Intronic
1146679382 17:34796144-34796166 CACCTTCCAGCTCCATGTTGGGG - Intergenic
1147749226 17:42718379-42718401 CCATTTCCTTCTCTTTGTTCTGG - Intronic
1147992897 17:44345784-44345806 CTCCTTACTTCCTCTTGTTGCGG + Intronic
1148339890 17:46867111-46867133 TCTCTTCCTTCCCCTTCTTGGGG + Intronic
1150006496 17:61472847-61472869 CCCCTTTCCTCCCCTGGTTGAGG + Intronic
1151210283 17:72539212-72539234 CCCCTTCCTTGTCCCTCTGGAGG - Intergenic
1151539458 17:74757796-74757818 CCCCTTCCATCCTCTTGTTGGGG + Intronic
1152012069 17:77724851-77724873 CCCCTCCCTTGTCCCTGTGGGGG + Intergenic
1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG + Intronic
1152946225 17:83199016-83199038 GCCCCTCCTTCTCCTTGATCAGG + Intergenic
1153018538 18:606236-606258 GGCCGTCCTTCTCCCTGTTGTGG - Intronic
1155278017 18:24208474-24208496 CTCCTTCTTTGTCCTGGTTGGGG + Intronic
1157401271 18:47390517-47390539 CCACCTCCTTCTCCCTGCTGTGG - Intergenic
1157890090 18:51407235-51407257 CATATTCCTTCTCCCTGTTGGGG + Intergenic
1158117867 18:54016586-54016608 CCCATTACTTTTCCTTGATGAGG + Intergenic
1160554175 18:79715293-79715315 CCTCCTCGATCTCCTTGTTGAGG - Exonic
1161865967 19:6832448-6832470 CCTCTTCCTTCTCCTCCTTCTGG + Intronic
1161930629 19:7337152-7337174 CCCTTTGGTTCTCCTTGCTGTGG + Intergenic
1162284561 19:9728496-9728518 CCCTTTCCCTCTCCTTTTGGGGG + Intergenic
1162497397 19:11030912-11030934 CCCCTTCCTTCTCCTCGACCTGG - Intronic
1162516181 19:11149212-11149234 CCACTTCCTTCTCCATGGTGAGG + Exonic
1162532842 19:11245763-11245785 CCCCTTCCTTCTCCTTGTTGGGG - Intronic
1162821982 19:13228793-13228815 CCCCTTTCTTCTCCTTTCAGCGG - Intronic
1163224616 19:15949343-15949365 CTCCTTCCTTCTCCTGGTCATGG + Exonic
1163943565 19:20516178-20516200 CCCTTTCCCTCTCCTTTTGGGGG + Intergenic
1164551596 19:29216933-29216955 CACCGTCTTTCTCTTTGTTGAGG - Intergenic
1164557312 19:29263516-29263538 CCCCTTCCTTCACCCTGGAGGGG - Intergenic
1164567658 19:29339469-29339491 CCTCTTCCTTCTCTTGGTTGAGG - Intergenic
1164676983 19:30107507-30107529 CCCCTTCCTTCCCCTTGCTGGGG - Intergenic
1164803000 19:31093234-31093256 CCCTCTGCTTCTCCCTGTTGAGG - Intergenic
1165349285 19:35267638-35267660 CCTCTTCCTCCTCCTCCTTGTGG - Exonic
1166368851 19:42290670-42290692 CCTCTTGCTCCTCCTTGTTTGGG - Exonic
1166922890 19:46243193-46243215 TTCCTTCCTTCTCCTTGCTTTGG + Intergenic
1167521911 19:49960297-49960319 CCCCTTCTTTCTCCTGGACGGGG - Exonic
1167523473 19:49970425-49970447 CCCCTTCTTTCTCCTGGACGGGG + Intergenic
1167721982 19:51185541-51185563 CCCCTACCATCTCCTGGATGGGG + Intergenic
1167756593 19:51416826-51416848 CCCCTTCTTTCTCCTGGACGGGG - Exonic
1167783841 19:51619789-51619811 CACCTTCCTTCTACTTGTTTTGG - Intronic
1168003924 19:53470561-53470583 CCTCTTACCTCTCCTTGTTAAGG - Intronic
925159135 2:1670955-1670977 CACCTTCCTTCTGCCTGATGTGG - Intronic
926010246 2:9401069-9401091 CCCCTTCTCTCTGCTTGGTGGGG + Intronic
927031625 2:19125842-19125864 CCCCTCCCTCCTCCTAGTTTTGG - Intergenic
927482026 2:23461702-23461724 CCCCTTCTTTATCTTTGCTGGGG + Intronic
927922503 2:26983943-26983965 CCCGTCCCTTCCCCTTGTTGGGG + Intronic
927927336 2:27023227-27023249 CCTCTTCTCTCTCCTTGTTCTGG - Intronic
928822295 2:35375919-35375941 CCCCTTCCTTTTCCTTCCTTTGG - Intergenic
930526990 2:52542723-52542745 CCCCTTCCTTTTGCTTGAGGAGG + Intergenic
932433107 2:71687043-71687065 CCCCTGCCTTCTCCTTACTCGGG + Intergenic
932777848 2:74539173-74539195 CAACTTCCTTCTCCTTTTTGCGG - Intronic
933872380 2:86580020-86580042 CTCCTTCCTTCTGCTTGTTTTGG - Intronic
934078817 2:88451072-88451094 CCCCTTTCCTTTCCTTGTTCTGG + Intronic
934931026 2:98423512-98423534 TTCCTTCCTTCTGCTTGTTTTGG - Intergenic
934971234 2:98766184-98766206 TCCCTTCCTCATCCTTGTTCAGG - Intergenic
935158827 2:100511183-100511205 TCCCTTCCTTCTGCTTGATTTGG - Intergenic
936384895 2:112020514-112020536 CCTCTTCCTTCTTCTTGTGTAGG + Intronic
936842235 2:116785199-116785221 CCCCTACCTTCTCCCTGTCATGG + Intergenic
937258857 2:120572819-120572841 GCCTCTCCTTCTCCTTGGTGCGG - Intergenic
937764662 2:125646165-125646187 CCCCCTCCTTTTCCGTGTTTTGG + Intergenic
939195182 2:138962970-138962992 CCCCGTCTTTCTCTGTGTTGTGG + Intergenic
940896743 2:159088383-159088405 CTCCTTCCCTCTGCTTCTTGGGG + Intronic
941644325 2:168024030-168024052 CCCCTTCCTACTCCTGATAGCGG - Intronic
941762978 2:169265049-169265071 TGCCTTCATTCTCCTTCTTGGGG - Intronic
942100454 2:172576520-172576542 TTCCTTCCTTCTGCTTGCTGTGG + Intronic
943081282 2:183261399-183261421 ACCCTTTCTTCTCTCTGTTGGGG + Intergenic
943582317 2:189699327-189699349 CAGCTTCCTTCTCCTTTTTAGGG + Intronic
944929003 2:204497026-204497048 ATCCTTCCTTTTCTTTGTTGGGG + Intergenic
945978671 2:216290811-216290833 CCCCATCCTTCTCATTGTGCAGG - Intronic
945991295 2:216397530-216397552 CCTGTTCCCTGTCCTTGTTGAGG - Intergenic
946156458 2:217809792-217809814 CCCCTGCCTGCTCCTCGGTGGGG - Intronic
948305217 2:236941362-236941384 CCTTTTCCTTCTCCTTTATGGGG + Intergenic
948565463 2:238883574-238883596 CCCCATCCTTCTCCTTCTATTGG - Intronic
948865401 2:240772442-240772464 CTGCTTTCTTCTCCTTTTTGGGG - Intronic
1169022379 20:2339787-2339809 CCCCTGCCTGCACCTTGGTGAGG - Intronic
1171106944 20:22442696-22442718 CCCATGCCTACTACTTGTTGAGG - Intergenic
1172393651 20:34583685-34583707 CACCTTCCCTGTCCTTGTTCCGG - Intronic
1172765917 20:37350705-37350727 CCCCATTCTCCTCCCTGTTGGGG + Intronic
1172914183 20:38431535-38431557 TCCTTTACTTCTCCTGGTTGGGG - Intergenic
1173002142 20:39112047-39112069 CCCTTTCCTTCTCCTTGCTCTGG + Intergenic
1173554090 20:43953367-43953389 CCCCTTCCTCCTGTCTGTTGTGG + Intronic
1173990214 20:47296532-47296554 CTCTTTCCATCTCATTGTTGAGG - Intronic
1175172721 20:57091500-57091522 TCCCAACCTTCTCCTTGTTGAGG - Intergenic
1175183493 20:57164852-57164874 CCCCTTCCTCCTCCTCGTCCTGG - Intergenic
1175563049 20:59948890-59948912 CCACTTACTACTCCATGTTGAGG + Intergenic
1176991575 21:15503561-15503583 CCCCTTCCTTCTCTTGATTATGG - Intergenic
1177216018 21:18130041-18130063 CCTATTCCTTCTCCTTGCTCCGG - Intronic
1177362057 21:20085550-20085572 ACCCTTGCTTCTCCTCTTTGGGG + Intergenic
1178515020 21:33239264-33239286 TCCCTTCCTTCTCTTATTTGGGG - Intronic
1179154384 21:38837020-38837042 CACCTCCCTCCTCCTTGCTGGGG - Intergenic
1179364002 21:40738900-40738922 TTCCATCCCTCTCCTTGTTGGGG - Intronic
1179365474 21:40755077-40755099 TCCCTTCCTCTTCCATGTTGTGG - Intronic
1179502986 21:41821511-41821533 CCCCCTCCTCCTCCCTGCTGAGG - Intronic
1179580960 21:42343685-42343707 CCCCTTCCTCCTCCTTTGGGGGG - Intergenic
1179936925 21:44611965-44611987 AGCCTTCCCTTTCCTTGTTGTGG - Intronic
1180744460 22:18078216-18078238 CCCCTTCCTTTTCCTTCTCGGGG + Intronic
1181406953 22:22691836-22691858 CCCCTTCCTGCTCCTGGTACAGG - Intergenic
1181512392 22:23394750-23394772 CCCCTTCCTGCGCCTTGAGGTGG + Intergenic
1182417757 22:30232425-30232447 ACCCTTCCTTCTGCTTTTTAGGG - Intergenic
1182475262 22:30573681-30573703 CCCTTTCCTTCCCCCTGGTGTGG + Intronic
1183496500 22:38147964-38147986 CTCCTTCCCTATCTTTGTTGTGG - Intronic
1183642538 22:39101203-39101225 CCCCTCCCTTCTCTCTGTTTGGG + Intronic
1183978516 22:41526704-41526726 CCCCTTCCTTGTCTTTGTCTAGG - Exonic
1184381257 22:44146496-44146518 CCCCTTCCGTGGCCTTGTGGAGG - Intronic
1184415606 22:44350268-44350290 CCCCTTCCTTTGCCTTTCTGGGG - Intergenic
1185132126 22:49045187-49045209 CCTCTTCCTTTTTCTTGTCGAGG + Intergenic
949549003 3:5096808-5096830 CCCCACCCTTCTCATTGTTGGGG - Intergenic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951156954 3:19367062-19367084 CCACTTGCTCCTCCTTCTTGTGG + Intronic
952526007 3:34211313-34211335 CCCCTCCTTCCTCCTTGTGGAGG + Intergenic
953214122 3:40901935-40901957 CCCCTTCCTCCTTCATGTTTAGG + Intergenic
953638532 3:44684396-44684418 TCTCTTCCTTCTCCTTGCTCTGG + Intergenic
954637423 3:52078836-52078858 CCCCTTCCTTCCCCTTGTAGAGG - Intronic
956426417 3:69140274-69140296 CTCTTTCCTTCTTTTTGTTGGGG + Intergenic
956750921 3:72343214-72343236 CCTCTGCCTTCTCCTGGTGGAGG + Intergenic
957452238 3:80394015-80394037 CCCCTTCCTTGTTCTTCTCGTGG - Intergenic
961905637 3:130260189-130260211 CCCCTTCCTTCTTCTTCCTAGGG - Intergenic
963035621 3:141024321-141024343 TCCCTTCCTTCTGCTTGCTTTGG + Intergenic
964264067 3:154874642-154874664 CCCATTACTTCTGCTTTTTGTGG - Intergenic
964445414 3:156752686-156752708 CCTCTTCCTCCTCCTTCTGGAGG - Intergenic
964522773 3:157585594-157585616 CCCTTTCCCTCTCCTTCTGGGGG + Intronic
966480794 3:180406117-180406139 TCCCTTCCTTATCCTTTGTGAGG + Intergenic
966884574 3:184369480-184369502 CCTCTTCCTCCTCCCTGCTGAGG - Intronic
966919455 3:184602344-184602366 CCTTTTCTTTCTCCTTTTTGGGG - Intronic
967004615 3:185372309-185372331 CCCCTTCCTCCTCCTTTTTCTGG + Intronic
967493633 3:190120387-190120409 CCCTTTTCCGCTCCTTGTTGGGG - Exonic
967809940 3:193749707-193749729 TCCCTTCCTTCTGCATGTTCTGG + Intergenic
969021455 4:4142766-4142788 CCGCTCCCTTCTCCTGGCTGGGG + Intergenic
969215517 4:5719315-5719337 TCTCTTCCTCCTCCTTGATGGGG - Exonic
969404961 4:6985211-6985233 CCCCATCATTCTCCTGGGTGTGG - Intronic
969567283 4:7985950-7985972 CCACTTCCTGCCCCTTGCTGGGG + Intronic
969723148 4:8904378-8904400 CATCTTCCCACTCCTTGTTGCGG - Intergenic
969732409 4:8964650-8964672 CCACTCCCTTCTCCTGGCTGGGG - Intergenic
969791991 4:9498733-9498755 CCACTCCCTTCTCCTGGCTGGGG - Intergenic
969971897 4:11056411-11056433 CTCCTTCCTTCTCCCTGTGCCGG - Intergenic
970010618 4:11454863-11454885 CTTCTTCCTTCTTCTTCTTGAGG - Intergenic
971485997 4:27160895-27160917 TCTCTTCTTTCTCCATGTTGTGG + Intergenic
971558775 4:28047505-28047527 CCCCTTCCTTCTGCTTGAAGAGG - Intergenic
972393528 4:38635658-38635680 CCCATTCCTTCTCCTTGGCATGG + Intergenic
972983477 4:44734497-44734519 TCCCTTCCTTCTGCTTGCTTTGG + Intergenic
973852718 4:54977177-54977199 CTCCTTCCTTCTGCTTGAGGAGG + Intergenic
974800821 4:66815514-66815536 CCCCTCCATTCTCTTTATTGAGG + Intergenic
974900950 4:67997519-67997541 CCCCTTTCTTCTCATTAGTGAGG + Intergenic
975657450 4:76655839-76655861 CACCTTCCTTCTCTCTGCTGGGG + Intronic
977229279 4:94432788-94432810 ATCCTTCTTTCTCCTGGTTGTGG + Intergenic
979105194 4:116676767-116676789 CCCCTTCTTTCTCCATGTAGGGG - Intergenic
979320490 4:119317868-119317890 CCCCTTCTTTTTTGTTGTTGTGG - Exonic
979494667 4:121370126-121370148 CTCCTTCCTCCACCTTGGTGAGG + Intronic
980634797 4:135487588-135487610 CCACTACATTCTCCTTTTTGTGG + Intergenic
981736045 4:147951366-147951388 GCCCTTCTTTCTCCTTATTTAGG + Intronic
983421789 4:167527357-167527379 CCCCTTCCTTCTGCTTGAGGAGG - Intergenic
983878496 4:172905074-172905096 CCCGTTACTTTTCCTTGTTAAGG - Intronic
985472480 5:54329-54351 CCTCTTCCTCCTCCTGGGTGGGG - Intergenic
985686892 5:1286305-1286327 CCCCTTCCTTGTCCTTTGCGTGG - Intronic
985729293 5:1538324-1538346 CCACCTACTTCTCCTTGCTGTGG + Intergenic
986042384 5:4005980-4006002 CCCCACCTTTCTCCTTGCTGAGG + Intergenic
986044979 5:4028103-4028125 CCCCTTCTTGCTCCTTCTTCCGG - Intergenic
991387475 5:66106128-66106150 CCCCTTGCTCTTCCTTGGTGAGG - Intergenic
993557455 5:89358281-89358303 ACCCTTCCTTATTCTTGTTGTGG - Intergenic
994901448 5:105776824-105776846 CCCCCTCCTTTTCCATGTTTTGG + Intergenic
996235132 5:121118823-121118845 CCTCTTCCTTCTTCTGATTGTGG - Intergenic
996403813 5:123088422-123088444 CTCTTTCCCTCTCCTTCTTGGGG - Intergenic
996529923 5:124517993-124518015 CCTCTTACCTCTCCTTGTTAAGG + Intergenic
997527209 5:134561057-134561079 TCCCTTCCTCCTCCTTCTTAAGG - Intronic
1000159906 5:158587158-158587180 CCGCTTCCTTCTGCTTGAGGAGG - Intergenic
1000498792 5:162021458-162021480 CCCCTTCCTTCTACTTGAAGAGG + Intergenic
1000914678 5:167066243-167066265 CCCCATCCTACTCCTTGGTTTGG - Intergenic
1000924592 5:167178396-167178418 TCACTTCCTTCACCTTGTTCTGG - Intergenic
1001705310 5:173737215-173737237 GCCCTTCCTTCTCCAGGGTGGGG - Intergenic
1003522361 6:6868914-6868936 CCCCTTCCTGCTCTTTCTTTGGG - Intergenic
1003611409 6:7617961-7617983 CCCCAATCTTCTCCTTTTTGAGG + Intergenic
1003673061 6:8177817-8177839 CACCTTCCTTCTCATTTTTCTGG + Intergenic
1004148791 6:13094842-13094864 CCCCTTCTTTCTCCCTTTTATGG + Intronic
1005706517 6:28459975-28459997 CTCCTTCCTTCTCTTTATTCAGG - Intergenic
1006425933 6:33963011-33963033 CTCCTTCCTGCTCCTTCCTGTGG + Intergenic
1009977288 6:70684948-70684970 CTCCTTCCTTCTTCGTGGTGGGG + Intronic
1011081597 6:83495853-83495875 CCCCTTGCATCTCCTGGGTGAGG - Intergenic
1011204028 6:84872269-84872291 CCATTTCCTTCTCGTTCTTGTGG - Intergenic
1012933201 6:105338594-105338616 CCCCTTGCATTTCCTGGTTGAGG - Intronic
1012982802 6:105847533-105847555 CTCCTTTCTTTTCCTTGCTGTGG - Intergenic
1014408517 6:121083927-121083949 CTCATTCCTTCACCTTGTTCTGG + Intronic
1017166124 6:151410003-151410025 ACCCTTTCTTCTACTTTTTGAGG + Intronic
1017343451 6:153353347-153353369 CCACTTCCTCCTCCCTGGTGGGG + Intergenic
1018523111 6:164675182-164675204 TTCCTTCCTTCTACTTGTTTTGG + Intergenic
1019266341 7:119402-119424 CCCCTTCCTTCCCCTTGTCCAGG - Intergenic
1019850990 7:3557074-3557096 CTCTTTCCTTCTGCTTGTTCTGG - Intronic
1020308876 7:6854795-6854817 CCGCTCCCTTCTCCTGGCTGAGG + Intergenic
1021184736 7:17550930-17550952 TTCCTTCCTTCTGCTTGTTTTGG - Intergenic
1021759213 7:23886973-23886995 CCCCTCCCTTCTCCTTGTATAGG + Intergenic
1022269500 7:28792698-28792720 CAGCTTTCTTCTCCTTGGTGTGG + Intronic
1024211103 7:47205599-47205621 TTCCTTCCTTCTGCTTGTTTTGG - Intergenic
1024976429 7:55117951-55117973 TCCCTTCCTTCTCCTTTTCTGGG - Intronic
1025634991 7:63314140-63314162 CTCCTTCCTTTTCGTTGCTGAGG - Intergenic
1025647704 7:63434030-63434052 CTCCTTCCTTTTCGTTGCTGAGG + Intergenic
1027333832 7:77127201-77127223 CTCCTGCCTGCTCCATGTTGTGG + Intronic
1028733413 7:94179257-94179279 CCACTTCCCTCTCCTTTCTGGGG + Intergenic
1029198403 7:98822510-98822532 CCACTGCCTTCTCCTTGACGGGG + Intergenic
1029350845 7:100011847-100011869 CCCCTTCCCTCTCCCTGGGGTGG - Intergenic
1029460205 7:100689895-100689917 CCCCTTACTTCTCTTTCATGAGG + Intergenic
1029694186 7:102202236-102202258 CCCATCTCTTCTCCTTGCTGAGG + Intronic
1029781961 7:102744113-102744135 CTCCTGCCTGCTCCATGTTGTGG - Intergenic
1031723002 7:125200519-125200541 CCCCTTCCTTTTCTTTGATAAGG + Intergenic
1032364473 7:131286354-131286376 CCCCTGCCTTTTCCTTTGTGGGG + Intronic
1032675019 7:134121852-134121874 CCACTTCCTTCTCCTCTTTCAGG + Intergenic
1033105905 7:138523200-138523222 CACCTTCCTACTCCTGGTAGTGG - Intronic
1033285239 7:140035830-140035852 CCTCTTCCTCCTCCTTCTTTTGG - Intronic
1033349021 7:140546763-140546785 CTCCTTCCTTCTCCCTGGGGAGG - Intronic
1033416581 7:141166913-141166935 CCCCTTTCTTGTCCTTGTATGGG + Intronic
1033733051 7:144196621-144196643 CCTCTTCCTTCTCCTACTTAGGG + Intergenic
1033743903 7:144295201-144295223 CCTCTTCCTTCTCCTACTTAGGG + Intergenic
1033749998 7:144354366-144354388 CCTCTTCCTTCTCCTACTTAGGG - Intergenic
1034421015 7:150990782-150990804 CCCCTTCCCTTCCCTTGTTCAGG - Intergenic
1034470013 7:151249914-151249936 CCCCTTTTTTCTCCTTCTTGGGG + Intronic
1034737031 7:153439057-153439079 CCCCTTCCCTCTCTTTGCTGTGG + Intergenic
1034869501 7:154671333-154671355 TCCCATCCTTCTCCCTGTAGTGG - Intronic
1036973318 8:13380444-13380466 CCCCTTCCTCCACCTTTTTGTGG + Intronic
1037498690 8:19464770-19464792 CCACCACCTTCCCCTTGTTGTGG + Intronic
1037851796 8:22336586-22336608 TTCCTTCCTTCTCCTTGTTTTGG - Intronic
1038798741 8:30731004-30731026 CCCCTTCCCTTGCCTTTTTGTGG - Intergenic
1039053052 8:33512310-33512332 CACCTTCCTCCTCCTTGGAGGGG + Exonic
1040521381 8:48178981-48179003 CCACCTTCTTCTCCTTGTGGAGG + Intergenic
1040596854 8:48846872-48846894 CCCCCTTTTTCCCCTTGTTGAGG - Intergenic
1040601517 8:48889364-48889386 ACACTTGTTTCTCCTTGTTGAGG - Intergenic
1040888109 8:52287559-52287581 CCCCTTCTCTCTACTTGTTCTGG - Intronic
1041692546 8:60703148-60703170 CTCCTTCCTTTTTCTTATTGTGG + Intronic
1042777343 8:72448074-72448096 CGCCTTCCTTCTCCTGTATGTGG - Intergenic
1043115916 8:76253995-76254017 TTCCTTCCTTCTCCTTGCTTTGG - Intergenic
1043607842 8:82024294-82024316 GCCCTTTCTTCTCCTTCTAGAGG + Intergenic
1043670832 8:82882102-82882124 CCCATTCCTTGTCCCTGTTGTGG + Intergenic
1047476763 8:125239950-125239972 CCCCTTCTTGCTCATTGCTGAGG + Intronic
1048332471 8:133480069-133480091 TCTCTTCTTTCTCCTTGTTCTGG - Intronic
1049237476 8:141519308-141519330 CCCCTTCCTGGTCCTTGGGGAGG + Intergenic
1051061394 9:13049208-13049230 CCCTTTCCTTCTCCTTATCCAGG - Intergenic
1051449631 9:17180873-17180895 CCCCTTCCTTCTGGTTTTGGTGG + Intronic
1051465001 9:17367583-17367605 CCCCTTCCATCTGCTTGAGGAGG + Intronic
1052978806 9:34432088-34432110 CCCCTGCCATCTCCTGGCTGTGG - Intronic
1054777576 9:69136806-69136828 CCTCTTCCTTCTCCTTCTCCAGG - Intronic
1054845422 9:69791403-69791425 CCCATCCTTTCTCCATGTTGAGG - Intergenic
1055723270 9:79199426-79199448 CCCCTTCCTTCTTCATGTCTAGG - Intergenic
1057221670 9:93260857-93260879 CCCCCTCCTGCTCCCTGGTGTGG - Intronic
1057391732 9:94646280-94646302 CCCCTTCTTTGTCCTTAATGAGG + Intergenic
1058217043 9:102247503-102247525 AGCCTTCATTTTCCTTGTTGTGG - Intergenic
1059046626 9:110875720-110875742 CCCTATCCTTGTCCTTGTAGGGG - Exonic
1061832551 9:133304824-133304846 CCCCTTCCTCCTCCAGGATGTGG + Intergenic
1062104968 9:134750365-134750387 CCCCTCCCTTCTCCGGGTGGGGG + Intronic
1062460504 9:136660792-136660814 ACCCTTCCTTCCTCTTCTTGGGG - Intronic
1186108813 X:6233529-6233551 CTCCTGCCTACTCCTTGTGGAGG - Intergenic
1186333795 X:8564664-8564686 ACCCTTCCTTCTGCATGTGGTGG - Intronic
1187006320 X:15236480-15236502 CCCCCCACTCCTCCTTGTTGTGG + Intronic
1187124783 X:16445076-16445098 CCTCTTCTGTCTCCTTGATGTGG - Intergenic
1187379994 X:18793051-18793073 TTCCTTCCTTCTGCTTGTTTTGG + Intronic
1189099524 X:38174313-38174335 CCCCATACTTCACCTTGATGGGG + Exonic
1189428445 X:40924673-40924695 CTCCTTCCTTCTGCTTGCTTTGG + Intergenic
1190943127 X:55063523-55063545 CTCCTTCCTTCCCCTTTTAGAGG + Intergenic
1192580935 X:72280660-72280682 CCTCTGCCTCCTCCTTGTTCCGG - Intronic
1192890867 X:75389448-75389470 CTCCTTCCTTCTGCTTGAGGAGG + Intronic
1193100209 X:77602451-77602473 TTCCTTCCTTCTGCTTGTTTTGG + Intronic
1193365717 X:80629865-80629887 CCCTTTCCATCTCCTTCTTGAGG - Intergenic
1193668260 X:84351201-84351223 GCCCTTCCTCCTCCTCATTGGGG - Intronic
1194349232 X:92805455-92805477 CCTCTTCCTTCTAATTGTTATGG - Intergenic
1195172349 X:102281607-102281629 CCCCTTCCTTCCACTTGAGGAGG - Intergenic
1195186512 X:102405486-102405508 CCCCTTCCTTCCACTTGAGGAGG + Intronic
1195740016 X:108054930-108054952 TCCCTTCCTTCTGCTTGCTTTGG - Intronic
1195966179 X:110432145-110432167 CCCCTCCCTTCTCCTTCATCTGG - Intronic
1196380103 X:115080194-115080216 CCCTTTCCTTATCCTTATTAAGG - Intergenic
1197343856 X:125307902-125307924 CCCTTTCCTCCTCCTTTTTCTGG - Intergenic
1197987236 X:132279056-132279078 CCCCTTCCTTCTGCTTGAGAAGG - Intergenic
1198117091 X:133554806-133554828 CCCCTTCCCTTCCCTTGTTCAGG + Intronic
1198425184 X:136511317-136511339 CCTCTTCAGACTCCTTGTTGAGG - Exonic
1198927524 X:141815262-141815284 CCCCTTCCTTCCACTTGACGAGG - Intergenic
1199807243 X:151312455-151312477 TCCCTTCCTCCTCATTGCTGAGG - Intergenic
1199847700 X:151702859-151702881 CCCCTGCTTTTTCCATGTTGGGG + Exonic
1200657558 Y:5922055-5922077 CCTCTTCCTTCTAATTGTTATGG - Intergenic