ID: 1162535588

View in Genome Browser
Species Human (GRCh38)
Location 19:11261706-11261728
Sequence GAACCAGCTGGTGGGCAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162535588_1162535603 29 Left 1162535588 19:11261706-11261728 CCCGTCTGCCCACCAGCTGGTTC 0: 1
1: 0
2: 2
3: 20
4: 227
Right 1162535603 19:11261758-11261780 TCACCCATCCATCCCCAGCGCGG 0: 1
1: 0
2: 2
3: 12
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162535588 Original CRISPR GAACCAGCTGGTGGGCAGAC GGG (reversed) Intronic
900529514 1:3145869-3145891 GCCCCAGCAGGTGGGCAGCCCGG + Intronic
900596203 1:3481278-3481300 GCTCCAGCCGGTGGGCAGACTGG - Intergenic
903880006 1:26501675-26501697 GGACCAGGTGGTGGCCAGAAGGG + Intergenic
904011789 1:27394023-27394045 GTTCCTGCTGGTGGGCAGCCTGG + Exonic
905230924 1:36514531-36514553 GGAGAAGCTGGTGGGGAGACTGG + Intergenic
906070496 1:43013033-43013055 GCACCAACTAGTGGGTAGACAGG + Intergenic
906942542 1:50268211-50268233 AAATCAGCTGGTGAGCAGCCAGG + Intergenic
911488269 1:98529278-98529300 GTCCCAGCTAGTTGGCAGACAGG + Intergenic
911987302 1:104644138-104644160 GAGCCAGTTGGTGGGTAGAGTGG - Intergenic
913215672 1:116617987-116618009 GATCCAGCTGGTGAACAGCCGGG + Intronic
915039885 1:152959877-152959899 GAACAAGCAGGTGGTGAGACTGG - Intergenic
915110451 1:153561546-153561568 GAAGAAGCTGATGGGCAGCCTGG - Exonic
915724444 1:158007683-158007705 GAGCCTGCTTGTGGGCAGCCTGG + Intronic
915899698 1:159837544-159837566 GAACAATCTGTTGGGGAGACAGG + Intronic
917442287 1:175078714-175078736 GAGGCAGCTGGAGGGCAGACTGG - Intronic
918014828 1:180623307-180623329 GAACCAGCGGGGGGGCAGGAGGG - Intergenic
918584916 1:186175645-186175667 GATCCAGCTGGTGGCCAAATTGG - Intronic
920353917 1:205356460-205356482 GGGCCTGCTGGTGGGGAGACAGG - Intronic
920857386 1:209674386-209674408 GAAGCAGTTTGTGGGCAGAAGGG - Intergenic
923806821 1:237266671-237266693 GAAGCAGCTCCTGGGCAAACTGG + Intronic
924360513 1:243236475-243236497 GAGCCTGCTGGTGGCCAAACAGG - Intronic
1062828757 10:590937-590959 GAACCTGGTGGGGGACAGACTGG - Intronic
1062923932 10:1300087-1300109 TAAACAGCTGGAGGGCAGAGTGG - Intronic
1064230195 10:13523031-13523053 GATCCAGCTGGGGAGGAGACAGG - Intronic
1070918411 10:80169229-80169251 GAACAGGCTGCTGGGCAGAGGGG + Exonic
1071511265 10:86264019-86264041 GACCCGGCAGGTGGGCAGCCTGG - Intronic
1072656065 10:97331452-97331474 GACACAGCTGGTGAGCAGAAAGG + Intergenic
1073345181 10:102777494-102777516 GACACAGCTGATGGGCAGAGAGG + Intronic
1075884123 10:125882352-125882374 GAACTAGCTGTTGAGCACACTGG - Intronic
1076068705 10:127469111-127469133 GAAACAGCTGGAGGGCAGGGTGG - Intergenic
1076791207 10:132777755-132777777 GCACCAGCTCCTTGGCAGACGGG - Exonic
1077167963 11:1152255-1152277 GATGCTGCTGGAGGGCAGACTGG + Intergenic
1078141895 11:8699176-8699198 GAACCAGCTGGGGGGAAGGGTGG - Intronic
1078148779 11:8741269-8741291 AAATCAGCTTGGGGGCAGACAGG - Intronic
1078442876 11:11381760-11381782 CAATCAGCTGGTGGCCCGACTGG - Intronic
1081870164 11:46379701-46379723 GGAGGAGCTGGTGGGCAGAGAGG + Intronic
1083769574 11:64858981-64859003 GAAGCAGCTCGTGAGGAGACAGG - Intronic
1084431379 11:69113384-69113406 GAACCAGCTGGGGGTGAGACCGG - Intergenic
1084489960 11:69472848-69472870 AGACCAGCTGGAGGGGAGACTGG - Intergenic
1084731696 11:71077727-71077749 AAGCCAGGTGGTGGGCAGAAGGG + Intronic
1085419213 11:76341215-76341237 CAATCAGCTGGTGAGCAGTCGGG + Intergenic
1085621826 11:78043607-78043629 GAACCAGCTCGTGGGGTGTCAGG + Intronic
1086920488 11:92581075-92581097 GAACCAGTTCCTGGGCAGAAGGG - Intronic
1088682146 11:112252642-112252664 GTACCAGCCTGTGGGCAGTCAGG - Intronic
1090009547 11:123034161-123034183 CATCCAGCTGGTGGAGAGACTGG + Intergenic
1090668094 11:128928250-128928272 GAAATAGCTGGTGGGCAGAAAGG + Intergenic
1091979540 12:4853990-4854012 GGGCCAGCTGGAGGGCAGCCTGG - Intergenic
1096477374 12:51916354-51916376 GAACCAGCTGGTGGGCAGCATGG - Intronic
1097289843 12:57905481-57905503 GAACCATCTGGTGGCCAGAAAGG + Intergenic
1099610064 12:84857132-84857154 GGACCAGCTTTTGGCCAGACGGG - Intergenic
1100799044 12:98212285-98212307 GAACCAGCTCGTGCCCAGAGAGG - Intergenic
1102075351 12:110055624-110055646 GAGCCAGCTGTGGGGGAGACCGG + Intronic
1102666491 12:114578378-114578400 GAACAAGGTGGAGGGCAGAGGGG - Intergenic
1103620600 12:122184899-122184921 GAAGCAGATGGAGGGCAGGCTGG - Intronic
1103952795 12:124560474-124560496 GAAACAGGTGGTGGGCTGGCCGG + Intronic
1103967155 12:124647062-124647084 GCAGCAGATGGAGGGCAGACAGG + Intergenic
1105219401 13:18311463-18311485 GATCCAGCTGGTGAACAGCCGGG + Intergenic
1105846336 13:24297458-24297480 ACACCAGCTGGTGGTCAAACAGG - Exonic
1106634247 13:31510127-31510149 CAGCAAGCTGGTGGGCAGTCAGG + Intergenic
1108527511 13:51298609-51298631 AAACCAAGTGGTGGGCAGACAGG - Intergenic
1112760044 13:102684797-102684819 GAAGAACCTGGTGGGAAGACAGG - Intergenic
1112807263 13:103176510-103176532 TAACCAGCTGGTGGCCACAATGG - Intergenic
1115727259 14:36230702-36230724 GAACTATCTGGTGAGCAGAGAGG + Intergenic
1116286869 14:42985495-42985517 AAAACAGCTGGTGGGCAGGGGGG - Intergenic
1122024577 14:98866480-98866502 GACGCAGATGCTGGGCAGACAGG - Intergenic
1122307301 14:100773909-100773931 GATCCACCTGTAGGGCAGACAGG + Intergenic
1122475118 14:102002521-102002543 CAAAAACCTGGTGGGCAGACAGG - Exonic
1122672714 14:103384827-103384849 CAAGGAGCTGGTGGTCAGACGGG - Intergenic
1122814571 14:104306195-104306217 CCACCAGCTGTCGGGCAGACGGG + Intergenic
1122834416 14:104423938-104423960 GGCCCAGCTGGAGGGCAGCCTGG - Intergenic
1122984485 14:105205907-105205929 GCACCAGCAGGTGGGCGGATTGG - Intergenic
1124077570 15:26460842-26460864 AAGCCAGCTGATGAGCAGACAGG - Intergenic
1124216620 15:27812867-27812889 GAAGCAGCTGCTGGGCTGGCTGG - Intronic
1124974957 15:34522731-34522753 GGACCAGTTGGTTGGAAGACAGG + Intergenic
1128314552 15:66652500-66652522 CAATCACCTGGTGGGCAGCCAGG - Intronic
1129544453 15:76380058-76380080 GACGCAGCTGATGGGTAGACTGG + Intronic
1130088714 15:80801231-80801253 GAACCAGCTGGTTGACCCACAGG - Intronic
1132026188 15:98406155-98406177 GCAACAGCTCGTGGGGAGACAGG + Intergenic
1132589647 16:721073-721095 GAACCCGCGGGAGGGCAGCCGGG + Exonic
1133252572 16:4493198-4493220 GAATTAGCTGGTAGGCAGACGGG - Intronic
1133360487 16:5169991-5170013 GACCCAGCTAATGGGCAGAAAGG - Intergenic
1136549143 16:30973051-30973073 GAAGCAGCGGGTTGGAAGACTGG + Intronic
1138016479 16:53433473-53433495 GAGCCAGCTGAACGGCAGACAGG + Intergenic
1138469565 16:57222558-57222580 GAATCAGATGATTGGCAGACTGG - Intronic
1138744911 16:59352363-59352385 GAACCAGCTGTGTGGGAGACCGG + Intergenic
1139594608 16:67950450-67950472 GAACTTGGTGGTGGGCACACTGG - Exonic
1139650075 16:68357812-68357834 GCACCAGCTGGTGGCCTGCCAGG + Exonic
1139890981 16:70253158-70253180 TAACCAACCGGTGGGCAGAAAGG + Intronic
1140141757 16:72265005-72265027 GAACCATGTGGTGAGCAAACAGG + Intergenic
1141996488 16:87639385-87639407 GAAGCTCCTGGTGGGCAAACTGG + Intronic
1142157141 16:88537733-88537755 GAACCAGCTGGGGGGCCGAGGGG - Intergenic
1142160660 16:88555773-88555795 GAGCCAGGGGGTGGGCAGAGGGG - Intergenic
1142213700 16:88820861-88820883 GAACAAGCTGCTGGCCACACCGG - Intronic
1142289307 16:89185491-89185513 GAACCCACTGATGCGCAGACAGG + Intronic
1142348342 16:89568434-89568456 GGAGCAGGTGCTGGGCAGACAGG + Intergenic
1142492786 17:289498-289520 GAACCAGCTGGAGGACAGCGCGG - Intronic
1142987758 17:3707199-3707221 AAACTAGGTGGTGGGCAGACCGG + Intergenic
1143378509 17:6481031-6481053 AACCCAGCTGGTGGGGAGAAAGG - Intronic
1143732801 17:8890537-8890559 TAACCAGCTGGGTGGCAGCCTGG - Intronic
1143778063 17:9212515-9212537 TCACCTGCTGGTGGGCAGAATGG + Intronic
1145233225 17:21190214-21190236 GGACCAGCTGGCAGGCACACAGG - Intronic
1149568067 17:57653361-57653383 GAGCTAGCAAGTGGGCAGACTGG + Intronic
1150128979 17:62656477-62656499 GAACCAGATGCTGGGCACAGTGG - Intronic
1152007105 17:77689225-77689247 GAACCAGGTGATGAGCAAACAGG + Intergenic
1152036902 17:77879316-77879338 GTACCTGCTGGTGGGGAGAGGGG + Intergenic
1152308154 17:79533150-79533172 GAACCAGCTGGTGGGCAGCTGGG + Intergenic
1154001275 18:10484204-10484226 GAACCTGGAGGCGGGCAGACCGG + Intronic
1155813030 18:30262301-30262323 GAACAATCTGTTGGGCAAACTGG - Intergenic
1156536273 18:37867518-37867540 GAGCCAGCTGCTGGGCAGAGTGG + Intergenic
1157313813 18:46572156-46572178 CAACCACCTGGTGGGCAAATGGG + Intronic
1157966188 18:52211020-52211042 GATCCAGGTGGTGGGCAGAGAGG + Intergenic
1160603458 18:80032252-80032274 AAACCAGCAGGTGGGAAGAAAGG + Intronic
1161319874 19:3636236-3636258 CAGCCAGCAGCTGGGCAGACAGG + Intronic
1162535588 19:11261706-11261728 GAACCAGCTGGTGGGCAGACGGG - Intronic
1162827333 19:13261395-13261417 GAACCAGCAGGTGGGCAGGGGGG - Intronic
1163362273 19:16854438-16854460 GAACCAGCTGGAGGGTACCCAGG - Intronic
1163402460 19:17102329-17102351 GAACCAGCAGCTGGGCAAGCTGG + Exonic
1163829256 19:19540038-19540060 GAAACAGGTGCAGGGCAGACTGG - Intronic
1165259995 19:34605427-34605449 GAACAAGCTGGTGGCCACTCAGG - Intronic
1165272273 19:34720954-34720976 GAACAAGCTGGTGGCCACTCAGG + Intergenic
1167526855 19:49989540-49989562 GAGACAGCAGGTGGCCAGACAGG - Intronic
1168403640 19:56099822-56099844 AGACCAGCTGGGAGGCAGACGGG + Intronic
925014995 2:516316-516338 AAACCAGCTGCAGGGCAGAGCGG - Intergenic
925149004 2:1601728-1601750 GAACCAGCTGGGCTGCAGAGGGG + Intergenic
926331508 2:11829528-11829550 GATCCAACTTGTGGGCAGAGGGG + Intergenic
926718509 2:15942316-15942338 GAACGAGCTGTGGGGCAGCCCGG + Exonic
927630234 2:24766821-24766843 GAGGCAGCTGGAGAGCAGACTGG + Intronic
927892864 2:26763407-26763429 GAACCTGCTGGTGAGCAGTGGGG - Intergenic
928314797 2:30236812-30236834 GAATCAGAGGGAGGGCAGACTGG + Intronic
932494657 2:72140365-72140387 GCACCAGCGGGTGGGCACAGGGG - Intronic
932711612 2:74069513-74069535 GATCCAGGTGGTGGTCACACAGG - Intronic
933758382 2:85658365-85658387 GCAGCAGCTGGAGGGCAGGCTGG + Exonic
934045694 2:88170916-88170938 GAACAAGAAGGTGGGTAGACAGG - Intronic
934184647 2:89661050-89661072 GATCCAGCTGGTGAACAGCCGGG - Intergenic
934294930 2:91735188-91735210 GATCCAGCTGGTGAACAGCCGGG - Intergenic
934573140 2:95384565-95384587 GGACCAGCTGGGGGGCAGGGGGG + Exonic
935194047 2:100800920-100800942 GAACCAGTTGGTGGAGAGGCTGG - Intergenic
937153457 2:119701704-119701726 GAGCCAGCTGGGCGGGAGACCGG + Intergenic
938764964 2:134454753-134454775 GAAACGGCTGGTAGGAAGACAGG + Intergenic
941026331 2:160460267-160460289 GAAGCAGGTGGTGAGCAGCCTGG + Intronic
946053858 2:216884661-216884683 GAAGCAGCAGCTGGGCTGACAGG + Intergenic
948005863 2:234607099-234607121 GACCCATCTGGTGGGGAGACAGG - Intergenic
1170426656 20:16241861-16241883 TCACCAGCAGGTGAGCAGACTGG + Intergenic
1173979107 20:47209086-47209108 CAGCCAGGTGGTGGGCACACTGG - Intergenic
1174171606 20:48621161-48621183 GCACCACCTGCTGGACAGACAGG + Intergenic
1175888755 20:62306844-62306866 GAACCAGCTTGCGGACACACAGG - Intronic
1176038628 20:63052565-63052587 GAAACTGCAGGTGGACAGACAGG + Intergenic
1178340092 21:31778826-31778848 TACCCAGCAGGTGGGCAGTCAGG + Intergenic
1180817002 22:18796323-18796345 GATCCAGCTGGTGAACAGCCGGG + Intergenic
1181009002 22:20029281-20029303 GAAGCAGAAGGTGGGCAGAGAGG + Intronic
1181203191 22:21230668-21230690 GATCCAGCTGGTGAACAGCCGGG + Intergenic
1183019043 22:35012645-35012667 GAACGAGCAGGTGGGCACCCAGG - Intergenic
1183122178 22:35738505-35738527 GAAGCAGCTTTTGGACAGACTGG + Intergenic
1183376736 22:37469730-37469752 GGACCAGGTGGTGGCCAGAGAGG - Exonic
1183521920 22:38300575-38300597 GCACGAGCTTGGGGGCAGACGGG + Intronic
1183751872 22:39725505-39725527 GAGACAGGTGGTGGGGAGACAGG - Intergenic
1184492248 22:44816383-44816405 GAGACGGCTGGTGGGAAGACAGG - Intronic
1184693618 22:46128316-46128338 GTCCCAGCTGGGGGGCAGTCTGG - Intergenic
1203223728 22_KI270731v1_random:64756-64778 GATCCAGCTGGTGAACAGCCGGG - Intergenic
1203267101 22_KI270734v1_random:22044-22066 GATCCAGCTGGTGAACAGCCGGG + Intergenic
952507089 3:34017050-34017072 GAATCACCTAGTGGGCAGAGAGG + Intergenic
953245802 3:41190678-41190700 GAACCACCTGATTGGCAGAGGGG + Intergenic
953802016 3:46031599-46031621 GAACAAGCTCCTGGGCAGAAAGG + Intergenic
953980165 3:47409639-47409661 GTTCCACCTGGTGGGCAGAAGGG - Exonic
954378628 3:50207780-50207802 GGACCAGCTGCTGGGCAGGAGGG + Intronic
954411923 3:50374604-50374626 GCACCTGAGGGTGGGCAGACTGG + Intronic
955655612 3:61242000-61242022 TAACCTCCTGGTGGGCAGAAAGG + Intronic
956060131 3:65340733-65340755 GAGCGAGCTGGTGGGCAGCTGGG + Intergenic
959068146 3:101678096-101678118 GAAGTAGCTGACGGGCAGACAGG + Intergenic
961537997 3:127581515-127581537 GATCCAGGTGGTGGGTACACAGG + Intronic
961613424 3:128159685-128159707 GAAGCAGCTGGTGGGCCCACTGG - Intronic
965890055 3:173501256-173501278 GAACCTGCTGGTGGACTGCCGGG - Intronic
969332876 4:6490102-6490124 GAACCAGCTGGTGGGAGGGACGG - Intronic
972616699 4:40705154-40705176 CAAGCAGCTGGGGGACAGACTGG - Intergenic
976707379 4:88033485-88033507 GCACCATCTGCTGGACAGACAGG - Intronic
981822538 4:148902561-148902583 GAACCAGTTGCTGGGCATGCTGG + Intergenic
982486952 4:155977630-155977652 GAACCAGCTGTGCGGGAGACCGG + Intergenic
984512977 4:180701555-180701577 GAGCCAGCTGGTGGCCCAACAGG + Intergenic
985528943 5:422499-422521 GCACCACTTGGCGGGCAGACGGG + Intronic
985894116 5:2739056-2739078 GAACCCGCTGGAGGGCTGCCTGG - Intergenic
986178339 5:5370790-5370812 GAAACAGCAGGTGGGCAAACAGG - Intergenic
991207689 5:64068078-64068100 GAACCAGCTGTGTGGGAGACCGG - Intergenic
992184676 5:74232506-74232528 GGACCAGCTGGTTGGCAGGGGGG - Intergenic
993877714 5:93327619-93327641 GAACCAGCTGTTGGCCATGCAGG + Intergenic
997328641 5:133043194-133043216 GAAGTAGATGGTGGGCAGGCTGG - Intergenic
997527742 5:134564388-134564410 AAACTAGGTGGTGGGCAGACAGG - Intronic
997828451 5:137128587-137128609 GAAGCAGCTTGAGGGCAGAGTGG + Intronic
999384563 5:151145145-151145167 GTGCCAGCTGGTGAGCAGCCGGG + Intronic
1000300972 5:159955585-159955607 GAACCTGCTGGCTGGCAGAGAGG - Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1003097550 6:3154621-3154643 CCACCAGCTGGTGGACAGAGAGG + Exonic
1008961224 6:57268250-57268272 GCACCACCTGGTGGGCATTCTGG - Intergenic
1009434116 6:63598740-63598762 GAACCAGCAGGTGGCAAGAGAGG + Intergenic
1013616783 6:111850820-111850842 AACCCAGCTGTTGGGCACACAGG - Intronic
1015057099 6:128916828-128916850 GATCCAGCTGGAGGGCCAACAGG - Intronic
1015600240 6:134904392-134904414 GAACCAGGTGGAGGGCCTACAGG - Intergenic
1015940643 6:138448220-138448242 GAACCAGCTGCTGTGGAGCCAGG - Intronic
1016028726 6:139315313-139315335 GAGCCAGCTGTGGGGGAGACTGG - Intergenic
1017771970 6:157650836-157650858 CAGCAAGCTGGTGGGGAGACAGG - Intronic
1018458124 6:163971241-163971263 CACCCAGCTGGTGGGGACACTGG + Intergenic
1019548303 7:1589208-1589230 TACCCTGCTGGTGGGCAGTCTGG + Intergenic
1019564900 7:1674386-1674408 GAACTAACTGCTGGGCAGAAGGG - Intergenic
1022557605 7:31314973-31314995 GAATCAGCTGGTAGCCAGATAGG - Intergenic
1022612955 7:31895307-31895329 GGACAAGCTGGTGGGGAGAAAGG + Intronic
1022681154 7:32547580-32547602 GAACCAGGGAGTGGGGAGACAGG - Intronic
1023050727 7:36248792-36248814 GAAAGAGCTGGTGAGCAGATTGG + Intronic
1025606957 7:63046368-63046390 GACCCAGGTCGTGGGCAGCCTGG + Intergenic
1029544536 7:101203269-101203291 TAACTAGCTGGGGAGCAGACGGG + Intergenic
1033778862 7:144645931-144645953 TGATCAGCTGGTGGGCAGATGGG + Intronic
1034183149 7:149154187-149154209 GAACCAGCTGGAGGGCAAGTGGG + Exonic
1034196247 7:149250395-149250417 GAACCAGCTGGAGGGCAAGTGGG + Exonic
1034198587 7:149266577-149266599 GAACCAGCTGGAGGGCAAGTGGG + Exonic
1034227353 7:149494335-149494357 GAACCAGCTGGAGGGCAAGTGGG - Exonic
1034242531 7:149621391-149621413 GAACCAGCTGGAGGGCAAGTGGG - Intergenic
1034441440 7:151087702-151087724 GAGGCAGCTGCTGGGCAGCCGGG + Intronic
1034704212 7:153126175-153126197 TAAGCAGCTGGCGGGCAGAATGG + Intergenic
1035245750 7:157561164-157561186 GAACCAGAGGGCGGGGAGACTGG - Intronic
1035245775 7:157561239-157561261 GAACCAGAGGGCGGGGAGACCGG - Intronic
1035673782 8:1440403-1440425 AAACCAGCTGGATGGCACACAGG + Intergenic
1035700622 8:1637048-1637070 GAGCCAGCCGGCGGCCAGACGGG - Intronic
1035886921 8:3301300-3301322 GAACCAGGTGGTGGGCAGGGAGG + Intronic
1036726495 8:11225341-11225363 GACCCAGGAGGTGGGAAGACAGG - Intergenic
1037379410 8:18268495-18268517 GAGCAAGCTGGTGGGCAGTCAGG + Intergenic
1041256514 8:55983638-55983660 GACCCTGCTGGTGGGCAGCTAGG - Intronic
1043570645 8:81599189-81599211 GAGCCAGCTGTAGGGGAGACTGG + Intergenic
1045811865 8:106231278-106231300 AACGCAGCTGGTTGGCAGACTGG + Intergenic
1048657146 8:136553005-136553027 GAACCATCTGGTGAGAAGCCCGG + Intergenic
1049260267 8:141635291-141635313 GCACCAGCAGATGGGCAGAGAGG - Intergenic
1049745314 8:144260763-144260785 GGACCAGGTGGTGGGCGGGCTGG + Exonic
1053872127 9:42503343-42503365 GAGCCAGCTGGGCGGGAGACTGG - Intergenic
1054261022 9:62864922-62864944 GAGCCAGCTGGGCGGGAGACTGG - Intergenic
1057964201 9:99487613-99487635 GATCCAACTGATGGGCTGACCGG - Intergenic
1058453458 9:105117690-105117712 TAGCCAACTGGTGAGCAGACAGG + Intergenic
1059300563 9:113309405-113309427 GAGCCAGATGGAAGGCAGACAGG + Intergenic
1059661714 9:116408019-116408041 TTACCTGCTGGTGGGCAGAGTGG + Intergenic
1060545203 9:124455173-124455195 CAACCAGCTGGTGGCTAGGCTGG - Intronic
1061620744 9:131809856-131809878 CAGCCTGCTGGTGGGCACACAGG + Intergenic
1061924140 9:133797733-133797755 GAACCAGCTCCTGGCCAGCCGGG - Exonic
1062053529 9:134459148-134459170 GAACTAGCTGGGGGTCACACAGG - Intergenic
1062626971 9:137447798-137447820 GAACCAGCTGGCAGCCAGCCTGG + Exonic
1186747376 X:12583670-12583692 CAACCAGCTGGACCGCAGACAGG - Intronic
1189281789 X:39824264-39824286 GAACCAGAGGGTAGGCAGACAGG - Intergenic
1189348833 X:40262302-40262324 GGCCCAGCTGGTAGGCAGACCGG - Intergenic
1189658488 X:43272838-43272860 GAACCATCAGGCAGGCAGACAGG - Intergenic
1190719369 X:53134498-53134520 AAGCCAGCTGGTGGGTAGATGGG + Intergenic
1191662516 X:63665897-63665919 GGACCATCTGGTGGTCAAACAGG + Exonic
1194745667 X:97625764-97625786 GATGCAGCTGGTTTGCAGACTGG - Intergenic
1194932484 X:99904400-99904422 GAGCCAGCTGTGGGGGAGACTGG + Intergenic
1198305940 X:135383151-135383173 GAAGCAGCAGGAGGGTAGACTGG - Intergenic
1198445213 X:136706690-136706712 GTACCAGCTGATGGGGATACAGG - Intronic