ID: 1162535826

View in Genome Browser
Species Human (GRCh38)
Location 19:11262448-11262470
Sequence GCGTCCCGCCGCCGCCGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 1, 2: 16, 3: 60, 4: 422}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162535818_1162535826 29 Left 1162535818 19:11262396-11262418 CCTGTTGATCTTGTGCGCGAAGG 0: 1
1: 0
2: 1
3: 3
4: 13
Right 1162535826 19:11262448-11262470 GCGTCCCGCCGCCGCCGCCCCGG 0: 1
1: 1
2: 16
3: 60
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162535826 Original CRISPR GCGTCCCGCCGCCGCCGCCC CGG Exonic
900180196 1:1307889-1307911 TCGTCCCGCCCGCGCCGCCTCGG + Exonic
900364137 1:2303930-2303952 GTGTGCCGCCGCCGTCTCCCGGG + Exonic
900513014 1:3069318-3069340 GCGCCGCGCCGCCGGGGCCCGGG + Intronic
900540163 1:3198634-3198656 GCCTCCAGCAGCAGCCGCCCAGG + Intronic
900624026 1:3600064-3600086 GGGTCCCGCCTCAGCTGCCCCGG + Intronic
900640032 1:3684222-3684244 CCGCCCCGCCTCCGCCGCCCAGG + Intronic
900970964 1:5992252-5992274 CCGACCCGCCGCGGCCGCGCCGG + Exonic
900971108 1:5992837-5992859 GATACCCGCCGCCGCCGTCCCGG - Intronic
901045372 1:6393000-6393022 CCGTGGCGCGGCCGCCGCCCTGG + Intronic
901084662 1:6603091-6603113 GCGTCTCCCCGCTGACGCCCGGG + Intronic
901535938 1:9883097-9883119 CCGTCCCGCTGCTGCCACCCAGG - Intronic
901631249 1:10649232-10649254 TCGTCCCCCCGCACCCGCCCTGG - Intronic
901797842 1:11691146-11691168 CCGTCCCGCCTCCCCCGCCCTGG + Intronic
902214329 1:14924714-14924736 GCCTCCCGCTGCACCCGCCCGGG - Intronic
902323566 1:15684296-15684318 TCCTGCCGCCGCCGCCGCCGCGG + Intergenic
902585711 1:17437883-17437905 GCGCCCCTCCCCCCCCGCCCCGG - Intronic
902823110 1:18955637-18955659 CCGCCCCTCCCCCGCCGCCCTGG - Intronic
903132767 1:21290326-21290348 GCCTCCCGCCCCCGCCCTCCAGG + Intronic
903413677 1:23167761-23167783 GCGACCCGCAGCGGCCGCGCTGG - Intronic
903883764 1:26529773-26529795 GCCGTCCGCCGCCGCCGCCGCGG - Intronic
903931544 1:26865104-26865126 CCGTCCCGCCTTCGCAGCCCTGG + Intergenic
904181398 1:28668988-28669010 GCGTGCCGCCGCCGCCGCCGGGG + Intronic
904252931 1:29237667-29237689 GGGCCCCGCGGCCGCCGCCTCGG + Intronic
904620453 1:31772032-31772054 CCGCGCCGCCGCCGCCGCCACGG - Intergenic
904659250 1:32072692-32072714 TCCTCCGGTCGCCGCCGCCCCGG + Intronic
905990785 1:42335283-42335305 GCGTCGCTGCGCCGCCGGCCCGG + Intronic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
906662541 1:47593269-47593291 GCGGCCCGCCGCCGCCAGCCCGG + Intergenic
910427637 1:87132420-87132442 GCCTCCCGAGGCCGCCGCGCCGG - Intronic
915511346 1:156388564-156388586 TGCGCCCGCCGCCGCCGCCCAGG + Intergenic
918388764 1:184037056-184037078 GCGTCCCGCCGCGGCGGCCCGGG + Intronic
919463241 1:197902936-197902958 CCGCCCCGCCGCGGCCGCCCCGG + Intronic
920660586 1:207911148-207911170 TCTTCCCGCCCCCTCCGCCCGGG + Exonic
921029700 1:211326761-211326783 GCGCCCCTCCGCCCGCGCCCCGG + Intronic
921152770 1:212414913-212414935 GCGCCTGGCCGCTGCCGCCCAGG + Intergenic
921155159 1:212433228-212433250 GCGGCCCGCGGCGGGCGCCCTGG + Intronic
922513146 1:226186475-226186497 GCCCCCAGCCGCCGCCTCCCCGG + Exonic
922730881 1:227948197-227948219 CCGTCCCGCCGTGGTCGCCCCGG - Intergenic
922821408 1:228487922-228487944 GCGCCTCTCCGCCCCCGCCCCGG + Intronic
923372369 1:233327402-233327424 TCGTCCCGCCCCTGGCGCCCGGG - Intergenic
923506545 1:234609995-234610017 CCGCCCGGCCGCCGCCACCCCGG - Intergenic
924289724 1:242524715-242524737 CCCCGCCGCCGCCGCCGCCCCGG - Intergenic
1064230780 10:13528439-13528461 GCTGCCTGCCCCCGCCGCCCCGG + Intronic
1064622443 10:17229379-17229401 CCGCGCCACCGCCGCCGCCCAGG + Exonic
1065069027 10:22003351-22003373 CGTTCCCGCCGCCGCCGCCGCGG - Exonic
1065844716 10:29735541-29735563 GCGCCCCGTCGCAGCGGCCCGGG + Intronic
1067474420 10:46556613-46556635 GCCGCCCGCCGCCGTCGGCCCGG + Intergenic
1067972810 10:50991711-50991733 CCGACCCGCCCCCGCCGCCGCGG - Intronic
1069019145 10:63465992-63466014 GCTGCGCGCCGCCGCTGCCCGGG - Intergenic
1069474572 10:68721393-68721415 GAGCCCCACCGTCGCCGCCCGGG - Intronic
1070570673 10:77637841-77637863 GCGAGCCGCCGCCGCCCGCCCGG + Intronic
1070800837 10:79243560-79243582 CCGCGCCGCCGCCGCCGCCGGGG + Intronic
1071527464 10:86366645-86366667 GCGGGCCGCCCCCGCCGCGCCGG - Intergenic
1071997486 10:91162731-91162753 GCCTCTCGCCGCCGCCCGCCAGG - Intergenic
1072409069 10:95183875-95183897 ACCTGCCGCCGCCGCCGCCCCGG + Intergenic
1072891606 10:99329723-99329745 GGGCCACGCCGCCACCGCCCGGG - Exonic
1072930674 10:99659478-99659500 ACGTGGCGCCGCCGCCGGCCGGG + Intergenic
1073051654 10:100671116-100671138 GAGACCCGCCGCCTCCGCCGGGG + Intergenic
1073287877 10:102399364-102399386 GCGCCCCGCCCCCGCCTCCCGGG - Exonic
1075645454 10:124093304-124093326 GCGCGCCGCCTCCGCCGGCCCGG + Intronic
1076638849 10:131900824-131900846 GCTTCCCTCCGCAGTCGCCCAGG + Exonic
1076723982 10:132404916-132404938 GGGTGCCCCAGCCGCCGCCCAGG + Exonic
1076792811 10:132785949-132785971 GGGCGCCGCCGCCGCCGGCCCGG + Exonic
1076985973 11:236359-236381 TCGCCCCGCCCCCGGCGCCCCGG + Exonic
1077090625 11:776876-776898 GCGCCCCGCGGCCCCCGTCCTGG - Intronic
1077107950 11:849976-849998 GCGCCCCGCACCCGCCGCCCCGG - Intronic
1078266246 11:9758161-9758183 GCGCCCCGCCTCCCTCGCCCAGG - Intergenic
1079689405 11:23403534-23403556 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1080283600 11:30585391-30585413 GCGCCCCGCGGCCGCCCCCGGGG - Intronic
1081845597 11:46238350-46238372 GCGCCGCGCCGCCTCCGCCCGGG - Intergenic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083663993 11:64265041-64265063 GCCTCCCCCCGCCGGCCCCCTGG + Exonic
1083940021 11:65890736-65890758 CCCGCCCGCCGCCGCGGCCCAGG - Exonic
1084028404 11:66466946-66466968 CCATCCCGCCGCAGCGGCCCGGG + Exonic
1084546851 11:69818952-69818974 GCCTGCAGCCGCCGCCGCCGCGG - Exonic
1087175191 11:95089754-95089776 CGGACCCGCCCCCGCCGCCCGGG + Intergenic
1089432715 11:118436697-118436719 GCTTCCCGCCGCCGCCGCCGCGG - Exonic
1089499922 11:118925842-118925864 GCCGCGCGCCGCCGCCTCCCCGG + Intronic
1089520040 11:119057240-119057262 CGGCCCCGCCCCCGCCGCCCCGG + Intergenic
1091303740 11:134523879-134523901 GCGTCTCCCCGCGGCCGGCCCGG - Intergenic
1091303759 11:134523941-134523963 GCGTCTCCCCGCGGCCGGCCTGG - Intergenic
1091558654 12:1594365-1594387 GCCGGCCGCCGCCGCCGCCTCGG + Intronic
1092169343 12:6363530-6363552 GGGTCCCGCCCCCGCCTCACGGG - Exonic
1092899498 12:13044823-13044845 CCGTCCCGCCGCCCCCGCCCAGG - Intronic
1094041838 12:26126639-26126661 GCGAGCGGCCGCCGCGGCCCGGG - Intronic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1096191342 12:49622239-49622261 GCGGCCCGCAGCCGCCGCCGCGG - Intronic
1096191528 12:49623343-49623365 GCGTCCCGGGTCCGCCCCCCGGG - Intronic
1097929698 12:65170052-65170074 TCCTCCCGCCGCCGCCGGCCTGG - Exonic
1098161443 12:67649968-67649990 CCCTCCCGCCCCCACCGCCCGGG - Intronic
1099439908 12:82687077-82687099 GCCTCCCCTCGCCGCCTCCCGGG - Exonic
1100391311 12:94148361-94148383 GCCGCCCGCCGCGGCCGCCGCGG - Intergenic
1100391734 12:94150076-94150098 GGGAGCCGCCGCCGCCGCCGAGG + Intronic
1101680054 12:106955968-106955990 GCCGGCCGCCGCTGCCGCCCAGG + Exonic
1102256512 12:111418516-111418538 TGGCCCCGCCGCGGCCGCCCGGG + Exonic
1102678075 12:114672066-114672088 GGGCCCCGCGGCCGCCGCCATGG + Exonic
1102853864 12:116277234-116277256 CCGGGCCGCCGCCGCCGCCGGGG + Exonic
1103474819 12:121210445-121210467 GCCTCCCGCCCCCGGGGCCCCGG - Intronic
1103604879 12:122079017-122079039 GCGCCGCGCCACCGCCGCCTCGG + Exonic
1103649635 12:122422628-122422650 GTGACGCGCCGCCGCCGCCGCGG + Intronic
1103954194 12:124567434-124567456 TCCTCCCGCCGCCGCCTCCTAGG + Intronic
1104448841 12:128853532-128853554 CGGCCCCGCCGCCGCCGACCAGG - Exonic
1104448851 12:128853563-128853585 GCATGCCGCCGCCGCCGCCCGGG - Exonic
1104862038 12:131929028-131929050 TCGCTCCGCCGCCGCCTCCCGGG - Intergenic
1104961472 12:132490296-132490318 GCGGCCCTCGGCCGCCCCCCCGG - Exonic
1104983352 12:132583499-132583521 GCCGCCCGCCGCCCCCGCCTTGG + Exonic
1105725708 13:23160320-23160342 GCGTCCAGCCGGCGGCGCCCTGG + Intergenic
1105964530 13:25372324-25372346 GCCCCGCGCCGCCCCCGCCCCGG - Intronic
1106087649 13:26557790-26557812 CGGTCCCGCCGCCGGCGCCGGGG - Exonic
1106157378 13:27171434-27171456 CCGTCCAACCGCCCCCGCCCGGG + Intronic
1106422479 13:29595415-29595437 GAGCCCCGCCGCCGCCGGCTTGG - Exonic
1106735794 13:32586782-32586804 GCGCCCCGCGACCCCCGCCCCGG - Intronic
1106735836 13:32586914-32586936 GCCCGCCGCCGCCGCCGCCCCGG - Intronic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1107831037 13:44373932-44373954 GCGTCCCGCCGAGGCCCCCGCGG - Exonic
1108373352 13:49792295-49792317 GCCTCCCGTCACCGCGGCCCCGG - Intronic
1110705144 13:78596283-78596305 GCATCCCTCCGCCGCCTGCCTGG - Intergenic
1110705950 13:78602197-78602219 CCGGGCCGCCGCCGCCGCCCGGG + Exonic
1111811997 13:93102788-93102810 CCGCCCCGCCCCCGCCGCCATGG - Intergenic
1111935027 13:94549351-94549373 CCGTCTCGCCACCGCGGCCCGGG + Intergenic
1112091670 13:96090368-96090390 GCGGCCCGCTCCCGCCGCCCCGG - Intergenic
1112402124 13:99086495-99086517 GAGTCCGGCCGCCGCAGCCCAGG + Intronic
1112416362 13:99206448-99206470 GCGTCCCGCAGCCGCTTCCCTGG + Intronic
1113768354 13:112894349-112894371 GCGTCCTGACGCCTCCTCCCAGG - Intergenic
1115849939 14:37583570-37583592 GTGTCCCGCGGTCCCCGCCCAGG + Intergenic
1117029295 14:51652082-51652104 CAGTCCCGCCGCCGCCCCGCCGG - Intronic
1117315112 14:54565991-54566013 GCGTGCCGTCGCCGCCGCCCGGG + Intergenic
1117875893 14:60249620-60249642 GGCTGCCGCCGCCGCCGCCTCGG + Intronic
1117875930 14:60249724-60249746 GCCCGCCGCCGCCGCCGCGCAGG - Intronic
1118351002 14:64972369-64972391 CTGCGCCGCCGCCGCCGCCCCGG + Intronic
1118971596 14:70642222-70642244 GGGCTCCTCCGCCGCCGCCCGGG - Exonic
1120788124 14:88555035-88555057 ACGGGCCGCCGCCGCCTCCCCGG - Intergenic
1121622537 14:95360478-95360500 GAGTCCCGGCGCCGCGGCCAAGG - Intergenic
1122153605 14:99737698-99737720 GCGTCCCGCCCCGGCCGGCCTGG - Intronic
1122425335 14:101602260-101602282 GCGTCCCGTCCCGGCCTCCCTGG - Intergenic
1122624231 14:103075886-103075908 GCGCCCCGCAGCCGCGCCCCGGG + Intergenic
1122968467 14:105142932-105142954 ACTTCACGCCGCCGCCGCGCAGG - Exonic
1123041107 14:105490569-105490591 GCTTCCCTCTGCCGCCGCCACGG - Intronic
1124128911 15:26967868-26967890 GGGTCCCGCCGCCCCCGCCGAGG + Intergenic
1124237672 15:28004010-28004032 CCGTCCAGCCGCTGCCACCCAGG + Intronic
1124427010 15:29570844-29570866 GCGCGCGGCCGCCGCAGCCCTGG - Intergenic
1125516427 15:40323715-40323737 GCGCTCCGCCGCCGCCTGCCCGG - Intergenic
1126574262 15:50182307-50182329 GCGTCCCGCCGCGTGCGCCCCGG + Exonic
1128314062 15:66649086-66649108 GCCTCCGGCCTCCGCCTCCCAGG + Intronic
1128528957 15:68431406-68431428 GTGTCCCGCCGCTGCTGGCCGGG + Intronic
1129052816 15:72796914-72796936 TCTTCCCGCCGGCGCCTCCCCGG + Intergenic
1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG + Intergenic
1129273873 15:74433212-74433234 GCCTGCCCCCGCCCCCGCCCCGG - Intronic
1130076689 15:80695612-80695634 GGCTACCGCCGCCGCCGCCGCGG + Exonic
1130115303 15:81000956-81000978 GCTCGCCGCCGCCGCCGCCTCGG - Exonic
1131186037 15:90275046-90275068 GCGACTCCCAGCCGCCGCCCGGG + Exonic
1131493567 15:92883077-92883099 GGGTCCAGCCGCCGGGGCCCGGG - Intergenic
1132093028 15:98960898-98960920 GCGTCACGCCCCCCCCGCCAGGG + Exonic
1132519790 16:381866-381888 GCCGGCCCCCGCCGCCGCCCGGG + Exonic
1132519822 16:381951-381973 GGTCCCCGCCGCCGTCGCCCCGG + Exonic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1132734718 16:1379692-1379714 GCGCCCCGCCCCCTCCGCGCTGG + Intronic
1132779367 16:1614360-1614382 GCGCCCTCCCGCCGCCGGCCCGG + Intronic
1132848051 16:2009727-2009749 GCGCCCCCCGGCCGCCGCCATGG + Exonic
1132987812 16:2777184-2777206 GCCCCCCGCCGCCCCCGGCCCGG + Intronic
1133171169 16:3983287-3983309 GCCTCCCCCGCCCGCCGCCCTGG - Exonic
1133250368 16:4476640-4476662 GCTTCCGGCCGCCCCCGGCCGGG - Intronic
1133784426 16:8963594-8963616 GCCTCCCGCCGCCGGGGCCGGGG + Intronic
1135034732 16:19067675-19067697 GCGGGGAGCCGCCGCCGCCCCGG - Exonic
1135517754 16:23149484-23149506 GCCTCCCGGCGCCGCCCGCCCGG + Intergenic
1136406780 16:30052933-30052955 GAATCCCGCCGCCGCCCGCCTGG - Intronic
1137084432 16:36102213-36102235 GCTTCCTGCCCCCGCCGCCGCGG - Intergenic
1137412930 16:48244635-48244657 GCCGCCCGCCGCCGCCGCGGGGG - Intronic
1137426559 16:48385348-48385370 GCGCCCCGCAACGGCCGCCCCGG + Intronic
1138651316 16:58463221-58463243 GCTACCCGCCGTCGCCGCCTGGG - Intronic
1139467776 16:67163425-67163447 GCGTTGCGCCGCCGCCACCCTGG + Exonic
1139637121 16:68264524-68264546 CGGTCGCGCCGCCGCCGCCGCGG - Intronic
1139805951 16:69565822-69565844 GCTTCCTGCCGGCGCGGCCCGGG - Intronic
1141949158 16:87329700-87329722 GGCTCCCGCTGCTGCCGCCCTGG + Exonic
1142124694 16:88404359-88404381 ACGCACCGCCGGCGCCGCCCAGG - Intergenic
1142136354 16:88453575-88453597 GCCGCCCGCCGCCGCCCGCCCGG + Exonic
1142163324 16:88570597-88570619 TCCTCCCGCCGCCGCCGGCCCGG - Intronic
1142211907 16:88812383-88812405 CAGGCCCGCCGCCTCCGCCCTGG - Intergenic
1142810524 17:2393672-2393694 GCGGCCCGGCGCCTCCTCCCCGG - Intronic
1143164771 17:4892357-4892379 GCGCCCCCCCGCCGCCCCCTCGG + Intronic
1143483848 17:7242205-7242227 GCGTCCCGCGCCCTCGGCCCTGG + Intronic
1143513571 17:7408312-7408334 GGGTCCCGGCGGCGGCGCCCCGG + Exonic
1143515386 17:7417184-7417206 TCGTCCCCCCGCTGGCGCCCCGG + Exonic
1144185136 17:12789724-12789746 CAGTGCCGCCGCCGTCGCCCGGG + Exonic
1144756186 17:17681839-17681861 GCCTCGCGCCGCCCCCGCCCCGG - Intronic
1145874591 17:28307242-28307264 GCGTCCCGAGGCCGCCTTCCCGG - Intergenic
1146057698 17:29589437-29589459 AGGGGCCGCCGCCGCCGCCCGGG - Exonic
1147285943 17:39402351-39402373 GCGTCCGGCCCCGGCCCCCCAGG - Intronic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1148021807 17:44558234-44558256 GGGGAGCGCCGCCGCCGCCCGGG - Exonic
1148559496 17:48597704-48597726 ACTTCCCGTCGCCGTCGCCCCGG - Intronic
1150239981 17:63623020-63623042 CGGTCCCGCCGCCGCTTCCCCGG - Intronic
1150485043 17:65537553-65537575 GCCTCCCGCGGCCGCCTCGCCGG - Exonic
1150791919 17:68205834-68205856 GTGGGCCGCCGCCGCCGCCTAGG + Intergenic
1150802208 17:68291338-68291360 GCGTGCTGCCGCCCGCGCCCCGG + Intronic
1151559231 17:74861758-74861780 GGGGCCCGCCACCTCCGCCCCGG + Intergenic
1151954390 17:77373270-77373292 CCGCCCCGCCCCCGCCTCCCGGG - Intronic
1152552318 17:81035706-81035728 GCCCGCCGCCCCCGCCGCCCCGG - Intronic
1152728626 17:81959611-81959633 GCCTCCCCCCGCCTCAGCCCTGG + Intronic
1152729123 17:81961254-81961276 ATGTGCCGCCGCCGCCGCCCGGG + Exonic
1152820988 17:82437531-82437553 GCGTCCCTCAGCGGCCGCTCTGG - Intronic
1152828602 17:82483291-82483313 GAGTCTCACCTCCGCCGCCCAGG - Intronic
1153382538 18:4455142-4455164 GCGAACGGCCGCCGCCGCCTCGG - Exonic
1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG + Intergenic
1154214874 18:12408319-12408341 GGCTCCGGCCGCCCCCGCCCCGG - Intronic
1154303998 18:13217801-13217823 GCGCGCCGCCGCGGCCGGCCGGG + Intronic
1157614086 18:48976523-48976545 GCGGAGCGCCGCCGCCTCCCTGG + Intergenic
1157662749 18:49460266-49460288 GGGTCCCTTCGCCGCCGCCCCGG + Intronic
1158427456 18:57352680-57352702 GCCTCCCCCCACCCCCGCCCGGG + Exonic
1158648877 18:59269342-59269364 CCGGCCCGCCACCGCTGCCCGGG + Exonic
1160500748 18:79400253-79400275 CCGCCCCGCCCCCGCCCCCCGGG - Intronic
1160577249 18:79863688-79863710 GGGTCCCGCCGCCGCCGCCCGGG - Exonic
1160597770 18:79988821-79988843 GAGGCCGCCCGCCGCCGCCCGGG + Intronic
1160706306 19:531784-531806 CTGCGCCGCCGCCGCCGCCCGGG - Exonic
1160706345 19:531913-531935 GGGCCCCTCCGCCGCCGCCATGG + Exonic
1160736085 19:663018-663040 GCCGCCCGCCGCCCCGGCCCGGG + Intronic
1160858711 19:1228711-1228733 GCGCCCCGCGGCCCCCGCCCGGG + Exonic
1160930464 19:1567639-1567661 CCCCGCCGCCGCCGCCGCCCCGG - Exonic
1160930702 19:1568310-1568332 CCGCGCCGCCGCCGCCGCCTCGG - Intergenic
1160988705 19:1851952-1851974 GGGTCCCCCGGCCGCCTCCCAGG - Intergenic
1161130976 19:2588533-2588555 GCGTCCAGCTGCCGCCGCCCTGG - Intronic
1161478981 19:4501348-4501370 GCGTCACACCGCTGCCGCTCAGG - Intronic
1161703246 19:5805938-5805960 GCTCGCCGCCGCCGCCGCCGGGG + Intergenic
1161957637 19:7505464-7505486 GCCTCCCACCGCAGCCTCCCAGG + Intronic
1162535826 19:11262448-11262470 GCGTCCCGCCGCCGCCGCCCCGG + Exonic
1162954595 19:14091021-14091043 GCTTTCCCCCGCCCCCGCCCCGG - Intronic
1163334335 19:16661146-16661168 CCGTCCCGCCGCCCGCGGCCCGG - Exonic
1163426911 19:17245225-17245247 GCGCCCCGGCCCCGCTGCCCTGG - Exonic
1163631398 19:18419623-18419645 GCTCCACGCCGCCGCCGCCGGGG - Exonic
1164835081 19:31350766-31350788 CCGCTCAGCCGCCGCCGCCCGGG - Intergenic
1165058640 19:33194460-33194482 GAGCCCCGCCGCGGCCGGCCTGG - Intronic
1165080258 19:33302610-33302632 GCGCCGCGCCGCCGCAGCCCGGG - Intergenic
1165089157 19:33373690-33373712 GCGCGCCGCCGCCGCCATCCCGG - Exonic
1166055317 19:40284978-40285000 ATGGCCCGCCGCCACCGCCCCGG + Intronic
1166290530 19:41860476-41860498 GCACCCCGCCGCTGCCCCCCGGG - Intronic
1166361673 19:42255130-42255152 CCTCCCCGCCGCCGCCTCCCGGG + Exonic
1166386919 19:42387517-42387539 GCCTCCCGACGGCTCCGCCCCGG + Intronic
1166539539 19:43596052-43596074 GCCTCCGTCCGCCGCGGCCCAGG - Exonic
1166765662 19:45251293-45251315 GCCTCCCTCCGCCGCCGCTTGGG + Exonic
1167441868 19:49513405-49513427 GGGTCCCGCGGCCTCAGCCCTGG + Exonic
1167738764 19:51311880-51311902 GCTTCTCGCCGCCGCCGCCCTGG + Exonic
1168297301 19:55383735-55383757 GCTGCCCGCGCCCGCCGCCCCGG + Exonic
1168549365 19:57280418-57280440 AAGTCCCGCCTCCGCCGCCCTGG - Intronic
1168553626 19:57320442-57320464 AAGTCCCACCTCCGCCGCCCTGG - Intergenic
1202669633 1_KI270709v1_random:39505-39527 GCTTCCTGCCCCCGCCGCCGAGG + Intergenic
1202681423 1_KI270712v1_random:7112-7134 GCCCTCCGCCGCCGCCGCCCCGG - Intergenic
925984959 2:9207552-9207574 GCCGCCGCCCGCCGCCGCCCGGG + Intronic
927809400 2:26173191-26173213 GCGCCCCGGGGCCGCCGTCCCGG - Exonic
927904618 2:26847943-26847965 GCCGCGCGCCGCCGCCGCCTGGG - Intronic
929188695 2:39120705-39120727 CCGGCCCGCCGGCGCCGCCCCGG + Intronic
931429051 2:62195603-62195625 GCCTCCCTCCCCCGCCTCCCCGG + Intergenic
931517831 2:63059938-63059960 CGTTCCCGCCGCCGCTGCCCAGG - Intergenic
934251701 2:90360528-90360550 GCTTCTTGCCCCCGCCGCCCCGG - Intergenic
934257734 2:91442415-91442437 GCTTCTTGCCCCCGCCGCCCCGG + Intergenic
934257789 2:91442618-91442640 GCTTCCTGCCCCCGCCGCCGCGG + Intergenic
934618524 2:95790073-95790095 GCGCCCCACAGCCCCCGCCCAGG - Intergenic
934642369 2:96034486-96034508 GCGCCCCACAGCCCCCGCCCAGG + Intronic
936399729 2:112156100-112156122 GCTTCCTGCCCCCGCTGCCCAGG + Intronic
936954763 2:118013409-118013431 TCCTCCCGCCGCCCCGGCCCGGG + Intronic
937408297 2:121650300-121650322 GGGTCTCACCGCCGTCGCCCAGG + Intergenic
938368772 2:130756073-130756095 GCCTCCCTGCGCCGCCGCTCGGG - Intronic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
941951496 2:171160835-171160857 GCCCGCCGCCGCCGCCTCCCGGG - Intronic
942361964 2:175181659-175181681 CCGTGCCGCCGCCGCCTCCTGGG - Exonic
942890493 2:180981011-180981033 CCCCACCGCCGCCGCCGCCCCGG - Intronic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
944457616 2:199911540-199911562 GCGCGCCGCCGCTGCCGCCCGGG - Exonic
945673761 2:212832133-212832155 GCGCCCTGCCTCCGCCGCCATGG + Intergenic
946191646 2:218010687-218010709 TGCTGCCGCCGCCGCCGCCCCGG - Intergenic
946248566 2:218400231-218400253 GGGAGCCGCCGCCGCCGCCCCGG + Intronic
946354924 2:219178483-219178505 GCGTCCCACCGCCTCGGCCGTGG - Exonic
946386878 2:219388581-219388603 GCGACCCGCAGCCGCCGCCAGGG + Intronic
946422214 2:219571303-219571325 GCGCCCCGACCCCGCCGCCCCGG - Intronic
947549836 2:231038037-231038059 GCCTCCAGCAGCCGCAGCCCCGG - Exonic
948438130 2:237967399-237967421 GTCCCCCGCCGCCGCCGCCGCGG - Intronic
948874372 2:240819275-240819297 GCGGCGCGCCCCCGGCGCCCGGG - Intronic
949017920 2:241723900-241723922 TCCTCCCGCCTCCGCCTCCCAGG - Intronic
1169065483 20:2692619-2692641 CCGCCCCGCCGCCGCGGCCCGGG + Intergenic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1170991189 20:21303260-21303282 ACGTCACGGCGCCGCCGCCGGGG - Intergenic
1171427525 20:25058066-25058088 GCCTCCCGACGCCGCGGCCCAGG + Exonic
1172545980 20:35761830-35761852 GCGTCCTGCCTCAGCCTCCCCGG - Intergenic
1173166079 20:40688242-40688264 GCCGCCCGCCGCCGTCGCCGAGG + Exonic
1173279708 20:41617927-41617949 GGGTCCCACCGCGCCCGCCCCGG + Intronic
1175074153 20:56359261-56359283 GGGTCCGGCCGCCTCCGCCAAGG + Intronic
1175715823 20:61253410-61253432 CCGCCCCTCCGCCTCCGCCCAGG - Intronic
1175846953 20:62064626-62064648 CCGTCCCGCCGCCCGCCCCCGGG - Exonic
1176221155 20:63969853-63969875 GCGCCCCGCGCCCCCCGCCCCGG - Intronic
1176285432 21:5016693-5016715 GCCTCCCGCCTCCCCCGGCCGGG - Intergenic
1176380696 21:6111024-6111046 CTGCCCCGCCCCCGCCGCCCGGG - Intergenic
1176546731 21:8205533-8205555 CCGTCCCGCCCCCGTCCCCCGGG + Intergenic
1176548596 21:8212230-8212252 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176554626 21:8249723-8249745 CCGTCCCGCCCCCGTCCCCCGGG + Intergenic
1176556490 21:8256438-8256460 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176565682 21:8388580-8388602 CCGTCCCGCCCCCGTCCCCCGGG + Intergenic
1176567527 21:8395265-8395287 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176573547 21:8432748-8432770 CCGTCCCGCCCCCGTCCCCCGGG + Intergenic
1176575429 21:8439480-8439502 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1178314766 21:31558876-31558898 GCGTCCGGCCGGAGCCGCCCCGG - Intronic
1178513837 21:33229905-33229927 GCGCCGCGCCGCCGCCGGCGCGG - Intronic
1178534984 21:33403627-33403649 GCGTCCCGCCGCGGAGGCCCAGG - Intronic
1178916702 21:36709032-36709054 GCGTCTCCCCGCCGCCTCCCCGG - Intronic
1178992480 21:37367197-37367219 AGGAGCCGCCGCCGCCGCCCGGG + Intronic
1179742776 21:43427216-43427238 CTGCCCCGCCCCCGCCGCCCGGG + Intergenic
1179871749 21:44246782-44246804 GCCTCCCGCCTCCCCCGGCCGGG + Intronic
1179912027 21:44455634-44455656 GCCTCCGGCCGCCGCCGCGCAGG + Exonic
1180073259 21:45449248-45449270 GCTTCCAGCTGCCGCCGGCCAGG + Intronic
1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG + Exonic
1180843598 22:18970352-18970374 GCGCCCCCCAGCCCCCGCCCAGG + Intergenic
1180843612 22:18970378-18970400 GCGCCCCCCAGCCCCCGCCCAGG + Intergenic
1180843675 22:18970535-18970557 GCATCCAGGCGCCGCCGCTCCGG - Intergenic
1181006527 22:20016345-20016367 GAGACCCGCCCCCGCCGGCCCGG + Intronic
1181067354 22:20313216-20313238 GCACCCCCCCGCCCCCGCCCAGG + Intergenic
1181283399 22:21735753-21735775 TCCTCCCGCCGCCGCCCCGCGGG + Exonic
1181381611 22:22508879-22508901 GCGTCCAGCCGTCGCCACCAGGG - Exonic
1181457939 22:23070309-23070331 GCGCCGCGCCGCCGCCGGCAGGG - Intronic
1182335556 22:29581123-29581145 GCGCCCCGCCTCCGCCACCAGGG - Exonic
1183149733 22:36028365-36028387 CGGGCCCGGCGCCGCCGCCCGGG - Exonic
1183427223 22:37746383-37746405 GCCTCCTGCTCCCGCCGCCCTGG + Intronic
1183525001 22:38317492-38317514 CCGGCCCGCCGCCGCCGCCCCGG + Intronic
1183578252 22:38706153-38706175 AGCGCCCGCCGCCGCCGCCCGGG - Intronic
1183702235 22:39457288-39457310 CCGGGCCCCCGCCGCCGCCCCGG + Intergenic
1183744819 22:39686222-39686244 CCGCCCCCACGCCGCCGCCCTGG + Exonic
1183912948 22:41092442-41092464 CCGCGCCGCCGCCGCCGCACCGG - Exonic
1183942069 22:41301617-41301639 TGCTCCCGGCGCCGCCGCCCCGG - Exonic
1184680696 22:46071075-46071097 CCGGCCCGCCCCCGCCGCCCTGG - Intronic
1184759410 22:46536475-46536497 CCGTCGCGCCGGCCCCGCCCGGG + Exonic
1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG + Intergenic
1185313795 22:50170389-50170411 GGTGCCCCCCGCCGCCGCCCCGG + Intergenic
1185313824 22:50170433-50170455 GCGCTCCGCCGCCGCCCCCGGGG - Intergenic
1185349456 22:50326985-50327007 GCAACCCGCGGCCGCCGCCATGG - Exonic
1203251596 22_KI270733v1_random:121799-121821 CCGTCCCGCCCCCGTCCCCCGGG + Intergenic
1203259646 22_KI270733v1_random:166881-166903 CCGTCCCGCCCCCGTCCCCCGGG + Intergenic
1203261534 22_KI270733v1_random:173613-173635 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
950683980 3:14603205-14603227 CCATCCCGCCCCCGGCGCCCGGG - Intergenic
952644651 3:35640123-35640145 CCGAGCCGCCGCCGCAGCCCTGG + Intronic
952764842 3:36944914-36944936 GCATCGCGCCGCCCCTGCCCCGG - Exonic
952816476 3:37452054-37452076 CCGTCCAGCCGCCGCCGCCCGGG + Intergenic
953925435 3:46980203-46980225 GTGTCCGGCCGCCTCGGCCCAGG - Intronic
954112791 3:48444812-48444834 GCTTCCCGCAGCTGCTGCCCTGG - Intergenic
954367814 3:50155515-50155537 CCGTGCCGCCGCCGCCGCCCGGG + Exonic
955368697 3:58332823-58332845 CCTTCCCACGGCCGCCGCCCCGG - Intergenic
955368741 3:58332960-58332982 ACGCCCGGCCGCCGCCGCCTAGG - Exonic
955687692 3:61562589-61562611 GCGTCCCCCAGCCCCCTCCCCGG - Intronic
955916388 3:63912317-63912339 GCGGCCCGCCACCGCGGCGCTGG - Intronic
956678345 3:71754979-71755001 GCGGCCCGGCGCCGTCCCCCAGG + Exonic
961612734 3:128153489-128153511 CCATGCCGCCGCCGCCGCCTCGG - Exonic
962263178 3:133927704-133927726 CCGCCCCTCCGCCGCGGCCCGGG - Intergenic
963133248 3:141877036-141877058 GCACTGCGCCGCCGCCGCCCGGG - Intronic
963904455 3:150762657-150762679 CGGCCCCGCCGCCGCCGCCGGGG + Exonic
966866136 3:184260058-184260080 GCGCCCCCCCGCCCCGGCCCAGG - Exonic
966874516 3:184314753-184314775 GCCACCCTGCGCCGCCGCCCCGG + Intronic
966883247 3:184361565-184361587 CCGTCCCGTCCCCGCAGCCCGGG + Exonic
967055619 3:185826086-185826108 GGCTTTCGCCGCCGCCGCCCGGG - Intergenic
967857805 3:194131445-194131467 GCGTCCCCCCACCCCCGCCCCGG - Intergenic
968317503 3:197736847-197736869 CCCTCCCGCTGTCGCCGCCCGGG - Intronic
968583698 4:1406337-1406359 CGCTCCCGCCGCCGCTGCCCAGG - Intergenic
968659592 4:1793600-1793622 GTTTGCCGCCGCCGCCGCCCTGG + Intronic
968659642 4:1793711-1793733 GCCCGCCGCCGCCGCCGCCCAGG - Intronic
968665514 4:1819782-1819804 GGGTCCCGCCACCGACCCCCAGG + Intronic
968674962 4:1872008-1872030 CCCTCCCACCGCGGCCGCCCCGG - Intronic
969716891 4:8872045-8872067 GCGACCCCCCGCCTGCGCCCGGG - Intergenic
970195213 4:13544911-13544933 GGCTACCGCCGCCGCCGCCGGGG - Exonic
970445310 4:16118995-16119017 GCCTCCCGCCTCAGCCTCCCTGG - Intergenic
971244084 4:24912928-24912950 TCGCGTCGCCGCCGCCGCCCGGG + Intronic
971327430 4:25655737-25655759 GCCTGCCGCAGCCGCCGCCGGGG - Intronic
972396658 4:38664107-38664129 GGGAGCCGCCGCGGCCGCCCGGG - Intergenic
973137316 4:46724426-46724448 GCGCCCTGCCGCCGCCGCCGCGG - Intergenic
975870689 4:78776093-78776115 CCGTCGCGCCGCCGCCGCCCCGG - Intergenic
976390018 4:84497707-84497729 GCCCGCCGCCGCCGCCGCCCGGG - Exonic
976431241 4:84966002-84966024 GGGAGCCGCCGCCGCCGCCAGGG - Intronic
979327312 4:119394997-119395019 CCCTCCCGCCGCCGTCACCCAGG - Intergenic
979565726 4:122152413-122152435 GCCGCCCGGGGCCGCCGCCCAGG - Exonic
981128402 4:141132623-141132645 GCCGCCCGCCGCCCCGGCCCCGG + Exonic
982172842 4:152678519-152678541 CCCTCCCCCCACCGCCGCCCCGG - Intronic
982712205 4:158768942-158768964 CCGCGCCGCCGCCGCCGCCGTGG + Intergenic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
983245195 4:165279685-165279707 CCCTCCCGCCGCCGTCACCCAGG - Intronic
984823912 4:183906982-183907004 ACGTCCCGCGGCCCCGGCCCGGG - Intronic
985713721 5:1444701-1444723 CCGGCAAGCCGCCGCCGCCCTGG + Intronic
985895571 5:2748627-2748649 GCTGCCCGCGGCCGCCGCGCCGG - Exonic
985896299 5:2751570-2751592 CCGCCACCCCGCCGCCGCCCCGG - Exonic
985897317 5:2756445-2756467 GCGCCCCGCCCCCTCCCCCCAGG + Intergenic
986912513 5:12574602-12574624 GCTTCCCCCCGCCCCCGCCGTGG - Intergenic
989576457 5:42992663-42992685 CAGCGCCGCCGCCGCCGCCCGGG - Intergenic
989592216 5:43121839-43121861 GAGTCCCGCGGCCGCGGCTCCGG + Exonic
991435851 5:66596609-66596631 GCGCCGCGCCCCCGCCGCTCGGG + Exonic
992042452 5:72848763-72848785 GGGGCCCCCGGCCGCCGCCCGGG + Intronic
992105516 5:73447195-73447217 GCAGGCCGCCGCCGCCGCTCAGG - Exonic
993770273 5:91917375-91917397 GCGGGCCGGCCCCGCCGCCCGGG + Intergenic
994072733 5:95620473-95620495 AGGGCCCGCCGCCGCCGCACAGG - Exonic
994353835 5:98773860-98773882 GCGCCCCGCTGCTGCCGCCGCGG + Intronic
996329354 5:122312059-122312081 GCTTCGGGCCGCGGCCGCCCAGG + Exonic
997297528 5:132777271-132777293 TTCTCCCGCCGCCGCCGCCAAGG - Exonic
997975375 5:138438957-138438979 GGGGCGCGCCGCCGCCGCCGCGG + Intergenic
997975376 5:138438960-138438982 GCGCGCCGCCGCCGCCGCGGCGG + Intergenic
998131856 5:139655430-139655452 GCCACCCCCCGCCGCCCCCCTGG + Intronic
998166675 5:139848292-139848314 GCGCGCCCCCGCCGCCGCCGCGG - Exonic
1001065072 5:168529582-168529604 CCGCGCCGCCGCCGCCGCCTCGG - Exonic
1002512741 5:179733340-179733362 GCCGCCCGCCGCCACGGCCCCGG + Exonic
1002524166 5:179806428-179806450 CGCTCCCGCCGCCGACGCCCAGG + Intronic
1002559474 5:180071775-180071797 GCGCGCTCCCGCCGCCGCCCGGG - Exonic
1002666771 5:180831184-180831206 GCCCGCCGCCGCCGCCGCCTCGG + Intergenic
1002888172 6:1313421-1313443 GCCGCCCGCGCCCGCCGCCCCGG + Exonic
1002928781 6:1619814-1619836 GCGGCCCGCCACTCCCGCCCGGG + Intergenic
1003139303 6:3457224-3457246 ACGCGCGGCCGCCGCCGCCCGGG + Intergenic
1004044462 6:12011818-12011840 GCGTCCCGCGCCCCTCGCCCCGG + Intronic
1004241349 6:13925045-13925067 GCGTCCCGCCGACCCCTCCCCGG - Intronic
1004395641 6:15245128-15245150 GCGTCCCTCCCCCGCGGCTCCGG + Intergenic
1004516883 6:16328133-16328155 GCCTCCCGCCCCCGTGGCCCCGG + Exonic
1004720429 6:18264162-18264184 CCGCTCCGCCGCCGCCGTCCAGG + Intronic
1006369162 6:33633683-33633705 ACGACGCGCCGCCGCCGCCAAGG - Intronic
1007444511 6:41895019-41895041 GCCTCCCGCCGCCCCCGCCCCGG + Intronic
1008378751 6:50820156-50820178 GCGGCCCGCGCCCGCCACCCGGG - Intronic
1011640169 6:89411295-89411317 GCATCCCCCCGCCGCCCCGCGGG + Intronic
1013117468 6:107114441-107114463 GCTCCCGGCCGCCGCCGCCGCGG + Intronic
1013273255 6:108561081-108561103 GGGCGCCGCCGCCGCCGCCTGGG - Exonic
1015244783 6:131063361-131063383 CGGTCCCGCCCCCGACGCCCAGG + Intergenic
1016010757 6:139135524-139135546 GCAACCGGCCGCCGCCGCCAGGG - Exonic
1016863960 6:148747768-148747790 ACCGCGCGCCGCCGCCGCCCCGG + Intronic
1016949447 6:149566256-149566278 GCGCCTCTCCGCGGCCGCCCGGG + Intergenic
1017164119 6:151391391-151391413 GCGCACCGCCTCCGCCTCCCGGG - Intronic
1017877404 6:158536416-158536438 GCGCCCATCCGCCGCCGCCCCGG - Exonic
1018613055 6:165662158-165662180 CCCGGCCGCCGCCGCCGCCCCGG - Intronic
1018686572 6:166308251-166308273 GCGTCCAGCCGCGGCCTCTCCGG + Exonic
1019048913 6:169168429-169168451 GCCTGGCGCCGCCGCCGCCCTGG - Intergenic
1019184343 6:170212447-170212469 GCTTGCCGCCGCCTCTGCCCCGG + Intergenic
1019498631 7:1353067-1353089 CCTGCCCGCCGCCGCCACCCAGG - Intergenic
1020238524 7:6374696-6374718 GCGCCCTGCCGCCGCCGCCGCGG + Exonic
1024075090 7:45814035-45814057 TCGCCCCACCGCGGCCGCCCGGG - Intergenic
1025777298 7:64570383-64570405 GCTTCTCGCCGCCGCCGCCCTGG - Intergenic
1026360565 7:69598483-69598505 GGCTCCCGCTGCAGCCGCCCGGG + Intergenic
1027219835 7:76206810-76206832 GCCTCCTGCCGCCCCCGCCCTGG + Intronic
1029711119 7:102300568-102300590 TGGCCCCGCCGCAGCCGCCCCGG + Exonic
1030304147 7:108002589-108002611 GCCTCCCGCGGCCCCCGCTCAGG - Intronic
1031051885 7:116953446-116953468 TCGCGCCGCCGCCGCCGCCGCGG - Exonic
1031532028 7:122886796-122886818 GCGCGCCGCCGCTGCTGCCCGGG + Intergenic
1032117003 7:129126308-129126330 GCGAGCCGCCGCCGCTGCCGAGG - Intergenic
1033159054 7:138981142-138981164 TGCGCCCGCCGCCGCCGCCCGGG - Exonic
1033477131 7:141702033-141702055 GGGCGCCCCCGCCGCCGCCCCGG + Exonic
1034470516 7:151252041-151252063 TCCTCCCTCCGCCGCCTCCCCGG - Intronic
1034710232 7:153184838-153184860 GAGGCCCGCCACCGCCCCCCAGG - Intergenic
1035266104 7:157691014-157691036 GAGCCGCGCCGCCGCCGGCCGGG - Intronic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1035752065 8:2002950-2002972 GCGCCTCGAAGCCGCCGCCCTGG - Exonic
1038828495 8:31032985-31033007 GCATCCCTCCGCCGCCCCCGGGG + Exonic
1039542485 8:38382916-38382938 GCGAGCCGGCGCCGCCGGCCGGG - Intergenic
1040055950 8:43056716-43056738 GTCTCGCGCCGGCGCCGCCCTGG - Intronic
1041167342 8:55102653-55102675 GCGAGCAGCCGCCGCCGTCCGGG - Exonic
1042040220 8:64581387-64581409 CCCCGCCGCCGCCGCCGCCCAGG - Exonic
1042278364 8:67028658-67028680 GCGCCCGGCCGCCGCCTCACAGG - Intronic
1042916178 8:73878382-73878404 GCCCCCCGCCGCCCCTGCCCCGG + Intronic
1043464035 8:80487185-80487207 GACCCCCGCCGCCGCCGCCTCGG - Exonic
1043464082 8:80487386-80487408 CCGCCCCGCTGCCGTCGCCCAGG - Exonic
1044335976 8:90985232-90985254 GCCCCCCGCCGCCGCCACCGCGG - Exonic
1045063453 8:98426917-98426939 GCGTGCCTCGGCCGCCGCCCGGG - Intronic
1045114976 8:98972554-98972576 GAGTCCCGCAGCCGCGGCCCGGG + Intergenic
1045547417 8:103141002-103141024 GCCGCCCAGCGCCGCCGCCCCGG + Exonic
1045575389 8:103414967-103414989 GCGTCCCACCTCCGCGGCCCTGG - Exonic
1046871307 8:119208411-119208433 GCCTCCCGCCTCCGCCTCCCGGG - Exonic
1049759863 8:144327041-144327063 GCGGCCCGCAGCCCCGGCCCTGG - Intergenic
1053239945 9:36487408-36487430 GCCCCCCACCGCCGCCGCCCCGG - Intronic
1053306211 9:36986348-36986370 GGGCCCCGCCGCGGCCGCGCCGG + Intronic
1054308897 9:63450848-63450870 GCCCCCCCCCGCCGCCGCCACGG - Intergenic
1054835655 9:69672554-69672576 CGGTGCCGCCGCCGCCGCCGCGG - Intergenic
1057146776 9:92764219-92764241 CCGCCCCGCCGGGGCCGCCCAGG + Intronic
1057922151 9:99105680-99105702 GCTGCCCGCCGCCGCCCCCTGGG + Intronic
1058851220 9:109013511-109013533 GTGTCCTGTCGCCGCCGCCTCGG - Exonic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060405956 9:123373261-123373283 GCGTGCCGCGGCGGGCGCCCTGG + Exonic
1060797074 9:126519973-126519995 AAGTCTTGCCGCCGCCGCCCAGG - Intergenic
1060811771 9:126614365-126614387 GCTCTCCGCCGCCGCGGCCCTGG - Intergenic
1060825106 9:126683289-126683311 GGCTCCCGCCGCCGCCCGCCCGG + Intronic
1060849300 9:126860998-126861020 GAGTCCCGGCGCCGCTGGCCCGG + Intronic
1061231614 9:129319046-129319068 GCCCCCCGTCGCCCCCGCCCTGG + Intergenic
1061559672 9:131394343-131394365 GTCTCCCGCGGCCGCCGCCGGGG + Intronic
1062306182 9:135908028-135908050 AGGTCTCGCCGCCGGCGCCCTGG + Intergenic
1062314732 9:135961159-135961181 ACATCCCGCCGCCGCCGCAGGGG + Exonic
1062332300 9:136050053-136050075 GCAGCCGGCCGCCGCCGCCGCGG - Exonic
1062341385 9:136095213-136095235 GCGGCGCGCCGCAGCTGCCCAGG - Exonic
1062372206 9:136245771-136245793 GCTGCGCGCCACCGCCGCCCCGG + Exonic
1062435731 9:136545874-136545896 GGGACCGTCCGCCGCCGCCCCGG - Intergenic
1062556352 9:137114868-137114890 GCGCCCCGCGGCCGCTGCCCAGG + Intronic
1062621310 9:137423624-137423646 GCGTCCCGGCGCCGCCCGCCAGG + Exonic
1203467998 Un_GL000220v1:104950-104972 CCGTCCCGCCCCCGTCCCCCGGG + Intergenic
1203469880 Un_GL000220v1:111682-111704 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203475819 Un_GL000220v1:148922-148944 CCGTCCCGCCCCCGTCCCCCGGG + Intergenic
1203477701 Un_GL000220v1:155654-155676 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1185469416 X:373717-373739 GCGCCCCGCCGGCCCCGGCCCGG - Intronic
1187915600 X:24149968-24149990 GCGCGCCTCCGCCGCCGCTCGGG - Intronic
1188482999 X:30653476-30653498 CCCTCCCGCCGCCGTCACCCAGG + Exonic
1191184137 X:57592211-57592233 GCCTCCTCGCGCCGCCGCCCGGG - Exonic
1191213251 X:57910236-57910258 GCCTCCTCGCGCCGCCGCCCGGG + Exonic
1194666822 X:96685069-96685091 CGCTCCCGACGCCGCCGCCCCGG - Exonic
1195123428 X:101780580-101780602 CCCTCCCGCCGCCGTCACCCAGG - Intergenic
1195701686 X:107710556-107710578 GTGTCCTGCCGCCCCCCCCCCGG + Intergenic
1195716870 X:107826438-107826460 GCGCCCCCTCGCCGCGGCCCTGG + Intronic
1196707300 X:118727546-118727568 ACTTCCCGGCTCCGCCGCCCTGG - Intergenic
1200126824 X:153819157-153819179 TCGTCCCGGCGCCGCCACGCTGG + Intronic
1200129006 X:153830923-153830945 GCGCCCCTCCCCCGCCGCCGTGG - Intergenic