ID: 1162543001

View in Genome Browser
Species Human (GRCh38)
Location 19:11309410-11309432
Sequence GTGCTGGAACAGAGTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 14, 3: 71, 4: 452}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162543001_1162543006 11 Left 1162543001 19:11309410-11309432 CCTTGCTCACTCTGTTCCAGCAC 0: 1
1: 0
2: 14
3: 71
4: 452
Right 1162543006 19:11309444-11309466 CGCTACTGCTCAGAAACACCAGG 0: 1
1: 0
2: 0
3: 12
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162543001 Original CRISPR GTGCTGGAACAGAGTGAGCA AGG (reversed) Intronic
900495306 1:2973414-2973436 GTGCTGGGGCAGAGGGAGGAGGG + Intergenic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
901198805 1:7455152-7455174 GTCCTGGAACAGACTTAGCAGGG - Intronic
902257026 1:15196219-15196241 GTGCTGTGCCAGAGTGAGCTTGG + Intronic
902284036 1:15394837-15394859 TTGCAGGAACAGAGTTGGCAAGG + Intronic
902742153 1:18446092-18446114 GTGCTGGAACAGAAGGTGCAAGG - Intergenic
902922541 1:19675392-19675414 GTACTGGAACAGTGTGACCTTGG + Intronic
903271089 1:22188727-22188749 GGCCTGGCACAGAGTGAGAATGG + Intergenic
903320561 1:22540663-22540685 TGGCTGGAGCAGAGTGGGCATGG + Intergenic
903427698 1:23266651-23266673 ATTTTGGAAAAGAGTGAGCATGG + Intergenic
903458769 1:23506560-23506582 GAGCTGGAACCGAGAGAACATGG - Exonic
903762116 1:25706177-25706199 GAGCTGGAAGAGAGGAAGCAAGG - Intronic
904046629 1:27613083-27613105 GTGTTGGAACAGGTGGAGCAGGG - Exonic
904203860 1:28839843-28839865 GGGCTGGCCCAGGGTGAGCATGG + Intronic
904343488 1:29853142-29853164 GGGTTGGCACAGAGTGAGCATGG + Intergenic
904648528 1:31986917-31986939 GTGCAGGAACTGTGTGAGCCAGG - Intergenic
905105654 1:35562182-35562204 GGACTGGCACAGAGTGAGCCAGG - Intronic
905522851 1:38613721-38613743 GGGCTGGAAGAGTGTGTGCAGGG + Intergenic
905584874 1:39108413-39108435 GTGCTAGAACAGAGATAGTATGG + Intronic
906188364 1:43879238-43879260 ATGCTGTAACAGGGTGAGGAAGG + Intronic
906645207 1:47469887-47469909 GTGCTGGAACACGTTGGGCAAGG + Intergenic
907184311 1:52598120-52598142 TGGCTGGAGCAGAGTGAGCAAGG - Intergenic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
908248025 1:62243222-62243244 GTGCTGGATCAGGGAGAGCCAGG - Intronic
908647053 1:66289545-66289567 TGGCTGGAACAGAGTGAGCTAGG + Intronic
908853153 1:68394052-68394074 GCGCTGGAAGGGAGTGAGCAAGG - Intergenic
909480166 1:76121887-76121909 GGGCTGGAACAGCGTGAGTGAGG - Intronic
909679063 1:78270993-78271015 TGGTTGGAACAGAGCGAGCAAGG - Intergenic
910394900 1:86782448-86782470 GTGCTGAAACAGGCTGGGCATGG + Intergenic
910537560 1:88316156-88316178 ATGATTGTACAGAGTGAGCAAGG + Intergenic
912560287 1:110546640-110546662 ATTATGGAACAGAGTGAGCAAGG - Intergenic
912900906 1:113647258-113647280 GAGCAGGAACAGATTGAGGAAGG + Intronic
913268991 1:117074387-117074409 GGCCTGGAAAAGAGTGATCATGG + Intronic
913314597 1:117539398-117539420 GTGCTGGAACAGTGTGAGCTGGG - Intergenic
914220728 1:145679607-145679629 CTGGTGCAACAGAATGAGCATGG + Intronic
914473305 1:148002480-148002502 CTGGTGCAACAGAATGAGCATGG + Intergenic
915027097 1:152841356-152841378 CTGCTCTAACAGAGTGAGCGAGG + Intergenic
915349045 1:155213217-155213239 GGGCTGGAGCAGAGAGAGAAGGG - Exonic
915352232 1:155233844-155233866 GGGCTGGAGCAGAGAGAGAAGGG - Intergenic
915603620 1:156937633-156937655 GGGCTGGCAGACAGTGAGCAAGG - Intronic
915989569 1:160500344-160500366 GGGCTGGAGCAAAGTGAACAAGG - Intronic
916024677 1:160823445-160823467 GTTCTGGAACACATTGTGCAGGG - Exonic
916392432 1:164345079-164345101 GGGCTGGAACAGAAACAGCAGGG - Intergenic
917471374 1:175328742-175328764 GAGCTGGAACAGAGGGAGCAAGG + Intronic
918389259 1:184040884-184040906 GTGCTGGAACAGTATGGGGAGGG - Intergenic
918480944 1:184975708-184975730 GGGCTGGAACAGAGAGAACAAGG - Intergenic
919754708 1:201059414-201059436 GAGCTAAAACAAAGTGAGCAGGG - Intronic
919792099 1:201298579-201298601 GGTCTGGAACAGGGTGACCATGG + Intronic
920035106 1:203060455-203060477 GTCCTGGAACATAGTTTGCAAGG + Intronic
921164857 1:212499648-212499670 TGGCTGGAGCAGAGTGAGCAGGG + Intergenic
921342635 1:214149614-214149636 GAGCTGGAACAAGTTGAGCAAGG + Intergenic
921899520 1:220435604-220435626 AAGCTGGAAAAGAGAGAGCATGG - Intergenic
922002460 1:221493880-221493902 GAGCAAGAGCAGAGTGAGCAAGG - Intergenic
922764920 1:228151720-228151742 CTGCTGGGGCAGAGTGGGCATGG + Intronic
923087681 1:230713787-230713809 GTACAGGAACAGAGTCATCATGG - Intronic
923136741 1:231126613-231126635 GTCCTGGAATAGAGTGAGGTTGG + Intergenic
923167169 1:231376910-231376932 TGGCTGGAACACAGCGAGCACGG + Intronic
924800152 1:247323500-247323522 GGGCTGTAACAGAGTGTGCCTGG + Intronic
1065068695 10:22000486-22000508 TGGCTGGAGCAGAGTGATCAAGG - Intronic
1065797620 10:29321785-29321807 GGGCTGGGACAGAGTGAGCAGGG - Intergenic
1065997106 10:31069485-31069507 CTGATGGAACAGAGTGGCCAGGG + Intergenic
1066139554 10:32489718-32489740 AGGCTGGTGCAGAGTGAGCATGG + Intronic
1067101988 10:43340535-43340557 TAGCTGGAACAGAGTGGACAAGG + Intergenic
1067217785 10:44316821-44316843 GTGCTGGCACACAGGGACCAGGG - Intergenic
1067260221 10:44683034-44683056 GTGCTGGAACAGAGATGGCGGGG + Intergenic
1068492633 10:57743162-57743184 TGGCTGGAACAGAGTGAGCAAGG - Intergenic
1069160202 10:65083755-65083777 GGGCTGTAGCAGAGTGAGCAGGG + Intergenic
1069333258 10:67318588-67318610 TAGCTGGAGCAGAGTGAACATGG - Intronic
1069498912 10:68931851-68931873 CTGCTGGAACAGACTGAAAAGGG - Intronic
1069532597 10:69230267-69230289 GGCCTGGAACAGAGCCAGCAGGG - Intronic
1070392107 10:75980321-75980343 GTGCTGGAGAAGGGGGAGCAGGG - Intronic
1070754650 10:78984520-78984542 GGGCTGGAACATAGAAAGCAGGG + Intergenic
1072893337 10:99344503-99344525 GGGCTGGATCAGAGAGAGAAAGG - Intronic
1073027476 10:100498438-100498460 GTGCTTGATCACAGTGGGCAGGG + Intronic
1073172025 10:101518663-101518685 TGGCTGGAACAGAGTGAGCAAGG - Intronic
1074399480 10:113129932-113129954 CTGCTGGAACAGAGAGACCCCGG - Intronic
1075282459 10:121151664-121151686 TGGCTGGAACAGAGTAAACAAGG - Intergenic
1075977057 10:126705223-126705245 CTGCAGGAATAAAGTGAGCAAGG - Intergenic
1076329556 10:129654487-129654509 ATGCAGGCTCAGAGTGAGCAGGG - Intronic
1076365932 10:129921190-129921212 GTGCTGGATCGCAGTGGGCAAGG + Intronic
1076594623 10:131617911-131617933 GTGCAGGAACACAGGGAGCCTGG + Intergenic
1077966988 11:7145453-7145475 AGGCTGGAACAGAGTGAGTGGGG + Intergenic
1078710932 11:13790260-13790282 CAGCTGGAAGAGAGTGGGCATGG - Intergenic
1078795548 11:14588812-14588834 GAGCTGGAGTAGACTGAGCAAGG - Intronic
1080352615 11:31402711-31402733 GTTCAGGAACAGCCTGAGCAAGG - Intronic
1081028343 11:38044815-38044837 GAGCTCAAGCAGAGTGAGCAGGG - Intergenic
1081633460 11:44704982-44705004 TGGCTGGAAAGGAGTGAGCAAGG - Intergenic
1081659551 11:44879638-44879660 TGGCTGGAACAGGGTGAGGAGGG + Intronic
1082776816 11:57251682-57251704 TTGCTGGAACTAAGTGAACATGG + Intergenic
1082914764 11:58420903-58420925 TTGCTGGATCATAGAGAGCAAGG + Intergenic
1083190698 11:61050026-61050048 GAGCTGGAGCAGAGGGAGCCAGG - Intergenic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1083988611 11:66233042-66233064 GCGCTGGATCCGGGTGAGCAGGG - Exonic
1087743056 11:101911802-101911824 TTGCTGGAATAGAGTGAGGTAGG - Intronic
1087946431 11:104165099-104165121 GAGCAGGAACAGACTGAGCAAGG + Intergenic
1088689177 11:112310859-112310881 GGGCTTGAACAGACTGAGGAGGG + Intergenic
1089611656 11:119672720-119672742 TGGCTGGAGCAGAGTGGGCAGGG - Intronic
1090014820 11:123076653-123076675 GGTCTGGAGCATAGTGAGCAAGG + Intronic
1090592758 11:128290492-128290514 GAGCAGGAACAGAGTTTGCAAGG + Intergenic
1090799006 11:130159439-130159461 GTCCTGTAGCAAAGTGAGCAAGG + Intergenic
1091676325 12:2493328-2493350 GCACTGGAACACCGTGAGCATGG - Exonic
1092090557 12:5800240-5800262 TGGCTGGGGCAGAGTGAGCACGG + Intronic
1092836456 12:12493610-12493632 TGGCTGGAGCAGAGTGAGCATGG - Intronic
1093689479 12:22093793-22093815 GTGCTGGAAAGCAGTGAGCTTGG - Intronic
1094105353 12:26805741-26805763 GTCTTGGAACATAGTGAACACGG - Intronic
1094435467 12:30416281-30416303 AGGCTGGAACATAGTGAGAAAGG - Intergenic
1095304496 12:40623899-40623921 GTGGTGGAGCAGAGAGAGTAAGG + Intergenic
1095364410 12:41385393-41385415 GTTCTAGAACAGAATGAACAAGG + Intronic
1096194267 12:49639391-49639413 GGGATGGAAGAGGGTGAGCAGGG + Exonic
1096752797 12:53772982-53773004 GGGCTGGCACAGAGTGAGATAGG - Intergenic
1097365847 12:58711590-58711612 GGCCTGGATCAGAGTGAACAAGG - Intronic
1098445739 12:70564019-70564041 TGGCTGGAACAGAGTGAGCGAGG - Intronic
1098567870 12:71956185-71956207 GTGATCCAAGAGAGTGAGCAAGG + Intronic
1099101704 12:78449512-78449534 GTGGCTGAACAGAGTGAGCTAGG + Intergenic
1099302578 12:80916399-80916421 GAGCTGGAGCAGAGGGAACAAGG - Intronic
1100166350 12:91922248-91922270 AGTCTTGAACAGAGTGAGCATGG - Intergenic
1100554519 12:95679858-95679880 TGGCTGGAACAGAGTAAGCTGGG - Intronic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101520740 12:105479762-105479784 TTGTTGTAACAGAGGGAGCAGGG + Intergenic
1101563259 12:105880413-105880435 GGGGTGGAAAAGAATGAGCAAGG + Intergenic
1101878001 12:108608145-108608167 TAGCTGGAACAGAGTGAGTTAGG + Intergenic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102500510 12:113349013-113349035 GGTCAGGAACAGAGGGAGCAAGG - Intronic
1103725337 12:122994929-122994951 CTGCTGGAATGGCGTGAGCAGGG + Exonic
1103995743 12:124828913-124828935 CTGCTGGTCCAGAGTGGGCAGGG - Intronic
1103995851 12:124829547-124829569 TGGCTGGAGCAGAGTGAGCGAGG - Intronic
1104002423 12:124868716-124868738 TGGCTGGAGCAGAGTGGGCAAGG - Intronic
1104169007 12:126261639-126261661 CCGCTGGAGCAGAGTGAGCCAGG + Intergenic
1104415827 12:128596072-128596094 GTCCTGGTACAGAGGCAGCAGGG + Intronic
1104415885 12:128596364-128596386 GTCCTGGTACAGAGTGGGCAGGG + Intronic
1104415944 12:128596655-128596677 GTCCTGGTACAGAGGCAGCAGGG + Intronic
1104417480 12:128607249-128607271 GGGCTGGAGGAGAATGAGCAAGG + Intronic
1105442883 13:20430014-20430036 GGGCTGGCAGAGAGGGAGCATGG - Intronic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1107451529 13:40514553-40514575 GGGCTGGAACAGAGAGAAGAAGG + Intergenic
1108038303 13:46315432-46315454 TGGCTGGAACAAAGTAAGCAGGG + Intergenic
1108574769 13:51781719-51781741 CAGCTGCAACCGAGTGAGCATGG + Intronic
1110008979 13:70307536-70307558 TTGCTGTAAAATAGTGAGCAAGG + Intergenic
1110111550 13:71753591-71753613 TTACTGGAACAGTGTCAGCAAGG - Intronic
1110469441 13:75842265-75842287 GGGCTGGAACAGAGTGAGTAAGG - Intronic
1111779436 13:92702857-92702879 GTGCTGGAGCAAAATGAACAAGG - Intronic
1112347454 13:98602145-98602167 GTGCCAGAACAGACTGGGCATGG - Intergenic
1112380264 13:98882310-98882332 GAGCTGGGACAGAGGAAGCAGGG + Intronic
1112783322 13:102925833-102925855 GGGCTGGAGCAGGGTGGGCAAGG + Intergenic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1114456325 14:22856411-22856433 TGGCTGGAACAGAATGATCAAGG + Intergenic
1114846887 14:26333188-26333210 TGGCTGGAGCAGAGTGTGCAAGG - Intergenic
1115427529 14:33277744-33277766 TTGCTGGAGCAGAATGAGAAAGG + Intronic
1116350094 14:43850363-43850385 GTGTTGGAACAGAGAGAGATAGG - Intergenic
1116602491 14:46944537-46944559 GTTCTGAAATAGAGTGAGAATGG - Intronic
1117205235 14:53435616-53435638 GTGGTGGCACAGCATGAGCATGG + Intergenic
1117320331 14:54616175-54616197 GTGCATGAGCAGAGGGAGCAAGG - Intronic
1117602401 14:57389838-57389860 GTGGTGAAAGAGAGTGACCAGGG - Intergenic
1117932818 14:60862911-60862933 GTGGTAGAACAAAGTGTGCAGGG + Intronic
1120491475 14:85183962-85183984 CGGCTGGAAGAAAGTGAGCAGGG - Intergenic
1120782072 14:88494286-88494308 TGGCTGGAACAGAGCAAGCAGGG + Intronic
1121813605 14:96912678-96912700 GGGCTGGGGCAGAGTGAACAGGG + Intronic
1121936688 14:98026195-98026217 GTACTGGAACTGACTAAGCACGG - Intergenic
1122492852 14:102131510-102131532 TGGCTGGAGCAGAGTGAGCAGGG - Intronic
1122735740 14:103839744-103839766 TGGCTGGAGCAGAGTGAGTAAGG - Intronic
1124781135 15:32635156-32635178 AGACTGGAGCAGAGTGAGCAAGG - Intronic
1127482419 15:59389917-59389939 GTTCTGGAAGAGGGTGACCAGGG - Intronic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1128439201 15:67688184-67688206 GAGCTGAAGCAGAGTGGGCATGG + Intronic
1128717756 15:69921086-69921108 GAGCTGGGATAGTGTGAGCAGGG + Intergenic
1128781003 15:70358638-70358660 GTTGTGGAGCAGAGTGGGCAAGG - Intergenic
1129449460 15:75642343-75642365 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
1130949511 15:88574317-88574339 ATGCTGGAAAAGGGTGTGCATGG - Intergenic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1132086194 15:98910201-98910223 TTGCAGGGATAGAGTGAGCAGGG - Intronic
1132378957 15:101352629-101352651 GTGCTGGAATAGACCGATCAAGG - Intronic
1132508075 16:322468-322490 GTGCAGGAGCTGAGTTAGCATGG + Intronic
1132552488 16:559300-559322 GTGCTGTTTCAGAGTCAGCAGGG + Intergenic
1133421835 16:5653056-5653078 GTGCTGGGCCTGTGTGAGCAAGG + Intergenic
1133791644 16:9013579-9013601 GTGCTGGAGCAGAGCGAACACGG + Intergenic
1134692724 16:16201499-16201521 TGGCTGGAGGAGAGTGAGCATGG + Intronic
1134752428 16:16636583-16636605 GTGCAGGAGCAGAGTGGGCAAGG - Intergenic
1134979121 16:18593182-18593204 TGGCTGGAGGAGAGTGAGCATGG - Intergenic
1135195067 16:20387467-20387489 GGTCTGGAGCAGAGTGAGCTGGG + Intronic
1135510063 16:23074939-23074961 ATGCTGGAACAGACTCAGGATGG + Intronic
1136044188 16:27602397-27602419 TGGCTGGAACAGACTGAACAAGG - Intronic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1136228632 16:28874526-28874548 GTGCTGGAAGAGATTGAACGTGG + Intergenic
1137697379 16:50470164-50470186 GAGCGGGATCAGAGTGTGCAAGG - Intergenic
1137707190 16:50543847-50543869 GCTCTGGAGCAGAGAGAGCATGG - Intergenic
1138512594 16:57517185-57517207 GTGCTGGAGGGGAGTGAGCGGGG - Intronic
1138536797 16:57664433-57664455 GTGCTTGGTCAGGGTGAGCAAGG - Exonic
1138653276 16:58473975-58473997 TGGCTGGAGCAGAGTGAGCCAGG - Intronic
1139424062 16:66868079-66868101 GTGCTGGAAAAGAGTTTGCCTGG + Intronic
1139528824 16:67531651-67531673 TTGCTGGAACAGAGAAAGCAGGG + Intronic
1140869855 16:79096408-79096430 CAGCTGGAACCCAGTGAGCAGGG - Intronic
1141072851 16:80973697-80973719 GAACTGGAGCACAGTGAGCAAGG - Exonic
1141291450 16:82721812-82721834 GTGATGGAGCAGAGAGGGCAGGG + Intronic
1141658612 16:85429641-85429663 GGGCTGGAGCAGAGCCAGCAAGG - Intergenic
1141749105 16:85946467-85946489 GTGGTGGCCCAGAGGGAGCAGGG - Intergenic
1141927092 16:87177096-87177118 GAGCAGGACCAGAGTGAGCAGGG - Intronic
1143035100 17:3990522-3990544 GTGCTGGAACAGACATAGCTCGG + Intergenic
1143119297 17:4597152-4597174 GTGCTGCAACAGGGTGAGTGGGG - Exonic
1143489800 17:7279604-7279626 GTGCTGGAACTCAGGGATCAAGG + Intergenic
1143767410 17:9146657-9146679 GTGCTGAGACAGAGTGAGGCGGG + Intronic
1144191876 17:12853941-12853963 CTGCGGGAACAGAATGAGCTGGG - Intronic
1145092601 17:19998382-19998404 GAGCTGGAGTGGAGTGAGCAAGG + Intergenic
1145939192 17:28733242-28733264 GAGATGGAAGAGACTGAGCAAGG + Intronic
1145963220 17:28899634-28899656 TGGCTGGAACAGAGTGAGGGGGG - Intronic
1146165182 17:30582931-30582953 GAGCTGGAGTGGAGTGAGCAAGG + Intergenic
1146210078 17:30935441-30935463 GTGCTGCTGCAGAGTGATCAGGG + Intronic
1146541874 17:33703185-33703207 CGCCTAGAACAGAGTGAGCAAGG + Intronic
1146946580 17:36877627-36877649 GTGATGGAGGGGAGTGAGCAAGG + Intergenic
1148184775 17:45634182-45634204 CAGCTGGAACAGAATGAGCAGGG + Intergenic
1148440052 17:47707354-47707376 GAGCTGGAACAGACTTGGCAAGG - Intronic
1148638662 17:49168723-49168745 TTGCTGGAACAGAGTGAGAATGG + Exonic
1149434091 17:56618724-56618746 GTGGGAGAGCAGAGTGAGCATGG + Intergenic
1149571477 17:57675321-57675343 GTGATGGAGCAGAAGGAGCATGG + Intronic
1150005370 17:61465748-61465770 GAGATGGAACAGAGTGAGCAAGG - Intronic
1152419279 17:80183355-80183377 GTGCTGGAACACAGGGAAAATGG - Intronic
1152581834 17:81168759-81168781 GTGGTGGAAAAGAGGGGGCAGGG + Intergenic
1152937036 17:83145186-83145208 GTGCTGGAGCAGAGGCTGCAGGG - Intergenic
1157272004 18:46283352-46283374 GTGCTGGAACTGGGTGTGCAAGG - Intergenic
1157310198 18:46546948-46546970 GTGCTGCCACAGAGCGAGGAGGG - Exonic
1157446950 18:47753304-47753326 TGGCTGGAACAAAATGAGCAGGG - Intergenic
1158135642 18:54204856-54204878 TTGCTGGGACAGGGTGGGCAGGG + Intronic
1158757661 18:60346217-60346239 GTGCTGGCTCAGGGTGAGCTAGG - Intergenic
1159807543 18:72974352-72974374 TGGCTGGAACAGAATGAGCAGGG - Intergenic
1160104894 18:75964855-75964877 ATCCTGAACCAGAGTGAGCAGGG + Intergenic
1160236657 18:77090933-77090955 GTGCTGGCACAGAGGTGGCAGGG + Intronic
1160514728 18:79472064-79472086 GTGTTGGTACAGAGGGAGCCGGG + Intronic
1160566705 18:79790504-79790526 GTGCTGGCCCAGAGTGTCCAGGG + Intergenic
1160695135 19:480220-480242 CAGCTGGAGCAGCGTGAGCAAGG + Intergenic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161239336 19:3213344-3213366 TGGCTGGAGCAGAGTGAGCTGGG + Intergenic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161243336 19:3235072-3235094 TGGCTGGAACAGAGGGAGCGAGG - Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161267901 19:3373442-3373464 TGGCTGGAGCAGAATGAGCAAGG - Intronic
1161274291 19:3406976-3406998 TGGCTGGAGCAGAGTGAGCGAGG + Intronic
1161289397 19:3484998-3485020 TGGCTGGAGCAGAGTGAGCCGGG + Intergenic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161488310 19:4547815-4547837 TGGCTGGAGCACAGTGAGCAAGG - Intronic
1161503813 19:4633203-4633225 TGGCTGGAATAGAGTGAGCTAGG + Intergenic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161625400 19:5323636-5323658 TGGCTGGAACAGAGTGAGGACGG + Intronic
1161633273 19:5370219-5370241 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161760584 19:6168176-6168198 TGGCTAGAACAGAGTGAGCAAGG - Intronic
1161885153 19:6988835-6988857 GACCTGGAACAGAGAGAGGAGGG + Intergenic
1162110352 19:8396690-8396712 TGGCTGGAGCAGAGTGAGCCGGG + Intronic
1162131656 19:8529846-8529868 GTGATGGAACAGATTGATCTAGG + Intronic
1162299810 19:9838119-9838141 GTGATGGAACAGAGGAAGCTGGG - Intronic
1162370201 19:10274099-10274121 TGGCTGGAGCTGAGTGAGCAAGG - Intronic
1162543001 19:11309410-11309432 GTGCTGGAACAGAGTGAGCAAGG - Intronic
1162589807 19:11584115-11584137 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
1162844455 19:13381678-13381700 TGGCTGGAACAGAGTGAGTGAGG - Intronic
1163113505 19:15175858-15175880 TGGCTGGAACAGAGTGAGTGAGG + Intronic
1163440995 19:17322516-17322538 GGGCTGGGCCAGTGTGAGCAAGG - Exonic
1163518593 19:17779239-17779261 CTGCTGGAACGGGGTGATCACGG + Intronic
1164844721 19:31422151-31422173 GCGCTGGAACAGAATCACCAAGG - Intergenic
1165455812 19:35909798-35909820 GTGTTGGAGCAGAGTGGGCGAGG + Intergenic
1165461257 19:35945472-35945494 GTGATAGCACAGAGTGACCAGGG + Exonic
1165487942 19:36106691-36106713 CGGCTGGAATGGAGTGAGCAAGG + Intergenic
1165746229 19:38231238-38231260 TGACTGGAGCAGAGTGAGCAGGG + Intergenic
1165771020 19:38380399-38380421 TTTTTGGAACAAAGTGAGCAGGG + Intronic
1165861148 19:38910171-38910193 GTGCCGTAACAGGGTGGGCATGG - Intronic
1166423601 19:42656770-42656792 GTGCTGGCACAGGGTGTGAATGG - Intronic
1166713787 19:44953708-44953730 GTGATGACACAAAGTGAGCAGGG + Intronic
1167008786 19:46792629-46792651 GTGATGATACAGAGTGGGCAGGG + Intergenic
1167269710 19:48499925-48499947 GAGGTGGGGCAGAGTGAGCAGGG + Intronic
1167347802 19:48957160-48957182 CTGTTGGAACAGAGTGAACTGGG + Intronic
1167702061 19:51054648-51054670 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1167970098 19:53183843-53183865 TGGCTGGAGCAGAGGGAGCAAGG + Intronic
1168053509 19:53847627-53847649 GTGCTGGAGGAGAGTGAACGAGG - Intergenic
1168311352 19:55462438-55462460 TGGCTGGAGCGGAGTGAGCAGGG - Intergenic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
1168472923 19:56654334-56654356 TGGCTGGAACAGAGTGAGAAAGG + Intronic
926681202 2:15665359-15665381 CAGCAGGAACAGAGTGACCAGGG + Intergenic
926862894 2:17327504-17327526 TGGCTGGAGCAGAGTGTGCATGG - Intergenic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
927865155 2:26583395-26583417 GTGCTGGGACAGAGTGGGGAGGG + Intronic
930511410 2:52349908-52349930 TGGCTGCAACAGAGTGGGCAAGG - Intergenic
930805747 2:55488237-55488259 GTGCTGGCACAAAGTAAGCAAGG + Intergenic
931146717 2:59527262-59527284 TGGCTTGAGCAGAGTGAGCAGGG - Intergenic
931743072 2:65266426-65266448 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
931795872 2:65709405-65709427 GTGCTAGAGAACAGTGAGCAAGG + Intergenic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
932343548 2:70981528-70981550 GTGTTGGGAAAGAGTGGGCAAGG + Intronic
932438489 2:71717096-71717118 CAGCTGGAGCAGGGTGAGCAAGG - Intergenic
932757166 2:74416969-74416991 ATGCTGCAGCAGAGAGAGCAAGG - Intronic
933699455 2:85244153-85244175 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
933969574 2:87459354-87459376 GTGACGGGACAGAGTGATCAAGG - Intergenic
935052504 2:99535827-99535849 GTGCTGGAACACAGAGAGCAGGG - Intergenic
935105188 2:100036229-100036251 GGGCTGGCACATTGTGAGCAGGG - Intronic
935923910 2:108046464-108046486 GTGCTGGAACAATGGGAACACGG + Intergenic
936324213 2:111491143-111491165 GTGACGGGACAGAGTGATCAAGG + Intergenic
938028580 2:127972188-127972210 GTGCAGAAATAGGGTGAGCAGGG - Intronic
939014467 2:136886107-136886129 ATGCAGGAGCAGAGTGAACATGG + Intronic
939953230 2:148501026-148501048 GTGCTGGCACACAGTGAGTTGGG + Intronic
940647083 2:156402968-156402990 CTGGTGGAACTGAGGGAGCAGGG + Intergenic
941155733 2:161975823-161975845 GTTCTGGAACACAATGGGCATGG - Intronic
941155745 2:161975867-161975889 GGGCTGGAAAGGAGTGAGCAGGG + Intronic
942264301 2:174205696-174205718 TTCCTGCCACAGAGTGAGCAAGG + Intronic
944192489 2:197018339-197018361 CAGCTGGAACAGAGTGAGTGAGG - Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
945286396 2:208086996-208087018 GTGCTGTAACAGAGTGAAATGGG + Intergenic
946364681 2:219241623-219241645 TGGCTGGAGCAGAGTGAACATGG + Intronic
946884361 2:224208339-224208361 CTGCTGGAGCAGTGTGAGCAAGG + Intergenic
946934862 2:224709384-224709406 GAGCTGGAACAGCCTGAGAATGG - Intergenic
947010534 2:225561380-225561402 TGGCTGGAACAGAGTGAACCTGG + Intronic
948077419 2:235176079-235176101 GTGCTGAAACAAATTAAGCAGGG + Intergenic
948181979 2:235989461-235989483 GTGCTGGGACAGGATGAGCTGGG + Intronic
948660160 2:239501973-239501995 GTGCTGGAGCAGAAGGAGCTGGG - Intergenic
1168813356 20:720572-720594 GTGCTGGGAGAGAGTTAGGAGGG + Intergenic
1168957232 20:1842784-1842806 GGGCTGGAGCAAAGTGAGCGAGG - Intergenic
1170175200 20:13461038-13461060 TGGCTGGAGCAGTGTGAGCAAGG - Intronic
1170852925 20:20020469-20020491 TGGCTGGTACAGAGTGAGCATGG + Intronic
1171298868 20:24041998-24042020 TGGCTGAAACAGAGTGAGCAAGG - Intergenic
1172027961 20:31962362-31962384 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1172192882 20:33072624-33072646 GTGATGGAATAGGGTCAGCAGGG + Intronic
1172577389 20:36019667-36019689 TGGCTGGAACAGACTAAGCAAGG + Intronic
1173164606 20:40678169-40678191 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1173216206 20:41086828-41086850 GTGCTTGAAAAGAATGTGCAAGG - Intronic
1173539422 20:43840494-43840516 GGGCTGGAGCAGAGTGATCAAGG + Intergenic
1173622359 20:44446209-44446231 GGGCTGGAATGGAGTGACCATGG - Intergenic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1174187650 20:48718093-48718115 GTGCAGGAAACGAGTGAGTAGGG - Intronic
1174313949 20:49682433-49682455 TGGCTGGAACAGAGTGAGTGAGG - Intronic
1176088919 20:63310361-63310383 CACCTGGAACAGAGTGGGCAAGG - Exonic
1176222326 20:63975537-63975559 GTGATGGAAGAGGGTGAGAATGG + Intronic
1177828004 21:26105856-26105878 GTGCTGCAACACAGTGGGTATGG - Intronic
1180047032 21:45311682-45311704 GTGGTGGAGCAGAGGGTGCATGG - Intergenic
1181434257 22:22900994-22901016 GGGCGGGAACAGAGTGACCGAGG - Intergenic
1181436764 22:22915642-22915664 GGGCGGGAACAGAGTGACCAAGG - Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182716062 22:32356947-32356969 GGACGGGAACAGAGTGACCAAGG + Intronic
1182936464 22:34227443-34227465 GGGCTAAACCAGAGTGAGCAAGG - Intergenic
1183149258 22:36025186-36025208 TAGCTGGAGCAGAGAGAGCAAGG - Intronic
1184096735 22:42320145-42320167 TGACTGGAGCAGAGTGAGCAGGG - Intronic
1184825777 22:46949904-46949926 GGGCTGGAGCAGCCTGAGCAGGG + Intronic
1185003801 22:48263373-48263395 GTGCTGGGACAGAGTGACTTGGG + Intergenic
1185021753 22:48380514-48380536 GTGCTGGGAAAGAGTGAGAATGG + Intergenic
1185399353 22:50607936-50607958 GTGCTGGGACACAGAGGGCAGGG - Intronic
949268783 3:2190156-2190178 CTAGTGGAACAGACTGAGCAGGG - Intronic
949870335 3:8582730-8582752 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
951425841 3:22544287-22544309 AAGCTGGAAAAGAGAGAGCATGG + Intergenic
951460171 3:22943050-22943072 GTGCTGGAACACATTGGGGATGG - Intergenic
953024816 3:39138691-39138713 GACCTGGAACAGAGAGAGAATGG - Exonic
953955006 3:47225032-47225054 TGGCTGGAGTAGAGTGAGCAAGG + Intergenic
954419549 3:50411437-50411459 GAGCTGGGGGAGAGTGAGCATGG - Intronic
955018566 3:55096310-55096332 TGGCTGCAGCAGAGTGAGCAAGG - Intergenic
955243876 3:57205530-57205552 TGGCTGGAACACAGTGAACATGG - Intronic
956576692 3:70760047-70760069 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
956946797 3:74232493-74232515 TGGCTGGAACAGAGTGAGTAAGG + Intergenic
957731256 3:84140360-84140382 GTGCGGGGACGGAGCGAGCATGG + Intergenic
958922058 3:100118563-100118585 GTGCTTGAACAGAGGCCGCATGG - Intronic
961215564 3:125157585-125157607 GTGCTGGAGCTGAGTGTGCTGGG - Intronic
961353407 3:126318113-126318135 GTGCAAGAAGAGAGTGGGCAGGG - Intergenic
961577718 3:127851794-127851816 GTCCTGGGCCTGAGTGAGCAAGG - Intergenic
962944301 3:140153465-140153487 CTGGTGGAGAAGAGTGAGCAGGG - Intronic
964469524 3:157037937-157037959 CTGCTGGAGCTTAGTGAGCAAGG + Intronic
964931318 3:162028071-162028093 GTGCTTGAGCACAGTGAGCCAGG + Intergenic
965447701 3:168796105-168796127 GGGCTGGAAAAGAATGAACAAGG + Intergenic
965447917 3:168798930-168798952 AGGCTGGAAAAGAGTGAACAAGG + Intergenic
965537320 3:169836836-169836858 TGGCTGGAGCAGAGTGAGCCAGG + Intronic
966390409 3:179447257-179447279 AGGCTGGAAGAGAGTGAGCAGGG + Intronic
966497081 3:180593307-180593329 TGGCAGGAACAGAGTGAGCATGG - Intergenic
966605853 3:181820929-181820951 TGGCTGGAGCAGAGTGAGCAGGG - Intergenic
966723528 3:183088040-183088062 TGGCTGGAACACAATGAGCAAGG + Intronic
968675675 4:1877672-1877694 TGGCTGGAACAGAATGAGAATGG - Intronic
969333412 4:6492976-6492998 GTGTTGGAATGGAGTGAGGAGGG - Intronic
970050480 4:11908785-11908807 GTGAAGGAACAAAGTGAGAAGGG - Intergenic
973167658 4:47097243-47097265 TGGCTGGAGCAGAGTGAGAAAGG - Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974919059 4:68214500-68214522 GTGCAGGAACGGAGAGTGCAAGG - Intergenic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
975881169 4:78909536-78909558 TGGCTGGAATATAGTGAGCAAGG - Intronic
976186773 4:82449842-82449864 GGGCTGGGCCAGAGTGAGCTGGG - Intronic
977163171 4:93662024-93662046 TAGCTGGAACAGAATGAGCAAGG - Intronic
978349319 4:107804790-107804812 TCGGTGGAACAGAATGAGCAAGG + Intergenic
978787531 4:112626458-112626480 TGGTTGGAACAGAGTGAGCAAGG - Intronic
980610282 4:135151534-135151556 CATCTGGAGCAGAGTGAGCAAGG - Intergenic
982693160 4:158570866-158570888 GTGATGGAGCCCAGTGAGCAGGG - Intronic
982812544 4:159844226-159844248 TACCTGGAGCAGAGTGAGCAGGG - Intergenic
984016742 4:174435684-174435706 GTGGTGGAAAAAAGTGAGAATGG + Intergenic
984040649 4:174728854-174728876 GTGTTGGGACAGAGGGAGGATGG + Intronic
985044039 4:185922273-185922295 GGGCTGGGACAGAGAGAGGAAGG - Intronic
985084351 4:186297588-186297610 GTGAAGGAGCTGAGTGAGCAGGG - Intergenic
985811558 5:2093968-2093990 CTGCTGGAACACAGTGTGCATGG - Intergenic
986323395 5:6652276-6652298 GGGCTGTAGCAGAATGAGCAGGG + Intronic
986524403 5:8657543-8657565 GTCCAGGAAGAGAGTGAGAAAGG + Intergenic
988280086 5:29134253-29134275 CTGCTGGAACAGGGAGGGCAAGG + Intergenic
988627099 5:32889004-32889026 AGGCTGGAGCAGAGTGGGCAAGG - Intergenic
988697845 5:33641858-33641880 GTCCTGGAACAGTGGGACCAGGG + Exonic
989711942 5:44409105-44409127 TAGCTGGAACAGAATGAGCAAGG + Intergenic
989791781 5:45412755-45412777 AGGCTGGAACTGGGTGAGCACGG + Intronic
991442299 5:66663666-66663688 TAGCTGGAATAGAGTGGGCAAGG + Intronic
992763159 5:79969712-79969734 GGTCAGGAGCAGAGTGAGCAGGG - Intergenic
992770208 5:80040557-80040579 GTTCTGGAACAGAGAGGACAAGG + Intronic
993180784 5:84549243-84549265 GGGCTGGCACAGAGTGAGTAAGG - Intergenic
993488027 5:88511007-88511029 GTGATGCAATGGAGTGAGCATGG + Intergenic
994300619 5:98142702-98142724 CAGCTGGGACAGAGTGAGCATGG - Intergenic
995059283 5:107796146-107796168 GGGCATGAGCAGAGTGAGCAGGG + Intergenic
995848493 5:116520085-116520107 GGGCTGGAACAGAGTGGGAATGG - Intronic
996139418 5:119887747-119887769 AGGCTGGAGCAGAGTAAGCAAGG - Intergenic
996190408 5:120533673-120533695 TGGCTGGAACAGAGGGAGCAAGG + Intronic
997659738 5:135579888-135579910 GTGCTGGAAAGTAGTGAGGAGGG - Intergenic
997741700 5:136260549-136260571 GGGCTGAAACAGAGTGAGTGAGG + Intronic
998703581 5:144732704-144732726 GAGCTGGAACAGATTTAGGATGG - Intergenic
999111438 5:149124976-149124998 CTGATTGAACAGAGTGAGCTGGG + Intergenic
999816175 5:155178657-155178679 GTGATGGAACATAGGAAGCAGGG + Intergenic
1000158376 5:158574631-158574653 AGGCTGGAACAGAGTGAGCAAGG + Intergenic
1000448680 5:161357375-161357397 TGGCTGGAACAGAATGTGCAAGG + Intronic
1001584466 5:172824017-172824039 CAGCTGGAGCCGAGTGAGCAAGG + Intergenic
1001751795 5:174137062-174137084 TGGCTGGAACTGAGTGAGCAAGG + Intronic
1003418424 6:5934341-5934363 CTGCAGGAACACAGTGGGCAAGG - Intergenic
1005648072 6:27861031-27861053 TGGCTGGAACAGAGGGAACAAGG - Intronic
1005995467 6:30928449-30928471 GTGGTGGGGCAGAGTGAGAAGGG + Intergenic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1007322186 6:41035332-41035354 GTTCTGAAGCAGAGTGAGCTTGG + Intronic
1007629823 6:43266969-43266991 GTGCAGGATCAGAGAGAGCCTGG + Intronic
1007736336 6:43984622-43984644 AGGCTGGAGCAGAGTGAGCGAGG + Intergenic
1008095578 6:47336300-47336322 TAGCTGGAGCAGAGGGAGCATGG - Intergenic
1008206093 6:48659151-48659173 GTGCAGAAACTGAGTGGGCAGGG - Intergenic
1008609750 6:53174798-53174820 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1008931596 6:56946136-56946158 GTGCAGAAACAGAGAGAGCCAGG + Intronic
1009822803 6:68826433-68826455 TGGCTGGAGCAGAGTGATCATGG + Intronic
1009990990 6:70842721-70842743 GTGGTGGAACAGTGAGCGCAGGG + Intronic
1010351197 6:74876618-74876640 CAGCTGGAGTAGAGTGAGCAAGG + Intergenic
1012415142 6:99005013-99005035 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1012834842 6:104252043-104252065 CTACTGTAACAGAGGGAGCAAGG + Intergenic
1013300486 6:108800642-108800664 GTCCTGGAACAAAGACAGCATGG + Intergenic
1014402305 6:121005898-121005920 GGTCTGGAACAGACTGAGCAAGG + Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015809084 6:137143225-137143247 GTGCTGGAGAAGAGTGAGGAAGG + Intergenic
1016471425 6:144378641-144378663 GTGCTGGAGCAAACTGAGGAGGG + Intronic
1016737441 6:147494549-147494571 GTGCTGGAGCAAAGTGAGAGTGG - Intergenic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1019973850 7:4564041-4564063 GTGGAGGAAGAGAGTGTGCAGGG - Intergenic
1020976764 7:15015972-15015994 GTGCTGAAACTGAGTGTGCGAGG + Intergenic
1021979939 7:26044468-26044490 TGGCTGGAGCAGAGTCAGCAAGG - Intergenic
1023641638 7:42264885-42264907 GTGCAGGAGGAGAGTGAGAAAGG + Intergenic
1023881956 7:44325719-44325741 GTGCAGGAGCAGCGTGTGCAGGG - Intronic
1023934188 7:44727498-44727520 TGGCTGGAGCATAGTGAGCAAGG + Intergenic
1023981658 7:45074022-45074044 GAGCTGGAACACAGAGTGCATGG - Intronic
1024957837 7:54944073-54944095 GTATTGGAAAAGAGTGAGCAAGG + Intergenic
1026324791 7:69299718-69299740 CTGCTGGAACAGAACAAGCAAGG - Intergenic
1027695026 7:81399630-81399652 TTCCAGGAACAGAGTGTGCAAGG + Intergenic
1028276389 7:88863104-88863126 TTGCTGTAGCATAGTGAGCACGG - Intronic
1031208810 7:118795613-118795635 GTGCTAGCTCAGGGTGAGCAGGG + Intergenic
1031528845 7:122852685-122852707 TAGCTGGAGCAGAGAGAGCAAGG + Intronic
1032022737 7:128418892-128418914 GTGCTGGAGGGGAGTGAGCTGGG + Intergenic
1034871152 7:154685130-154685152 GTGTTGTAACAGAGCCAGCATGG + Intronic
1035761993 8:2075331-2075353 TTGCTGGTGCTGAGTGAGCAAGG - Intronic
1035901087 8:3459254-3459276 CTCATGGACCAGAGTGAGCAGGG + Intronic
1036502866 8:9329352-9329374 GAGCTGGAACACAGCGTGCAGGG + Intergenic
1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG + Intronic
1038455091 8:27667734-27667756 GAGCAGGCAGAGAGTGAGCAGGG + Intronic
1039148290 8:34474768-34474790 ATGCTGGAACAGAATGAGTAAGG + Intergenic
1041461616 8:58117714-58117736 GTTCTGGCACATAGTAAGCACGG + Intronic
1042089253 8:65140822-65140844 CCGCTGGAACAGAGTGAGAACGG + Intergenic
1042350107 8:67768524-67768546 ATACTGGTACAGAGTGATCAGGG - Intergenic
1042450147 8:68935820-68935842 GTGCTAGGACAGCTTGAGCATGG - Intergenic
1043023696 8:75039752-75039774 GTGCTGGAATAGTGTGTCCAAGG - Intergenic
1043812033 8:84753029-84753051 GGGCTGGAACTGAGTGCCCATGG - Intronic
1044130534 8:88518143-88518165 TGGTTAGAACAGAGTGAGCAAGG - Intergenic
1044230627 8:89773446-89773468 TGGCTGGAATACAGTGAGCAAGG + Intronic
1044287677 8:90428048-90428070 TAGCTGGAACAGAGTCAGCAAGG + Intergenic
1044576287 8:93773268-93773290 TGGCTGGAGCAGAGTGAGCAGGG + Intronic
1044693550 8:94901201-94901223 TGGCTGGAACGTAGTGAGCAAGG + Intronic
1044897672 8:96909956-96909978 GTGCTCGACCAGGTTGAGCACGG + Intronic
1046101578 8:109620524-109620546 TTCCTGGAACAGAGTGAACTTGG + Intronic
1046364652 8:113210984-113211006 GTGGTGGAACAAAGAGAACATGG - Intronic
1046823502 8:118661575-118661597 TGGCTGGAACAGAGAGAGTAAGG + Intergenic
1047158338 8:122347794-122347816 GAGAAGGAACAAAGTGAGCAAGG + Intergenic
1047367884 8:124228983-124229005 TGGCTGGAGCAGAGTGAGCTTGG + Intergenic
1048488076 8:134867103-134867125 GTGAGGGAACAGCGTGTGCATGG + Intergenic
1048861448 8:138727175-138727197 GTGCTGGAGCTGAGGGAGGAGGG - Intronic
1049137470 8:140916367-140916389 TGGCTGGAACAGAGTGAATACGG - Intronic
1049251963 8:141594015-141594037 TAGCTGGAGCAGAGTGAGCCAGG + Intergenic
1049259553 8:141631510-141631532 GTCCTGGAACAGCGTGGGAAAGG + Intergenic
1049259587 8:141631712-141631734 GTCCTGGAACAGAGTGGGAAAGG + Intergenic
1049259786 8:141632749-141632771 GTCCTGGAACAGAGTGGGAAAGG + Intergenic
1049260001 8:141633875-141633897 GTCCTGGAACAGAGTGGGAAAGG + Intergenic
1049945508 9:591506-591528 GGGCTGGAACATAGTGTTCAAGG - Intronic
1050185633 9:2969901-2969923 ATGCTGGAGCAGAGTGAGTGAGG + Intergenic
1050569403 9:6921828-6921850 GTGTTGGTACAGAGTGGGCAAGG - Intronic
1051220390 9:14842676-14842698 GAGATGGAGCAGATTGAGCAAGG + Intronic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052988415 9:34504220-34504242 GTGGTGGGACAGAGTGGGAAGGG - Intronic
1053096314 9:35331073-35331095 GTGGTGGTAAAGAGTGAGAAAGG - Intronic
1055329817 9:75171964-75171986 GGGCTGGAACAGAGTGAAGGAGG + Intergenic
1055583566 9:77732842-77732864 GAGCTGGATCAGGGAGAGCAGGG + Intronic
1056454435 9:86746325-86746347 CTCCAGGAACAGAGTGAGCGAGG + Intergenic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1057734076 9:97637064-97637086 GTGCTGGAGCAGAGTGAGTGAGG + Intronic
1057953109 9:99385745-99385767 GTGCTCCAACAGAATGAGCAGGG + Intergenic
1058767450 9:108195683-108195705 GTACAGGAACAGAATGTGCAAGG + Intergenic
1058770473 9:108226411-108226433 GTGCTGTAATAGAGAGAACATGG - Intergenic
1059489305 9:114654065-114654087 GATCTGGCACAGAGTAAGCAAGG + Intergenic
1061215939 9:129222161-129222183 GTGAGGGCACAGAGTAAGCAAGG - Intergenic
1061272606 9:129551854-129551876 CTGTGGGAACAGAGTGGGCAAGG - Intergenic
1061277223 9:129576560-129576582 CTGCTGGAAAGGGGTGAGCATGG - Intergenic
1061455743 9:130696271-130696293 GGGTTGGAACAGAGTGAGTGAGG + Intronic
1061496424 9:130977479-130977501 GGCCTGCAACAGAATGAGCACGG + Intergenic
1061642373 9:131969333-131969355 TTGCTGGGACAGGGTGAGCCTGG + Intronic
1186361643 X:8848568-8848590 ATGCTGTAACAGAATGAACAGGG - Intergenic
1187219413 X:17309052-17309074 GTGCTGAAACGGAGAGACCAGGG - Intergenic
1187476266 X:19613815-19613837 GAGGTGGAACAGAGCAAGCATGG + Intronic
1187731379 X:22258642-22258664 TGGCTGGAGCAGAGCGAGCAAGG + Intergenic
1187777103 X:22772890-22772912 GTGGAGGAACAGAGGGATCATGG + Intergenic
1187932240 X:24304048-24304070 GGGCTGGAACAGAGTGGGGAAGG - Intergenic
1189482738 X:41405727-41405749 CAGCTGGAGCAGAGTGAGCCGGG - Intergenic
1190217468 X:48489446-48489468 GGGCAGGAGCAGAGTGAACAAGG + Intergenic
1190221489 X:48515097-48515119 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190232137 X:48590460-48590482 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190321490 X:49182468-49182490 CTGCTGGCGCAGAGTGAGCAAGG - Intronic
1190458558 X:50647894-50647916 GAGCTGGAGCACAGTGAGCAAGG + Intronic
1190471652 X:50786512-50786534 GTCCTGAAACAGAGTGTGCTGGG - Intronic
1190753514 X:53381628-53381650 GTGTTGTAACCGGGTGAGCATGG - Intronic
1191135997 X:57066327-57066349 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1191803342 X:65105472-65105494 GTGCTGGGATAGAGTGCCCAGGG + Intergenic
1192081401 X:68051336-68051358 GTGCTGGTACAGACTGTCCAAGG - Intronic
1192322081 X:70098119-70098141 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
1193084998 X:77441089-77441111 GCTGTGGAACAGAGTTAGCAAGG - Intergenic
1193257435 X:79366879-79366901 GAGCTGGAACAGACAGAACATGG + Intronic
1194643675 X:96432044-96432066 TGGCTGGAACATAGTGAGGAAGG - Intergenic
1194807256 X:98344773-98344795 GTGCTGGCAAAGGGGGAGCAGGG + Intergenic
1196086299 X:111685911-111685933 TTGCAGGAGCATAGTGAGCAAGG + Intronic
1196377609 X:115051513-115051535 TTGCTGGGGCAGAGTAAGCAAGG + Intergenic
1197820817 X:130539068-130539090 GAGCCTGAACAGGGTGAGCAAGG + Intergenic
1198772443 X:140145232-140145254 GTGCTTGTACAGTGTCAGCAGGG - Intergenic
1200326821 X:155249159-155249181 GTGCTAGAGCAGAATGAGCCAGG - Intergenic
1200953967 Y:8927255-8927277 GAGCGGGAACAGACAGAGCAGGG - Intergenic