ID: 1162543109

View in Genome Browser
Species Human (GRCh38)
Location 19:11310223-11310245
Sequence AAGTGCAGGAAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1440
Summary {0: 1, 1: 0, 2: 21, 3: 157, 4: 1261}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162543105_1162543109 0 Left 1162543105 19:11310200-11310222 CCTAGAAGAGGGAGCTACTCTGG 0: 1
1: 0
2: 5
3: 13
4: 170
Right 1162543109 19:11310223-11310245 AAGTGCAGGAAGAAGGAAGAAGG 0: 1
1: 0
2: 21
3: 157
4: 1261
1162543104_1162543109 7 Left 1162543104 19:11310193-11310215 CCAGGGGCCTAGAAGAGGGAGCT 0: 1
1: 0
2: 1
3: 22
4: 266
Right 1162543109 19:11310223-11310245 AAGTGCAGGAAGAAGGAAGAAGG 0: 1
1: 0
2: 21
3: 157
4: 1261
1162543097_1162543109 26 Left 1162543097 19:11310174-11310196 CCTCCAGAGGTGAGATGTGCCAG No data
Right 1162543109 19:11310223-11310245 AAGTGCAGGAAGAAGGAAGAAGG 0: 1
1: 0
2: 21
3: 157
4: 1261
1162543100_1162543109 23 Left 1162543100 19:11310177-11310199 CCAGAGGTGAGATGTGCCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 172
Right 1162543109 19:11310223-11310245 AAGTGCAGGAAGAAGGAAGAAGG 0: 1
1: 0
2: 21
3: 157
4: 1261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162543109 Original CRISPR AAGTGCAGGAAGAAGGAAGA AGG Intronic
900202144 1:1413456-1413478 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
900481332 1:2900883-2900905 CTGTGCAGGAAGGAGGCAGACGG - Intergenic
900643333 1:3697630-3697652 AGGTGCAGGAAGATGGCAGCCGG - Intronic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900876937 1:5349543-5349565 ATGTGCAAGAAGCAGGATGAGGG + Intergenic
900928791 1:5722822-5722844 AAGTGAAGGAAGATGCAAGCTGG - Intergenic
901151741 1:7107927-7107949 AAGTGTAGGAAGAAGTCAGCAGG - Intronic
901244568 1:7719463-7719485 AAGATCAGGAAGAAGAAATATGG + Intronic
901295482 1:8157923-8157945 AGGAGGAGGAAGAAGAAAGAAGG + Intergenic
902077628 1:13800504-13800526 ATGTGGAGGAAGAGGGGAGACGG + Intronic
902161241 1:14532088-14532110 AAGTGGTGCAAGAAGGAAGGTGG + Intergenic
902360943 1:15942323-15942345 AAGTGCAGGAAGAAGGTGAGGGG - Exonic
902550451 1:17216105-17216127 AACGGCAGGAACAAGCAAGAGGG + Intronic
902652077 1:17843660-17843682 AAGTGAAAGGAGAAGGAAGGTGG - Intergenic
902754638 1:18541005-18541027 CAGAGCTCGAAGAAGGAAGAAGG + Intergenic
903280063 1:22245250-22245272 CAGTGCAGGAGGAAGGCAGGGGG + Intergenic
903331706 1:22600042-22600064 GAGTGGAGGAGGAAGGAAGGGGG + Intronic
903672467 1:25044959-25044981 GAAGGAAGGAAGAAGGAAGAAGG + Intergenic
903799465 1:25955736-25955758 GAGGGAAGGAAGAAGGAGGAAGG + Intergenic
903806477 1:26009332-26009354 GAGGGCAGGAAGAAGGCAGTGGG + Intergenic
904170408 1:28588279-28588301 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
904295768 1:29518891-29518913 AGGAGAAGGAAGAAGGAAGAAGG - Intergenic
904480734 1:30791720-30791742 AAGAGAGGGAAGAAGGAAGGAGG + Intergenic
904564143 1:31417475-31417497 AAGAGCAGGAAGAGGCGAGAAGG - Intronic
904585562 1:31577883-31577905 AAGTGCATGGAAAAGGATGATGG - Intronic
904742173 1:32686606-32686628 AACTTCAGGAAGAAGGGAAATGG + Intronic
904901178 1:33858335-33858357 TATTGCAGGAGGAGGGAAGAAGG - Intronic
904978887 1:34479994-34480016 TAGTGCAGGCAGAGGGGAGAAGG + Intergenic
905074884 1:35261699-35261721 AAGAGGAGGAAGGAGGAAGAAGG - Intergenic
905137839 1:35813780-35813802 AGGAAGAGGAAGAAGGAAGAAGG + Intronic
905246335 1:36616874-36616896 ATGTGCTGGAAGGAGGCAGAAGG + Intergenic
905293493 1:36939461-36939483 AACTGCATGCAGAAGGCAGACGG + Intronic
905699765 1:40002655-40002677 AATTACAGAAAAAAGGAAGATGG + Intergenic
905889330 1:41509752-41509774 AGGTGCAGGTAGAAGGAGGAGGG - Exonic
906180816 1:43817332-43817354 AGAAGAAGGAAGAAGGAAGAAGG - Intronic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906737053 1:48140176-48140198 GAAAGAAGGAAGAAGGAAGAAGG + Intergenic
906749349 1:48245208-48245230 AAGAGAAGGAGGAAGGAAGAAGG + Intronic
907276192 1:53317815-53317837 GAGTGCAGGAAGAAGGCAGAAGG + Intronic
907364470 1:53946835-53946857 GAGAGCGGGAAGAAGGAAGGGGG + Intronic
907470478 1:54670608-54670630 AAGTGGAGGAAGAGAGGAGAGGG - Intronic
907763735 1:57387961-57387983 GAGTGGAGGAAGAAGACAGAGGG - Intronic
907865113 1:58391740-58391762 GGGTGCAGGAAGCAGTAAGAGGG - Intronic
907909365 1:58813640-58813662 GAGTGTAGAAAGATGGAAGAAGG + Intergenic
908376607 1:63548585-63548607 AAGTGGAAGAAGAAGAAAGAGGG - Intronic
909022424 1:70446880-70446902 AAGAGGAGGAAGAAGAGAGAAGG - Intergenic
909208420 1:72791082-72791104 AAATGAAGGAAGAAGCAAGCAGG - Intergenic
909251630 1:73364353-73364375 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
909458682 1:75882416-75882438 AAGTGGGGGGAGGAGGAAGAGGG - Intronic
909594398 1:77389515-77389537 GACTGCAGAAAAAAGGAAGATGG + Intronic
909602604 1:77476598-77476620 AAGTGCAGGATGACGGAGTATGG - Intronic
910306317 1:85768303-85768325 AAGTGCAAGAAGAAGTCATAGGG + Intronic
910386757 1:86692563-86692585 TAGGCCAGGAAGAAGGAAGAAGG + Intergenic
910549603 1:88461118-88461140 AGGAGCAGGAAGCAGGCAGAGGG + Intergenic
911238689 1:95440353-95440375 AAATGTAGGAGGAAGAAAGAAGG - Intergenic
911911972 1:103648798-103648820 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
911916482 1:103703150-103703172 ATGGGCAGTAAGAAGAAAGATGG - Intronic
911919387 1:103742936-103742958 ATGGGCAGTAAGAAGAAAGATGG + Intronic
912183301 1:107244651-107244673 AGGAGAAGGAGGAAGGAAGAGGG - Intronic
912698813 1:111861146-111861168 AAGGGCAGAAAGGAGGAAGGGGG + Intronic
912969676 1:114269068-114269090 GGGTGCAGGAAGAAGAACGAGGG - Intergenic
913008868 1:114662964-114662986 AGGAAAAGGAAGAAGGAAGAGGG + Intronic
913213859 1:116603728-116603750 AACAGCAGGAAGGAGGACGAGGG - Exonic
913373176 1:118123192-118123214 AAATGCAGAAAGAATGAAGGAGG - Intronic
913691176 1:121281332-121281354 AAGAGAATGAAGAAGGAAGAAGG - Intronic
915341477 1:155179003-155179025 AAGCGCCTGAAGAAGGCAGAAGG - Intronic
915623405 1:157099585-157099607 AAGGGAAGGAAGGAGGCAGAGGG + Exonic
915993927 1:160545455-160545477 ACGTGCAGGAAGGAGGAAAGAGG - Intronic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
916191405 1:162182064-162182086 TAGTACATGAAGAAGGAAGATGG - Intronic
916616262 1:166444203-166444225 AAGAGGAGGAAAAAAGAAGAAGG + Intergenic
916981630 1:170144324-170144346 AATACCAGGAAGAAAGAAGATGG + Intergenic
917116134 1:171605604-171605626 ATGGGCAGTAAGAAGAAAGATGG - Intergenic
917635697 1:176933703-176933725 GAGGGCAGGATGAAGCAAGAAGG + Intronic
917725219 1:177821369-177821391 AATTGGAGGAAGGAGGGAGAAGG + Intergenic
918065763 1:181100605-181100627 AAGTGTTTGAAGAACGAAGATGG - Intergenic
918273362 1:182925099-182925121 AAGTGAAGAAAGAAAGAAGGAGG + Intronic
918524403 1:185450124-185450146 AAAAGGAGCAAGAAGGAAGAAGG - Intergenic
918837887 1:189491463-189491485 GGGAGCAGGAAAAAGGAAGAAGG - Intergenic
919094205 1:193010356-193010378 AAGGGGAAGAAGAAGAAAGAAGG + Intergenic
919133169 1:193476147-193476169 AAAGGCAGGAAGATGGAAGGAGG - Intergenic
919678425 1:200409732-200409754 AGGAGGAGGAAGAGGGAAGAGGG + Intronic
919830588 1:201538258-201538280 GTCTGCAGGAAGAAGGCAGAAGG - Intergenic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920107154 1:203561996-203562018 AAGAGGAAGAAGAAGAAAGAAGG + Intergenic
920201264 1:204261258-204261280 GGGTGCAGGAAGAATAAAGAGGG - Intronic
920287517 1:204891216-204891238 AAGTGAAGGAACAGGCAAGAAGG + Intronic
920478500 1:206299808-206299830 AAGAGAATGAAGAAGGAAGAAGG - Intronic
920847465 1:209606161-209606183 GGGTGCAGGTAGGAGGAAGAAGG + Intronic
920976644 1:210792066-210792088 AAGTGGAGGAGGAAAGAAGATGG - Intronic
921051949 1:211517220-211517242 TGGTGGAGGAAGCAGGAAGAAGG + Intergenic
921056331 1:211545295-211545317 AAGAGCAGAGTGAAGGAAGAGGG - Intergenic
921099506 1:211916252-211916274 AAGAGCTGGAAGAAGGAACCTGG - Intergenic
921280212 1:213559139-213559161 AAGTGAAGGATGAAGCTAGAGGG - Intergenic
921422066 1:214959677-214959699 AAGTGGAGGCAGAAGGGAGAGGG + Intergenic
921497947 1:215863828-215863850 AAATAGAGAAAGAAGGAAGATGG + Intronic
921893993 1:220380055-220380077 AAGTGCAGGGAGGAGAAGGACGG - Intergenic
922068553 1:222168483-222168505 AAGAGAAGGAAGAGGGAAGGAGG + Intergenic
922730215 1:227945639-227945661 CAGTCCAGGAAGCAGGGAGAAGG - Intronic
922878551 1:228960891-228960913 GCGTGCAGGAGGAAGGAAGCAGG + Intergenic
922986193 1:229867697-229867719 AACTGCAGGAGGAAGGAATAAGG - Intergenic
923120580 1:230986400-230986422 AAGTGCTGGAAGAAAAATGAAGG - Intronic
923534496 1:234838321-234838343 AGGGGAAAGAAGAAGGAAGAAGG + Intergenic
923538166 1:234869105-234869127 AAGTGCCAGAAGTGGGAAGATGG - Intergenic
923767868 1:236909535-236909557 AATTTCAGGTAGGAGGAAGATGG + Intergenic
923841494 1:237676660-237676682 AAGTGAAGGATAAAGGGAGAAGG - Intronic
923937960 1:238785483-238785505 AGGTGCTGGAAATAGGAAGATGG - Intergenic
924261719 1:242238324-242238346 AAGTGCAGGAAGAGGGTAGCAGG - Intronic
924457979 1:244233413-244233435 ACGTGCAGGAAGGGGGACGATGG - Intergenic
924467423 1:244311198-244311220 AGGAGGAGGAAGAGGGAAGAGGG - Intergenic
924854336 1:247860784-247860806 AAGTGCTGGAGAATGGAAGATGG - Intronic
1063225656 10:4013105-4013127 AAGGGAAGGACGAAGGGAGAGGG - Intergenic
1063297178 10:4818185-4818207 AAATAAAGGAAGAGGGAAGAAGG + Intronic
1063297287 10:4819648-4819670 AAATGAAGAAAGAGGGAAGAAGG + Intronic
1063605747 10:7521452-7521474 AAAAGAAGGAAGAAAGAAGAAGG - Intergenic
1063709430 10:8463032-8463054 ACGTGCAAGAAAAAGGCAGAAGG + Intergenic
1064489211 10:15832341-15832363 AACTGGAAGAAGAAGAAAGACGG + Intronic
1064526262 10:16260001-16260023 AGGTGGAGGAGGAAGAAAGAGGG - Intergenic
1064646042 10:17460727-17460749 AAGTGCACAAAGAAAAAAGAAGG + Intergenic
1064781611 10:18845537-18845559 CAGTGCAGGAAGCAGGAATGCGG + Intergenic
1064834995 10:19516735-19516757 AAGAGAAAGAACAAGGAAGAAGG - Intronic
1064965016 10:21006513-21006535 AAGGGAAGGAACAGGGAAGAAGG - Intronic
1065141187 10:22719734-22719756 AAGTTCACTAAGAAGAAAGAAGG + Intergenic
1065261061 10:23923602-23923624 ATGTGTCGGAAGAAGGAGGAAGG + Intronic
1065281386 10:24142466-24142488 AGCTGGAGAAAGAAGGAAGATGG + Intronic
1065350500 10:24791468-24791490 AAGTGGAGGAGGAAGGAAATGGG + Intergenic
1065355824 10:24840517-24840539 AAGTACAGCAAGAAGGAAATCGG - Intergenic
1065360827 10:24887468-24887490 AAGTGCAGAGCGAAGGGAGAGGG - Intronic
1065694287 10:28365661-28365683 AAGTGAAAAAAGGAGGAAGAAGG + Intergenic
1065802084 10:29361663-29361685 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
1065856490 10:29834819-29834841 CAATCCAGGAAAAAGGAAGAAGG - Intergenic
1065904800 10:30240757-30240779 AAAAGAAGAAAGAAGGAAGAAGG + Intergenic
1066243154 10:33557308-33557330 AGTTGCAGGAACAGGGAAGATGG - Intergenic
1066325201 10:34352349-34352371 AAGTGGAGGGAGAGGGGAGAGGG - Intronic
1066350895 10:34636070-34636092 GAAGGAAGGAAGAAGGAAGAAGG + Intronic
1066397588 10:35041256-35041278 AGGTGAAGGAGGATGGAAGAAGG + Intronic
1067565514 10:47333466-47333488 AGGTCCAGGAAGAAAGAGGAAGG - Intergenic
1067719907 10:48720290-48720312 AAATGCAGGAGGAGGGAAGAGGG + Intronic
1067784849 10:49238092-49238114 AAGTCCAGTGAGAAGGAAGTTGG - Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068412669 10:56677750-56677772 AGGAGGAGGAAGCAGGAAGAAGG + Intergenic
1068912182 10:62390032-62390054 GAGGGCAGGATGAAAGAAGACGG - Intronic
1068971079 10:62959135-62959157 AAGTGCCAGGAGAAGGATGATGG - Intergenic
1069034758 10:63634875-63634897 TAGTGCAGGAGGTAGTAAGAAGG - Intergenic
1069107145 10:64397191-64397213 AAGTAAAGAAAGAAAGAAGAGGG + Intergenic
1069335146 10:67340174-67340196 AAGGGCAGGAGGAAGGAGGAGGG + Intronic
1069685162 10:70313218-70313240 GAGTGCAGAAGGAAGGAGGAGGG - Intronic
1069718517 10:70535580-70535602 AGGAGAAGGAAGGAGGAAGAAGG - Intronic
1069979105 10:72239908-72239930 AAGGGCAAGAATAAGGCAGAGGG + Intergenic
1070440363 10:76436910-76436932 AGGTGGAGGGAGAAGGAAGGTGG - Intronic
1070697878 10:78576379-78576401 AAGTTCAAGGGGAAGGAAGAAGG + Intergenic
1071093291 10:81945303-81945325 AAGAGGAGGAAGGAGAAAGAAGG - Intronic
1071104711 10:82080889-82080911 GAGGGAAGGAAGAAAGAAGAGGG - Intronic
1071268973 10:83989794-83989816 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071268981 10:83989835-83989857 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071347969 10:84711427-84711449 GAGTCCAGGAAGAAAGAAGGTGG + Intergenic
1071544047 10:86514487-86514509 TTGTGAAGGAGGAAGGAAGATGG + Intronic
1071766134 10:88667734-88667756 GAGGGAAGGAAGAAGAAAGAAGG - Intronic
1071771731 10:88736203-88736225 AAGAGGAGGAAGAAGAAAAAGGG + Intronic
1071930741 10:90466682-90466704 AAGTGCCGGAACAAGGGAAATGG + Intergenic
1071955306 10:90751294-90751316 GAGTGAAGGAGTAAGGAAGAGGG + Intronic
1072240302 10:93489602-93489624 AGATGCAGGGAGAAGGAAGCTGG - Intergenic
1073445468 10:103577728-103577750 CAGTGCTGGTACAAGGAAGAGGG + Intronic
1073764313 10:106665350-106665372 AAGGGAAGGAAGAAGGAGAAAGG - Intronic
1073871876 10:107874052-107874074 AAAGGAAGGAAGAAGGAAGGAGG + Intergenic
1074389279 10:113043587-113043609 TGGGGAAGGAAGAAGGAAGAGGG - Intronic
1074480625 10:113816918-113816940 TATTGAAGGAAGAAAGAAGAGGG + Intergenic
1074732161 10:116390746-116390768 AGGAGGAGGAAGAAGGAAGAAGG + Intergenic
1074813931 10:117130900-117130922 AAGAGCAGGAAGCTGGAAGGAGG + Intronic
1074814673 10:117135008-117135030 CGGTGAAGGAAGAGGGAAGAAGG + Intronic
1074885752 10:117691880-117691902 GAGTGGAGGAAGGAGGAAGCAGG - Intergenic
1074913729 10:117936212-117936234 GAGTGAAGGAAGGAGGACGAGGG - Intergenic
1075282877 10:121155802-121155824 AAGTACAGGAAGCAGGAGAAGGG + Intergenic
1075396367 10:122130582-122130604 AGGTGGAAGAGGAAGGAAGAGGG - Intronic
1076043510 10:127272038-127272060 AACTGCAGGAGGATGGAGGAAGG + Intronic
1076068176 10:127465121-127465143 AAGAAGAGAAAGAAGGAAGAAGG + Intergenic
1076358534 10:129870188-129870210 AAATACAGGCAGAAGGAAGATGG - Intronic
1076558756 10:131347220-131347242 GAGATAAGGAAGAAGGAAGAAGG - Intergenic
1076587078 10:131556564-131556586 AGGTGCTGGCAGAAGCAAGAAGG - Intergenic
1076798327 10:132809453-132809475 AGGGGCAGGAGGAAGGCAGACGG - Intronic
1076870882 10:133193569-133193591 AAGAACAAGAAGAAGGAAAAAGG + Intronic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077599844 11:3566683-3566705 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077651354 11:3975631-3975653 AGAAGAAGGAAGAAGGAAGAAGG + Intronic
1077838264 11:5944384-5944406 AGTTGCAAGAGGAAGGAAGAGGG + Intergenic
1077921861 11:6647340-6647362 CAGAGCTGGAAGAAGGAGGAGGG + Intronic
1078016628 11:7620493-7620515 GAGTGAAGGAAGATAGAAGAGGG - Intronic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078280987 11:9900965-9900987 AGGTGGAGGCAGAAGGAAGCAGG - Intronic
1078359251 11:10655756-10655778 AGGTGGAGGAAGAAAGTAGAGGG - Intronic
1078440499 11:11361808-11361830 AAGTCCAGCACGAAAGAAGAGGG + Intronic
1078535746 11:12172141-12172163 CAAAGCAGGAAGAAGGTAGATGG + Intronic
1078673659 11:13389030-13389052 ATGTCCTGGGAGAAGGAAGAAGG - Exonic
1079077168 11:17391110-17391132 AAGTGCAGGATGGAGCAAAAGGG - Intergenic
1079132560 11:17756030-17756052 AAGTGCAAGAAGAAGGAGGGAGG + Intronic
1079341976 11:19618811-19618833 AAGTGGAGTAAGAAGGAAGATGG + Intronic
1079448114 11:20574695-20574717 AAGTACAGGAAGAAGGCTGAAGG - Intergenic
1079655425 11:22980910-22980932 AAGTGCAAGAAAAAGGCAGCAGG - Intergenic
1079950001 11:26790255-26790277 AAGTCTAGGTAGAAAGAAGATGG + Intergenic
1080295297 11:30720326-30720348 AAGAGAAAGAAGAAGGAAGAAGG - Intergenic
1081305336 11:41505030-41505052 GAAAGAAGGAAGAAGGAAGAAGG - Intergenic
1081433925 11:43006110-43006132 AAAAGAAGGAAGAAAGAAGAAGG + Intergenic
1081462104 11:43281419-43281441 TAGAGCAGGAGGCAGGAAGATGG - Intergenic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1081865510 11:46357579-46357601 CAGTGCAGGAGGAAAGAACAGGG - Intronic
1081884118 11:46480103-46480125 AAGTGGAAGAGGAAGGCAGAAGG - Intronic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1083001800 11:59299046-59299068 AAGAACAAGAAGAAGAAAGAAGG + Intergenic
1083081884 11:60102574-60102596 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
1083142523 11:60733703-60733725 AAGTGGAGGAAGAAGGAGCATGG + Intronic
1083541620 11:63515542-63515564 AACTGCAGGAAGCAGGAGGAAGG - Exonic
1083631920 11:64100014-64100036 TAGTGCAGCAAGAAGGAAACTGG + Intronic
1083851867 11:65372765-65372787 CAGTGCAGGAAGTAGGCAGGAGG - Intergenic
1083925510 11:65803768-65803790 AAGTGCAGGAAGGAAGATGCTGG + Intergenic
1083928328 11:65823161-65823183 TAGTGCAGGAAAAAGGCAAATGG - Intronic
1084255753 11:67941304-67941326 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1084733130 11:71087321-71087343 GAGGGCAGGAAAAAGGAAAAAGG + Intronic
1084817005 11:71654023-71654045 ATGTGCAGGTGGAATGAAGAGGG + Intergenic
1084857320 11:71997522-71997544 AAGGGCAGCAAGAACGAAGCAGG + Exonic
1084882041 11:72178267-72178289 AAGCGCAGGTGGAAGGAAGATGG + Intergenic
1085029618 11:73262955-73262977 AAGTGGAGGAAGAACAAGGAAGG + Intergenic
1085335415 11:75690046-75690068 AGTAGAAGGAAGAAGGAAGAAGG - Intergenic
1085587906 11:77728602-77728624 AAGGGAAGGGAGAAGGGAGACGG + Intronic
1085671574 11:78469850-78469872 AAGTGGAATAAGAAGGCAGAGGG + Intronic
1085847297 11:80080680-80080702 AAGGACAGGAGGAAGAAAGAAGG + Intergenic
1085955990 11:81395756-81395778 AAGGGGAGGAAGATGGCAGATGG - Intergenic
1086178194 11:83917953-83917975 AAGTGCATGAAGAAGAATGAAGG + Intronic
1086226026 11:84510879-84510901 AAATGAAGGGAGAAGGGAGAAGG + Intronic
1086282859 11:85210845-85210867 AATGGAAGGGAGAAGGAAGAAGG - Intronic
1086528503 11:87756855-87756877 AATTGAAGGAAGAAGGAAGCAGG - Intergenic
1086540279 11:87900738-87900760 GAGGGAGGGAAGAAGGAAGATGG + Intergenic
1086571624 11:88291439-88291461 GAAGGAAGGAAGAAGGAAGAAGG + Intergenic
1087850285 11:103019843-103019865 AAGGGGAGTGAGAAGGAAGAAGG + Intergenic
1087930011 11:103966190-103966212 GGGTGGAGGAAGAGGGAAGAAGG + Intronic
1087968402 11:104448773-104448795 AAGGAGAGGAAAAAGGAAGATGG + Intergenic
1088463817 11:110112029-110112051 AGGTGCAGGGATAAGGAAGGAGG + Intronic
1088639442 11:111857127-111857149 AAATAAAGAAAGAAGGAAGACGG + Intronic
1088751882 11:112849191-112849213 AAGGACAAGAGGAAGGAAGAAGG - Intergenic
1088753960 11:112869924-112869946 AACTACAGGAAGAATGAAGTGGG + Intergenic
1088843184 11:113643776-113643798 AAATGCAGAGAGGAGGAAGAAGG - Intergenic
1089041048 11:115450271-115450293 AAGTGAAGGAAACAGAAAGATGG - Intronic
1089149470 11:116353813-116353835 GAGTGAAGGAGCAAGGAAGAGGG - Intergenic
1089391475 11:118104850-118104872 AAGAGGAGGAAGGAGGAAGGAGG - Intronic
1089748328 11:120632587-120632609 AAGAGCAGGAAGAAGGTGGCTGG - Intronic
1090198683 11:124839098-124839120 ACGTGCAGGGAGAAGGAATAGGG - Intergenic
1090507316 11:127331415-127331437 AAGAGGAGGAAGAAGGAAAAAGG + Intergenic
1090623552 11:128584856-128584878 AAGGGAAGGAGGAGGGAAGAGGG + Intronic
1090639307 11:128716891-128716913 CAGTGCAGGGAGGAGGAAGAAGG + Intronic
1090694287 11:129221859-129221881 AGGAGCAGAAAGAAAGAAGAGGG - Intronic
1090876502 11:130793256-130793278 TAGTGCAGGAAGAAAGAAACTGG - Intergenic
1091335514 11:134762871-134762893 AAGTGCGGGAAGGAGAGAGAAGG + Intergenic
1091412397 12:252771-252793 AAGAGCAGGAAGCATGAATATGG - Intronic
1091593112 12:1857098-1857120 ATGTGTAGGAAGAAGGAAGAAGG + Intronic
1091621966 12:2095707-2095729 GAGTGCAGGACATAGGAAGATGG + Intronic
1092027704 12:5256851-5256873 AAGTGGACAATGAAGGAAGAAGG + Intergenic
1092284079 12:7118923-7118945 AGGAGGAGGAAGAAGAAAGATGG + Intergenic
1092425993 12:8376042-8376064 ATGTGCAGGTGGAATGAAGAGGG - Intergenic
1092509961 12:9144381-9144403 AAGTGAAGTAAGAGGCAAGATGG + Intergenic
1092550217 12:9490302-9490324 AGGTGGAAGGAGAAGGAAGAAGG + Intergenic
1092570304 12:9714337-9714359 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
1092576314 12:9787083-9787105 AAGGGGAGGAAGAAAGAAGGGGG - Intergenic
1092652668 12:10651163-10651185 AAGTGCAGGACCAAGGCAGGAGG - Intronic
1092754676 12:11752416-11752438 AAGGGCAGGAAGAGGGGAGGGGG - Intronic
1093019981 12:14194316-14194338 GAGTGAAGGAAGAAGGAAGGAGG - Intergenic
1093434342 12:19118466-19118488 AACTGGAGGAGGAAGGAAGGAGG + Intergenic
1093568895 12:20643034-20643056 AAGTGTATCAAGACGGAAGAGGG + Intronic
1093859318 12:24143840-24143862 AAGAGGAGGAGGAAAGAAGAAGG + Intergenic
1094276166 12:28677662-28677684 AGATGAAGGAAGAAGGAAGTTGG + Intergenic
1094498619 12:31004757-31004779 GAGGGCAGGAGGAAGGAAGAAGG + Intergenic
1094521591 12:31196071-31196093 AGGTGGAAGGAGAAGGAAGAAGG - Intergenic
1094628260 12:32146916-32146938 AGGAGGAGGAAGGAGGAAGAAGG - Intronic
1095668281 12:44828381-44828403 AATTGGAGTAAGAAGGTAGAAGG - Intronic
1095993648 12:48059018-48059040 AAGTGCAACGAGAAGGAAAAAGG - Intronic
1096023562 12:48342212-48342234 ATGTGCAGGATGAAGGGAGTAGG + Exonic
1096176548 12:49524502-49524524 AAGTGGAGGAAGAGGGCAGAAGG + Intronic
1096280857 12:50252200-50252222 AAGTGAAGGCAGGAGGAGGAAGG + Intronic
1096873484 12:54609491-54609513 AAGTGCAGCAGGAAGGATTAAGG + Intergenic
1097098753 12:56571245-56571267 AAGAGCAGGAGGAGGGGAGAAGG - Intronic
1097198581 12:57259063-57259085 AAGGGCAGGAAGAAAGCAGTTGG + Intronic
1097282660 12:57854250-57854272 AAGGGGAGGAAGGAGGAAGAAGG + Intergenic
1097548051 12:61029398-61029420 AAGAGAACGAAGAAGAAAGAAGG - Intergenic
1097623805 12:61975294-61975316 AAGTGAGGGAAGAAGGAATGGGG - Intronic
1097673746 12:62573706-62573728 AAATTCAAGAATAAGGAAGATGG - Intronic
1097901562 12:64878690-64878712 GGGTGAAGGAAGAAGGAAGAAGG - Intronic
1098395102 12:70008682-70008704 AAGTGCTGAAAGAAGAAAAACGG + Intergenic
1098700461 12:73617867-73617889 AACTGCAGCCAAAAGGAAGAGGG + Intergenic
1098702694 12:73648681-73648703 AAGGGCAGCAAGAAGAAAAAAGG + Intergenic
1098997621 12:77139566-77139588 CAGTGCAGGAAGGAGGAAAGAGG - Intergenic
1099460246 12:82912196-82912218 AAGTGTAGAAAGAAGGAACTGGG + Intronic
1099480738 12:83162789-83162811 AATTGAAGAATGAAGGAAGAAGG - Intergenic
1099493076 12:83309587-83309609 AAGAAGAGAAAGAAGGAAGAAGG + Intergenic
1099643363 12:85319451-85319473 GAAAGAAGGAAGAAGGAAGAGGG - Intergenic
1099802717 12:87476927-87476949 AAAGGAAGGAAGGAGGAAGAAGG - Intergenic
1100169942 12:91963057-91963079 AAGAAGAGGATGAAGGAAGAAGG - Intergenic
1100574745 12:95880077-95880099 AAGTGCGGGAAAAAGGGAAAGGG + Intronic
1100742874 12:97614683-97614705 AAGAGAAGGAAGAAAGAAGAAGG - Intergenic
1101050687 12:100860539-100860561 AAATTTAGGAAGAAGGAAGTAGG - Intronic
1101193764 12:102361687-102361709 GAGAGGAAGAAGAAGGAAGAAGG + Intergenic
1101260255 12:103021983-103022005 AAGTGCAGAGTGAAGGAGGATGG - Intergenic
1101547560 12:105730744-105730766 AAGTGTAGGAAGAACAAAGTAGG - Intergenic
1101556079 12:105810971-105810993 AAGACCAGGAAAAAGCAAGAGGG - Intergenic
1101594226 12:106149471-106149493 CAGGGCAGGGAGAAGGAAGGCGG + Intergenic
1101762258 12:107668622-107668644 AAATGCAGGGAGAAGCAAGAGGG + Intergenic
1101808875 12:108090781-108090803 AAGGGCAAGAAGAAGGCAGTGGG + Intergenic
1101861873 12:108489101-108489123 AAGAGCAAGAAGAAAGAAAAGGG + Intergenic
1102098231 12:110257403-110257425 AAGTGGAGGAAGCAGGGAAACGG - Intergenic
1102745219 12:115243926-115243948 AAGGGAAGGGAGAAGAAAGAAGG + Intergenic
1102899319 12:116624071-116624093 AGGTGAAGGAAGAAGGAAGAAGG + Intergenic
1102899321 12:116624097-116624119 AAGAGAATGAAGAAGGAAGAAGG + Intergenic
1103180755 12:118909225-118909247 ATGCGCAGGAAGTAGAAAGAGGG + Intergenic
1103195785 12:119042674-119042696 AAGGGCAGGAAGAGGGAGGAAGG + Intronic
1103229345 12:119315093-119315115 AGGTGGGGGAAGGAGGAAGAGGG - Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103359904 12:120347410-120347432 AGGTGCAGGAAGAGAGATGAGGG - Intronic
1103366967 12:120390568-120390590 AAGGGAGGGAAGAGGGAAGAAGG + Intergenic
1104609842 12:130219135-130219157 CAATGCAGGAAGAAGTGAGATGG + Intergenic
1104691145 12:130827248-130827270 TAGTGTAGGAAGAATGATGATGG - Exonic
1104955928 12:132465817-132465839 ATGTGCAGGGTGAAGGCAGACGG + Intergenic
1105217089 13:18294279-18294301 AACAGCAGGAAGGAGGACGAGGG - Intergenic
1105929039 13:25034602-25034624 AAAGGCAGGAGGAAGGGAGAGGG - Intergenic
1106042940 13:26111234-26111256 TAGAGGAGGAAGGAGGAAGAGGG - Intergenic
1106080424 13:26496031-26496053 AAGTGGAGGAAGCTGCAAGATGG + Intergenic
1107059708 13:36146154-36146176 AAGTCCAGGAAGCAGGAATGAGG + Intergenic
1107130146 13:36886361-36886383 AAATGCAGGAGGATGGGAGATGG + Intronic
1107315209 13:39123989-39124011 TAGTCCAGGAAGATGGAAGAAGG - Intergenic
1107526109 13:41233280-41233302 GAGTAGAGGAAGTAGGAAGAGGG + Intronic
1107758485 13:43651240-43651262 AAGAGGAAGAAAAAGGAAGAGGG + Intronic
1107789247 13:43984550-43984572 AAACAAAGGAAGAAGGAAGAGGG + Intergenic
1107817047 13:44253771-44253793 AACTTCAGGAAGTAGGAGGATGG - Intergenic
1108166398 13:47697780-47697802 AAGTGAAGGAAGAGGAAGGAAGG - Intergenic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1108543652 13:51468738-51468760 AAGTAAAGAAAGAAGGAACAAGG - Intergenic
1108854630 13:54777249-54777271 GAGAGAAGGAAGAAGGAGGAAGG + Intergenic
1108971115 13:56378458-56378480 AAGTGAGGGAAGAAGGGAGGAGG + Intergenic
1109085725 13:57969013-57969035 AAATGTACGATGAAGGAAGAAGG + Intergenic
1109687384 13:65839315-65839337 AACTGAAGCAAGGAGGAAGAAGG - Intergenic
1109803348 13:67404698-67404720 ATGGGCAGTAAGAAGAAAGATGG - Intergenic
1110177479 13:72574217-72574239 AAGAGCCAGAAGAAGTAAGATGG - Intergenic
1110868002 13:80419949-80419971 AAGGGAAGGGAGAAGGGAGAAGG - Intergenic
1111146961 13:84194766-84194788 AAAGACAGAAAGAAGGAAGAAGG - Intergenic
1111215398 13:85134115-85134137 AAGAGCAGCAAGAGGGAAGTCGG + Intergenic
1111216652 13:85151991-85152013 AAAGGAAGGAAGAAGGAAGGAGG - Intergenic
1111336260 13:86827907-86827929 AACTGTAGGAAAAAGGAATAAGG + Intergenic
1111674134 13:91366407-91366429 AGGAGCAGGAATAAGGGAGAAGG + Intergenic
1111956360 13:94763046-94763068 CAAAGCAGGAAGAAAGAAGAGGG - Intergenic
1112011745 13:95299354-95299376 ACGTGGAGGAGGAAGGAATATGG - Intronic
1112015185 13:95325600-95325622 AAGGGAAGGGAGAAGGAAGGAGG + Intergenic
1112124285 13:96447558-96447580 AAGGGCAAGAAGAAGGCAGCAGG - Intronic
1112169539 13:96956326-96956348 CAGAGCAGGAGGAAGAAAGAAGG + Intergenic
1112536550 13:100262698-100262720 AAAAGAAGGAAGAAGGAGGAGGG - Intronic
1112922939 13:104637637-104637659 TAGGGCTGGAAGAGGGAAGAGGG + Intergenic
1112956413 13:105064274-105064296 AAAAGCAAGAAGAAGCAAGATGG + Intergenic
1113276342 13:108734928-108734950 AAGTCCAGTGAGAAGGAAGTTGG + Intronic
1113367226 13:109687694-109687716 CATTCCAGGAAGCAGGAAGAGGG + Intergenic
1113552256 13:111201782-111201804 CGGTGCTGGAAGAAGGAAGAGGG - Intronic
1113613296 13:111663323-111663345 AAGGTGAGGAAGAAGGAGGAGGG - Intronic
1113613312 13:111663395-111663417 AAGGCGAGGAAGAAGGACGAGGG - Intronic
1113852037 13:113423379-113423401 AGGTGCAGAAGGAAGGCAGAGGG + Intronic
1114490942 14:23101539-23101561 GAATGCTGGAAGAAGGAAAACGG - Intergenic
1114552115 14:23538721-23538743 AAGAGGAGGAAGGAGGAAGAGGG + Intronic
1114711380 14:24781673-24781695 AGGTACAGGAAGAAGAGAGAAGG + Intergenic
1114816649 14:25966688-25966710 AGGTTTAGGAAGAAGGGAGAAGG + Intergenic
1114870366 14:26648347-26648369 AAGTAAAGGCAGGAGGAAGAAGG + Intergenic
1115163581 14:30423333-30423355 AAATGCAGAAAGAATCAAGACGG + Intergenic
1115314847 14:32014847-32014869 AGCTGCAGGAAGAAGGTAAAGGG - Intronic
1115318008 14:32046564-32046586 AAAGGCCAGAAGAAGGAAGAAGG - Intergenic
1115456050 14:33603563-33603585 AAGAGCAGCAAGAGGGAAAAAGG + Intronic
1115620118 14:35132837-35132859 AAGGGAAGGAAGAAGGAAGAAGG + Intronic
1115834162 14:37378708-37378730 AAGGAAAGGAAGAAGGGAGAGGG + Intronic
1115945311 14:38653217-38653239 AAGAGATGGAGGAAGGAAGACGG - Intergenic
1116556846 14:46321940-46321962 ATGTGCAGGAAGGAGGATAAGGG + Intergenic
1116699715 14:48224541-48224563 AAGAGCAGAAGGAAGGAAGTGGG + Intergenic
1116936461 14:50745499-50745521 AGGTTCAGGAAGTAGAAAGATGG - Intronic
1117200694 14:53386948-53386970 AAGTGAAAGAAGACTGAAGAAGG - Intergenic
1117508926 14:56429405-56429427 AGGGGCAGGTAAAAGGAAGAGGG - Intergenic
1118293892 14:64550654-64550676 AACGGCAGGAAGGAGGGAGAGGG - Intronic
1118427026 14:65676603-65676625 GAGGGAAGGAAGAAGGAAGGAGG - Intronic
1118462484 14:65999596-65999618 AATAGCAGAAAGCAGGAAGATGG - Intronic
1118676331 14:68188411-68188433 AAGAGGAGAAAGAAGAAAGATGG - Intronic
1118771438 14:68945286-68945308 CAGTGCAGGAGGGAAGAAGAGGG + Intronic
1119155249 14:72404406-72404428 CAGTGCTGGAACAAGGCAGATGG - Intronic
1119168252 14:72513642-72513664 AAATGCACAAAGCAGGAAGAAGG - Intronic
1119562591 14:75603031-75603053 AAGAGAAGGGATAAGGAAGAAGG - Intronic
1119854019 14:77885985-77886007 GAGGGAAGGAAGAAAGAAGAAGG + Intronic
1119957398 14:78813852-78813874 AAGTGAAGCCAAAAGGAAGAAGG - Intronic
1119996833 14:79262445-79262467 AAGAGGAGGAGGAAGGAGGAAGG + Intronic
1119997651 14:79271382-79271404 AGGGGAAGGAAGAAGGAGGAAGG - Intronic
1120050657 14:79861803-79861825 AAGTACAGGAACAGGGACGAGGG + Exonic
1120100337 14:80437588-80437610 AAAGACAGAAAGAAGGAAGAAGG + Intergenic
1120134522 14:80850058-80850080 GAGGGAAGGAGGAAGGAAGAAGG + Intronic
1120682124 14:87492710-87492732 AAGTGGAGGATCCAGGAAGAGGG - Intergenic
1120847378 14:89138472-89138494 AAGTGCAGGAAGCATGTAAAAGG + Intronic
1120920696 14:89752801-89752823 AAATGCAGCAAGAAGGAGCAAGG - Intergenic
1121152809 14:91652707-91652729 AAATGCAGCAAGAGGCAAGAGGG + Intronic
1121433000 14:93900501-93900523 AAGTGAAGGATGCACGAAGAAGG - Intergenic
1121658045 14:95612767-95612789 AATGGAAGGAAGAAGAAAGAAGG + Intergenic
1121664146 14:95659095-95659117 AAGACCAGGAGGAAGGAAGGAGG + Intergenic
1121780454 14:96618809-96618831 AAGCGCTGGAAGAAGGGAAAGGG - Intergenic
1121828396 14:97029177-97029199 AAGAGAAGAAAGAGGGAAGAAGG - Intergenic
1121969652 14:98344486-98344508 GGTTGCAGGAAAAAGGAAGAGGG + Intergenic
1122102445 14:99424329-99424351 AAGAGCAGGAAGAACGAAGCAGG + Intronic
1122321437 14:100858245-100858267 AAGTGCAGGGATGAGGAAGGAGG + Intergenic
1122408822 14:101515792-101515814 AAAGGCAGGAAGTAGGAAGAGGG + Intergenic
1124069546 15:26378623-26378645 AAATGAAGGAAGAAGAAGGAAGG - Intergenic
1124083561 15:26524085-26524107 AACAACAGGAAAAAGGAAGAGGG - Intergenic
1124375266 15:29125549-29125571 AAGTGCAGGAACCCTGAAGAGGG - Intronic
1124957747 15:34370816-34370838 AGGAGAAGAAAGAAGGAAGAAGG - Intergenic
1125341622 15:38681420-38681442 AGGAAGAGGAAGAAGGAAGAAGG - Intergenic
1125639872 15:41221691-41221713 AAGAGAAGGAAAAAGGATGAGGG - Intronic
1125724249 15:41860358-41860380 AACTGAATGAAGAAGGAAGTGGG + Intronic
1126319597 15:47407896-47407918 AGGTGCAGAAAGGAGGGAGAAGG - Intronic
1127706369 15:61551169-61551191 AGGAGCAGGAATGAGGAAGAAGG - Intergenic
1127788658 15:62378803-62378825 AAGGACAGAAAGAAGGAAGGAGG + Intergenic
1128095574 15:64951676-64951698 AAGAAGAGGAAGAAGAAAGAAGG - Intronic
1128095622 15:64952357-64952379 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
1128095707 15:64953287-64953309 AAGTAAAAGAAGAAGAAAGAAGG - Intronic
1128095772 15:64954055-64954077 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
1128095856 15:64954995-64955017 AAGTGGAAGAAGAAGGAAAGAGG - Intronic
1129298230 15:74611372-74611394 AAGCCCAGGAAGAAGGAATGGGG + Intronic
1129824958 15:78628886-78628908 AACTGCAGGAAGTGGGAAGCTGG + Intronic
1129961981 15:79695179-79695201 AAGCAAAGGAAGAAGGGAGAAGG - Intergenic
1130024508 15:80259951-80259973 GAGCCCAAGAAGAAGGAAGAAGG - Intergenic
1130360873 15:83184744-83184766 AAGAGCAGGAAGAAGGCAAATGG + Intronic
1130704077 15:86215486-86215508 GATTTCAGAAAGAAGGAAGAAGG - Intronic
1130936134 15:88472347-88472369 ACCTGCAGGGACAAGGAAGATGG + Intronic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131086186 15:89577364-89577386 AAGTGCAATGAGAAGGATGAAGG - Intronic
1131133307 15:89913529-89913551 CTGTGCAGGAAGAAGGAGGGAGG - Intergenic
1131150614 15:90045311-90045333 AACAGCAGAAAGAAGGAAGCTGG + Intronic
1131531259 15:93194395-93194417 AACAGCATAAAGAAGGAAGAAGG - Intergenic
1131667387 15:94585079-94585101 GTTTGGAGGAAGAAGGAAGAGGG - Intergenic
1132185338 15:99798349-99798371 AAGGGGAGGAAGAAGGAGGGAGG + Intergenic
1132200166 15:99947465-99947487 AAGAGCATGAAGATGGAGGAGGG - Intergenic
1132221795 15:100110718-100110740 AAGAGCAGCAAGGAGGATGAAGG - Intronic
1132282660 15:100633635-100633657 AAGGAAAGGAAGAAGGAAGGAGG + Intronic
1132437933 15:101826484-101826506 AACTGTAGGTAGAATGAAGAAGG + Intergenic
1132734851 16:1380137-1380159 AAGTGTAAGATGAAGGAAAATGG + Intronic
1132868164 16:2104018-2104040 AGGTGCAGGCAGAAGGAAGGGGG + Intronic
1132879819 16:2157145-2157167 AAGAGAAGGAATGAGGAAGAGGG - Intronic
1133162406 16:3920714-3920736 AACTGCCTGCAGAAGGAAGAGGG - Intergenic
1133460690 16:5984021-5984043 AGGAGGAAGAAGAAGGAAGAAGG - Intergenic
1133580719 16:7142014-7142036 AAAAGAAGAAAGAAGGAAGAAGG - Intronic
1133655733 16:7862079-7862101 AAGTGCAGCCGGAAGGAAGAGGG - Intergenic
1133797526 16:9058240-9058262 AAGTGAAGGAGGAGAGAAGATGG + Intergenic
1133816323 16:9200037-9200059 AAAAGAAGGAAGAAGGAGGAAGG - Intergenic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134060021 16:11193775-11193797 AGGAGGAAGAAGAAGGAAGAAGG - Intergenic
1134197544 16:12170524-12170546 AAGCTCAGGCAGAAGGAGGAGGG + Intronic
1134238489 16:12486429-12486451 AGGACAAGGAAGAAGGAAGAAGG - Intronic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134410342 16:13998684-13998706 AAGAAGAGGAAGAGGGAAGAAGG + Intergenic
1134459084 16:14416127-14416149 AAGGGAGGGAAGGAGGAAGAAGG + Intergenic
1134523610 16:14929106-14929128 AGGTGCAGGCAGAAGGAAGGGGG - Intronic
1134549287 16:15131830-15131852 AGGTGCAGGCAGAAGAAAGGGGG + Intronic
1134566522 16:15256700-15256722 AAGTGAGGGAAGGAGGATGATGG - Intergenic
1134711204 16:16327591-16327613 AGGTGCAGGCAGAAGGAAGAGGG - Intergenic
1134719056 16:16370893-16370915 AGGTGCAGGCAGAAGGAAGGGGG - Intergenic
1134735974 16:16499999-16500021 AAGTGAGGGAAGGAGGATGATGG + Intergenic
1134931550 16:18212160-18212182 AAGTGAGGGAAGGAGGATGATGG - Intergenic
1134948370 16:18340992-18341014 AGGTGCAGGCAGAAGGAAGAGGG + Intergenic
1134955625 16:18381102-18381124 AGGTGCAGGCAGAAGGAAGAGGG + Intergenic
1135013334 16:18903469-18903491 TAGTGGTGGGAGAAGGAAGAAGG - Intronic
1135166826 16:20146492-20146514 AAGGGGAGGAAGGAGGGAGAAGG + Intergenic
1135283233 16:21171169-21171191 AACTTCAGGAGGAAGGATGAAGG - Intronic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135438690 16:22448147-22448169 TAGTGGTGGGAGAAGGAAGAAGG + Intergenic
1135584110 16:23654746-23654768 AAAGGTAGGAGGAAGGAAGAGGG - Intronic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1135886896 16:26318386-26318408 ATGTTCAGGAAGAAGAAGGAAGG + Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136330489 16:29572763-29572785 TAGTGGTGGGAGAAGGAAGAAGG - Intergenic
1136452170 16:30359609-30359631 AAGAGCAAGAACAAGGAGGAGGG + Intronic
1137557137 16:49477610-49477632 AAGAGGAGGAGGAGGGAAGAAGG + Intergenic
1137895872 16:52211614-52211636 AAGAGGACGAAGAAGGGAGAAGG + Intergenic
1137961557 16:52886714-52886736 ATGTGGAGGAAGAAGGGAAAAGG - Intergenic
1137968902 16:52964235-52964257 AAGTACAAGAATAAGAAAGATGG + Intergenic
1138124928 16:54430860-54430882 GCGAGCATGAAGAAGGAAGAAGG - Intergenic
1138215505 16:55201554-55201576 AAGAGAGGGAGGAAGGAAGAAGG - Intergenic
1138637406 16:58352143-58352165 AAGGGCAGGGGGAGGGAAGAGGG - Intronic
1138887651 16:61098901-61098923 AGGAGGAAGAAGAAGGAAGAAGG + Intergenic
1138887652 16:61098908-61098930 AGAAGAAGGAAGAAGGAAGAAGG + Intergenic
1139165757 16:64563339-64563361 AGGTGGAGGAGGAGGGAAGAAGG + Intergenic
1140019641 16:71225673-71225695 AGGTTCAGAAAGAAGGAGGAGGG + Intronic
1140136135 16:72207171-72207193 GAGTGCAGGGTGAAGGGAGATGG + Intergenic
1140286846 16:73611114-73611136 AAAAGCAGGAGGAAGAAAGAGGG + Intergenic
1140376116 16:74446665-74446687 TAGAGGAGGAAGAAGGAGGAGGG - Intergenic
1140416689 16:74778675-74778697 AAGAGAAGGGAGAGGGAAGAGGG - Intergenic
1140420907 16:74817975-74817997 AAATGCTGGAAGATGGGAGAAGG - Intergenic
1141019763 16:80484355-80484377 AAGGGAAGGAAGAAAGAAGGAGG + Intergenic
1141056853 16:80824818-80824840 AAGAGAAGGAGGAAGGAAGGAGG + Intergenic
1141220137 16:82061856-82061878 ACATTCAGAAAGAAGGAAGATGG - Intronic
1141294134 16:82751037-82751059 AAGATCAGGAAGGAGGAGGATGG - Intronic
1141372404 16:83500353-83500375 AGAAGAAGGAAGAAGGAAGAAGG - Intronic
1141382003 16:83585216-83585238 GAGTGCAGGAAGGTGGAAGGAGG - Intronic
1141447638 16:84072301-84072323 AAGGGCTGGTGGAAGGAAGAAGG + Intronic
1141500925 16:84443534-84443556 AAGTCCAGGAGGAAGCAGGAAGG - Intronic
1141775660 16:86121427-86121449 GATTGCAGGGAGAAGGAGGAGGG - Intergenic
1141845119 16:86603377-86603399 AGGAGGAGGAAGAAGGAGGAGGG - Intergenic
1141850661 16:86643268-86643290 AAGGGGTGGCAGAAGGAAGATGG - Intergenic
1141902309 16:86999503-86999525 GAATGAACGAAGAAGGAAGAAGG - Intergenic
1142023637 16:87800525-87800547 AAGTCCTGGCAGAAGGCAGAAGG + Intergenic
1142488955 17:265558-265580 AAGGGAGGGAAGAGGGAAGAGGG - Intronic
1142785329 17:2217615-2217637 ATGTGCAGGAGGATGGTAGAGGG - Intronic
1143021326 17:3918330-3918352 AAGGGAGGGAGGAAGGAAGAGGG + Intergenic
1143048323 17:4100911-4100933 AAGTGAAGGAAAAATGCAGAGGG + Intronic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143356668 17:6334815-6334837 GACAGCAGGAAGGAGGAAGAAGG + Intergenic
1143391519 17:6561619-6561641 AAGAGGAGGAAGAGGGAAGGAGG - Intergenic
1143395411 17:6591012-6591034 AGAAGAAGGAAGAAGGAAGAAGG + Intronic
1143794683 17:9327186-9327208 AGAAGAAGGAAGAAGGAAGAAGG + Intronic
1143794701 17:9327260-9327282 AGGAGGAGGAAGGAGGAAGAAGG + Intronic
1143846719 17:9777727-9777749 TATGGAAGGAAGAAGGAAGAAGG + Intronic
1143922739 17:10343651-10343673 AAGAGCAGGAGGAAGAAAAATGG + Intronic
1143937523 17:10502405-10502427 ATGTGCAAAAAGAAAGAAGAGGG - Intronic
1143953547 17:10652228-10652250 TGGGGCAGGAAGAAGGAAGGTGG - Intronic
1144038951 17:11391429-11391451 AAGTGTAACAAGGAGGAAGAGGG - Intronic
1144255013 17:13458950-13458972 GAATGGAGGAAGAAGAAAGAAGG - Intergenic
1144655002 17:17029663-17029685 AAGAGGAGGAAGGAGGTAGAGGG + Intergenic
1144755561 17:17678699-17678721 ATATGCAGGCAGATGGAAGAGGG - Intergenic
1145398884 17:22515553-22515575 AAGAGGAGAAAGAAGGAAGAAGG + Intergenic
1145763284 17:27440334-27440356 AAGAAAAGAAAGAAGGAAGAAGG - Intergenic
1145839609 17:27983549-27983571 CAGTTCAGGAAGAAAGAAGCAGG + Intergenic
1145931779 17:28691172-28691194 AAGTACACAAAGAAGGAAGACGG + Intronic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146329064 17:31912465-31912487 AAGTGCAGGAAAAAGGAACACGG + Intergenic
1146581890 17:34045754-34045776 AAGGGCAGGAAGAAGAAAACTGG + Intronic
1146938243 17:36825878-36825900 GAGAGCTGGAGGAAGGAAGAGGG + Intergenic
1147140689 17:38459026-38459048 AAGTGTGGGAAGAAGACAGAAGG + Intronic
1147318244 17:39631337-39631359 AGGTCCAAGAAGAGGGAAGAAGG + Intronic
1147498812 17:40942527-40942549 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147498863 17:40942820-40942842 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147606316 17:41775739-41775761 AAGGACAGGAAGAAGGAAGACGG + Intronic
1148001379 17:44389470-44389492 AGGTTGTGGAAGAAGGAAGATGG - Exonic
1148203336 17:45764303-45764325 AAAGGAAGGAAGAGGGAAGAGGG + Intergenic
1148401565 17:47366914-47366936 AAGAGCAGGTAAAAGCAAGATGG + Intronic
1148459883 17:47833383-47833405 AAGTACAGGGGAAAGGAAGAAGG - Intronic
1148718500 17:49733128-49733150 AGGTGCTGGAGGGAGGAAGAAGG - Intronic
1148814083 17:50314191-50314213 AAGGAAGGGAAGAAGGAAGAGGG + Intergenic
1149054397 17:52345599-52345621 AAAGAAAGGAAGAAGGAAGAGGG - Intergenic
1149114161 17:53071707-53071729 TAAGGAAGGAAGAAGGAAGAAGG + Intergenic
1149600270 17:57888928-57888950 CAGGGGAGGAAGAAAGAAGATGG + Intronic
1149797902 17:59538387-59538409 AGGAAGAGGAAGAAGGAAGAAGG - Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1149869985 17:60172352-60172374 AAGTGGAGGAGGAAGAAAAAAGG - Intergenic
1150146482 17:62773764-62773786 AAGATTAGGGAGAAGGAAGACGG + Intronic
1150594871 17:66595131-66595153 AATTGGAGGAACAGGGAAGAGGG - Intronic
1150919593 17:69469254-69469276 AAGTGGAAGAGGAAGGTAGAGGG - Intronic
1151158799 17:72147232-72147254 GAAGGAAGGAAGAAGGAAGAAGG + Intergenic
1151353460 17:73545128-73545150 AAGTGGAGGCTCAAGGAAGAAGG + Intronic
1151887525 17:76932007-76932029 AGGAGGAGGAAGAAGAAAGAAGG - Intronic
1152053888 17:78006561-78006583 AGAAGAAGGAAGAAGGAAGAAGG - Intronic
1152053891 17:78006585-78006607 AGAAGGAGGAAGAAGGAAGAAGG - Intronic
1152116117 17:78388398-78388420 AAGTGCAGAAAGAAAGAAACAGG - Intronic
1152164402 17:78692933-78692955 AAGTGAAGGAAGGAGGAAGCAGG + Intronic
1152318234 17:79593243-79593265 AAGAGCTGGGAGAAGGAGGAAGG - Intergenic
1152362253 17:79838095-79838117 AAGGGCAGGAAGAAAGGGGAGGG + Intronic
1152752280 17:82068467-82068489 AAATGCAGCAAAAAGGAAGAGGG + Intergenic
1153343748 18:4004374-4004396 GAGAGCAGGAGGAAGGCAGAGGG - Intronic
1153736142 18:8069836-8069858 AAGTGCGAGAAGAAGTAAGCTGG + Exonic
1153993347 18:10419172-10419194 AAGTGAGGCAAGAAGGAAAAGGG - Intergenic
1154332239 18:13439716-13439738 GGGTGCAGGAAGAGGGAGGAAGG + Intronic
1155019429 18:21881472-21881494 AAGTTCAGGTAGAAGTAGGAAGG + Intergenic
1155362185 18:25014732-25014754 AAGAGCAGGAAGAGAGAAAACGG - Intergenic
1155442010 18:25871880-25871902 AAGAGAAGGAAGAAGGAAGCGGG + Intergenic
1155693009 18:28650135-28650157 AGGGGCAGGAAGAAGTCAGAGGG - Intergenic
1155989549 18:32265769-32265791 AAACTCAGGAAGAAGGAACAGGG - Intronic
1156042385 18:32837047-32837069 AAGGGAAGGAAGAAAGAACAGGG - Intergenic
1156280740 18:35635122-35635144 CAATGCAGGAAGAAGGTAAATGG + Intronic
1156449027 18:37256127-37256149 TAGCTCTGGAAGAAGGAAGACGG - Intronic
1156983021 18:43314542-43314564 AAGGGAAGGATGAAGGAAGATGG + Intergenic
1156992031 18:43420462-43420484 AAGATCAGGAAGAAAGCAGAGGG - Intergenic
1157289231 18:46398310-46398332 CAGGGCAGGAAGAAGGAAGCAGG + Intronic
1157451985 18:47795702-47795724 ATGTGCAGGAAGTACGATGAGGG + Intergenic
1157544010 18:48535262-48535284 CAGTGCAGAAGGAAGGAAGTTGG - Intergenic
1157577657 18:48754471-48754493 TTGTGCAGGAAGAAGGAAAAGGG + Intronic
1157583177 18:48785106-48785128 AAGAGAAGGAAGAAGGAAGATGG - Intronic
1157658432 18:49416714-49416736 AAGTGCAGGAAGAAAAACTAGGG - Intronic
1157895304 18:51460886-51460908 AAGTTCATGAAGGAGGCAGAAGG - Intergenic
1158249132 18:55467265-55467287 AAGTTCAAGGAGAGGGAAGATGG - Intronic
1158310108 18:56149023-56149045 AAGAGGAAGAAGAAGGAAGAGGG + Intergenic
1158444415 18:57506777-57506799 TATTCCAGAAAGAAGGAAGAGGG - Intergenic
1158641832 18:59210371-59210393 CAAGGCAGGAAGAAGGTAGAAGG + Intergenic
1158671094 18:59474516-59474538 AAGTGAAGGGAGAAGGCTGAGGG + Intronic
1158696346 18:59707464-59707486 CATTGCAGGAAGAAGCAAGAAGG - Intergenic
1158750064 18:60248258-60248280 ATGAGCCAGAAGAAGGAAGAAGG - Intergenic
1158767188 18:60466419-60466441 AAATGATGGAAGATGGAAGATGG - Intergenic
1160222507 18:76987540-76987562 AAGAACAGGAAGAAAGAACAGGG - Intronic
1160281407 18:77494166-77494188 AAGTGAGTGAAGAAGGATGATGG + Intergenic
1160384718 18:78488207-78488229 AGGGGCAGGAGGAAGGAAGCTGG - Intergenic
1160817871 19:1044587-1044609 AGATGCAGGATGAAGGAAGAAGG + Exonic
1160832078 19:1108778-1108800 AAGGACAGGAAGAAGCAAGTGGG - Exonic
1160965609 19:1745856-1745878 GGGAGCAGGGAGAAGGAAGAAGG + Intergenic
1161934344 19:7362304-7362326 AGGAGGAAGAAGAAGGAAGAAGG + Intronic
1162176792 19:8836367-8836389 AAGGGGAGGAGTAAGGAAGAAGG - Intronic
1162205648 19:9054313-9054335 AGGAGGAGAAAGAAGGAAGAGGG - Intergenic
1162300478 19:9842177-9842199 AAGTGGAAGAAGAAGTGAGAGGG + Intronic
1162543109 19:11310223-11310245 AAGTGCAGGAAGAAGGAAGAAGG + Intronic
1162543165 19:11310532-11310554 AAGTGCAGGAAGGAGAGAGGAGG + Intronic
1163044726 19:14631870-14631892 AAGTGGAAGTAGCAGGAAGAGGG + Intronic
1163113042 19:15173001-15173023 AAGAGGAAGAAGAAGGAAGAGGG - Intronic
1163200933 19:15768583-15768605 AAAGGGAGAAAGAAGGAAGAGGG - Intergenic
1163207205 19:15812475-15812497 GACTGCAGGAGGAAGGAAGGAGG + Intergenic
1163211697 19:15845594-15845616 AAGAAGAGGGAGAAGGAAGAAGG + Intergenic
1163235651 19:16029028-16029050 AGGAGGAGGAAGAAGGAAGAAGG + Intergenic
1163340075 19:16700137-16700159 AAGGGCTGGAAGAGGGAAGTGGG - Intergenic
1163442744 19:17329830-17329852 AACTGCAGGAAGGAGGCAGGCGG + Exonic
1163784938 19:19270152-19270174 AGGTGCAGGAGGCAGGGAGAGGG - Exonic
1164292718 19:23881941-23881963 AAGAGGAGGAAGAAAGGAGAAGG + Intergenic
1164292724 19:23881975-23881997 AAGAGGAGGAAGAAAGGAGAAGG + Intergenic
1164491702 19:28720703-28720725 AAGTGGAGGGAGATGGAATAGGG - Intergenic
1164574705 19:29398967-29398989 AAGGAAAGGAAGAAGAAAGAAGG + Intergenic
1164649906 19:29884233-29884255 AAGGAAAGGAAGAAGGAAGAAGG - Intergenic
1164771941 19:30816247-30816269 AAGGGAAGAAAGAAGGAAGGAGG - Intergenic
1164850472 19:31478947-31478969 AAGTGCAAGAAGAAAGCAAAAGG - Intergenic
1164932939 19:32189136-32189158 GAAGGAAGGAAGAAGGAAGAAGG + Intergenic
1164962531 19:32446304-32446326 GAAGGCAGGAAGAAGGAAGCAGG + Intronic
1165031302 19:32999784-32999806 AACTGCAGAAAAAAGGAAGCTGG - Intronic
1165322645 19:35095813-35095835 AAAGAAAGGAAGAAGGAAGAAGG + Intergenic
1165482528 19:36073173-36073195 AAGCAGAGGAAGAGGGAAGAGGG + Intronic
1166549498 19:43655865-43655887 AGTTCCAGGAAGGAGGAAGAAGG - Intronic
1166881591 19:45933650-45933672 AGGTGCAGGGAGGAGGGAGAGGG + Intergenic
1167627620 19:50603156-50603178 AAGAAGAGGAAGGAGGAAGATGG - Intergenic
1167684578 19:50948797-50948819 AAGTGGAGAAAGATGGAAGGCGG + Intronic
1168143884 19:54408460-54408482 CAATGAAGGAAGAAGGAAGGAGG + Intergenic
1168152450 19:54456304-54456326 CACTGCAGGAAGAAGCAGGAGGG - Exonic
1168294264 19:55370879-55370901 AGGTGGAGGCAGGAGGAAGAGGG + Intergenic
925656222 2:6152406-6152428 AAGTGCAGAGAGAAGAAAGACGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925912409 2:8582439-8582461 AACTGCAGGAGAAAGGAGGAGGG + Intergenic
926244580 2:11113515-11113537 GAGGGAAGGAAGAAGGAAGAAGG - Intergenic
926339877 2:11896133-11896155 TGGTGTAGGAAGAAGGAGGATGG + Intergenic
926497170 2:13604976-13604998 AAGGGAAGGGAGAAGAAAGAAGG - Intergenic
926618351 2:15021949-15021971 AATTGTAGGCAGAAGGCAGAAGG + Intergenic
926772316 2:16389404-16389426 AAGAGGAGGAGGAAGGAAAAGGG - Intergenic
926903045 2:17777456-17777478 TAATACAGGCAGAAGGAAGATGG + Intronic
927126485 2:20016476-20016498 CATTCCAGGATGAAGGAAGAGGG + Intergenic
927186358 2:20485294-20485316 CAGCCCAGGTAGAAGGAAGATGG - Intergenic
927233877 2:20852053-20852075 AATTGAAGAAAGAAAGAAGAGGG - Intergenic
927683428 2:25154947-25154969 AAGGGCAGGAAGCAGGATGCAGG + Exonic
927768444 2:25835555-25835577 CAGTGCAGGAAAATGAAAGAAGG + Intronic
928891597 2:36210272-36210294 AAGAACAGGAAGAAGAAACAAGG - Intergenic
928921675 2:36534142-36534164 GAGGGCAGGAAGGGGGAAGAAGG + Intronic
929049729 2:37825927-37825949 AAGAACAGGAAGCAGGAACAGGG - Intergenic
929052402 2:37849211-37849233 AAGTGGGGGAAGAAGGAGAAGGG - Intergenic
929219801 2:39451452-39451474 AAATGTTGGAAGAAGGAAGAAGG + Intergenic
929362151 2:41104531-41104553 AAGGGAAGGAAGAAGGAGAAGGG + Intergenic
929448968 2:42023987-42024009 GAGGGAGGGAAGAAGGAAGATGG + Intergenic
929564887 2:42978137-42978159 GAGAGTGGGAAGAAGGAAGAGGG + Intergenic
929599591 2:43196866-43196888 ACATGCAGGAAGAAGGAAAATGG - Intergenic
929623859 2:43386158-43386180 AAGTGGAGGATGAAGCAGGAAGG + Intronic
929672129 2:43884480-43884502 AAGGGCAGGAAGACTGAAGCTGG + Intergenic
929762443 2:44817157-44817179 GCGTGCTGGAAGAAGGGAGAAGG + Intergenic
929833287 2:45368597-45368619 AATTAGAGAAAGAAGGAAGAAGG + Intergenic
929846071 2:45529298-45529320 AAATGTAGTCAGAAGGAAGATGG + Intronic
930224100 2:48774656-48774678 AAGGAAAGGAAGAAGAAAGAAGG - Intronic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
930522590 2:52486235-52486257 AAGTAGAGGAATAAGGATGACGG - Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930936634 2:56960616-56960638 GAGTGCATGAGGAAGGAGGAAGG + Intergenic
930978051 2:57488637-57488659 AAGTGGAGGAAGGTGGAAGGGGG - Intergenic
931051574 2:58421135-58421157 GATGGAAGGAAGAAGGAAGAAGG + Intergenic
931090459 2:58880549-58880571 CAGGGAAGGAGGAAGGAAGAAGG + Intergenic
931091895 2:58895259-58895281 AAGTGAAGGGAGAAGACAGAAGG + Intergenic
931105878 2:59055058-59055080 AAATGAAGGAAGAAGGAAGAAGG - Intergenic
931184784 2:59939533-59939555 AAGTGCAGGGAGAAAGTATAAGG + Intergenic
931223306 2:60307808-60307830 AAGAGAAGGAAGAAGAGAGAAGG + Intergenic
931308713 2:61057888-61057910 AAGTGCAGGGAGAAGAGAGGGGG - Intergenic
931482513 2:62656132-62656154 GAAGGAAGGAAGAAGGAAGAAGG - Intergenic
931590131 2:63873984-63874006 AACAGCAGGAAGAAGGAAGATGG + Intronic
931853787 2:66280601-66280623 AAGTGATGGTAAAAGGAAGATGG - Intergenic
932285005 2:70524689-70524711 GAGTCCAGGAGGGAGGAAGAAGG + Intronic
932397643 2:71459094-71459116 ATGTGAAGGGAGAGGGAAGAAGG + Intronic
932486823 2:72089233-72089255 AAGAGAGGGAGGAAGGAAGATGG + Intergenic
932539411 2:72636425-72636447 AAGAGGAGGGAGGAGGAAGAAGG + Intronic
932549330 2:72751711-72751733 AAATGCAGAAAGACGAAAGACGG + Intronic
932549821 2:72756806-72756828 AAATGAAGGAAAAAGGATGAGGG + Intronic
932688786 2:73895025-73895047 CCGTGCAGGTAGAAGTAAGAAGG + Intronic
932734271 2:74243347-74243369 CAGTTCAGGAAGAAGAGAGAGGG - Intronic
933364244 2:81328636-81328658 AAATGGAGGAAGAGGGAACAGGG - Intergenic
933569725 2:83995427-83995449 AAGGAAAGGAAAAAGGAAGAAGG - Intergenic
933813401 2:86047523-86047545 AAGAGCAGCAAAAAGGGAGAAGG + Intronic
934297235 2:91752403-91752425 AACAGCAGGAAGGAGGACGAGGG + Intergenic
934764522 2:96873218-96873240 AAGTGCATGAAGGTGGAAAAGGG - Intergenic
934937438 2:98475723-98475745 AAAAGCAGGTAGAAGGGAGAGGG - Intronic
934979594 2:98829087-98829109 AAGTGCAGTAAGAATGATCACGG + Intronic
935171456 2:100613886-100613908 AAAGGAAGGAAGAAGGAAGAAGG - Intergenic
935338899 2:102042327-102042349 AAAGGAAGGAAAAAGGAAGAAGG + Intergenic
935383381 2:102476729-102476751 AGGAGGAGGAAAAAGGAAGAAGG + Intronic
935749576 2:106219420-106219442 AGGAGCAGAAAGAAGGAAGAGGG + Intergenic
935938261 2:108209825-108209847 AGTGCCAGGAAGAAGGAAGAAGG - Intergenic
936121722 2:109751897-109751919 AGGAGCAGAAAGAAGGAAGAGGG - Intergenic
936222973 2:110619575-110619597 AGGAGCAGAAAGAAGGAAGAGGG + Intergenic
936388367 2:112050873-112050895 AGGAGGAGGAGGAAGGAAGAAGG - Intergenic
936419204 2:112347327-112347349 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
936480501 2:112880613-112880635 AAGTGCAGGAATATGGAAGCAGG + Intergenic
936616928 2:114057332-114057354 AAGGGAAGAAGGAAGGAAGAAGG - Intergenic
936731308 2:115384621-115384643 AAGAAGAGGAAGAAGAAAGAAGG + Intronic
936751442 2:115647113-115647135 ATGGACAGAAAGAAGGAAGATGG + Intronic
937129430 2:119496568-119496590 AAGTGGAAGAAGAAGACAGATGG + Intronic
937139997 2:119591726-119591748 AAGGCCAGGAAGAAGTCAGATGG + Intronic
937615835 2:123921358-123921380 AAGGAAAGAAAGAAGGAAGAAGG + Intergenic
937616160 2:123924262-123924284 GAATACAGGAAGAAGAAAGAAGG - Intergenic
937822753 2:126329387-126329409 AAGGGCAGGAAGAATTATGATGG + Intergenic
937995582 2:127691796-127691818 CAGTGCAGGAGGAAGAAACAGGG + Intergenic
938242172 2:129751703-129751725 AAATGAAGGAAGGAGGAAGAGGG + Intergenic
938373229 2:130786967-130786989 AAGGGAAGGAAGGAGAAAGAAGG + Intergenic
939257785 2:139766696-139766718 CAGTGCAGGCAGAAGGAAGTGGG + Intergenic
939902841 2:147870820-147870842 AAGTATATAAAGAAGGAAGAGGG - Intronic
939959615 2:148554747-148554769 AAGTGCCTGAAGAAGTAAGAGGG - Intergenic
940057318 2:149526566-149526588 AGGTACAGGAAGAAGCTAGAAGG + Intergenic
941474873 2:165938711-165938733 AAAGGCAGGAAGAAGGAGGGAGG + Intronic
941735143 2:168965959-168965981 ATGTGCAAGAGCAAGGAAGAGGG - Intronic
942337810 2:174909268-174909290 AAGTGAAGGAAGAAGGTTGGAGG - Intronic
942415568 2:175755445-175755467 AAGTGCAGGAAGTAAGAGGCTGG - Intergenic
942480756 2:176385940-176385962 AAGGGCTGAAGGAAGGAAGAAGG + Intergenic
942504964 2:176632205-176632227 AAGAGCAGGATCTAGGAAGAAGG + Intergenic
942570965 2:177313843-177313865 AAGAGCTGGAAGAAGGCTGAGGG - Intronic
942602826 2:177658547-177658569 AAATACAGGAAGAAAGAAGGAGG - Intronic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
943112919 2:183628537-183628559 AACTGGAGGAAGAAGTCAGAAGG - Intergenic
943393413 2:187300052-187300074 AAGTGCATCAAATAGGAAGAAGG - Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
944058617 2:195548305-195548327 AAGGAAAGGAAGAAGGAAGAGGG + Intergenic
944237382 2:197452912-197452934 ACACGCAGGAAGAAGGCAGACGG + Intergenic
944280996 2:197897197-197897219 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
944405329 2:199377586-199377608 GAGTGCAGGAAGAGGGAAGAAGG + Intronic
944427558 2:199599147-199599169 GGGTGCAGAGAGAAGGAAGAGGG + Intergenic
944891387 2:204120643-204120665 AAGAGAAGCAAGAAGGGAGAAGG - Intergenic
945004640 2:205391227-205391249 AAGGGAAGGAAAGAGGAAGAAGG + Intronic
945814055 2:214582322-214582344 AAGTCCAGGAAGAAGAATGAGGG + Intergenic
946333004 2:219021091-219021113 AAATGCAGGATGAAGGGGGAGGG - Intronic
946482887 2:220073811-220073833 AAGGGGAGGCAGAAGGAAAATGG + Intergenic
946518729 2:220442624-220442646 AAGTCAAGGAAAGAGGAAGAGGG - Intergenic
946528524 2:220546524-220546546 GAAGGAAGGAAGAAGGAAGAAGG - Intergenic
946639408 2:221767284-221767306 AAGTTCGGGAAGAAGGGAGGAGG + Intergenic
946668768 2:222079598-222079620 TAGAGGAGGGAGAAGGAAGAAGG - Intergenic
946752769 2:222909287-222909309 AAGTACAGGAAGAAATTAGAAGG - Intronic
946973679 2:225123336-225123358 AAGAGAAGGAGGAAGAAAGAAGG - Intergenic
947053197 2:226070491-226070513 ATTAGCAGGAAGAAGCAAGAAGG + Intergenic
947102296 2:226634104-226634126 AAGTGCAGCAGGAGGAAAGATGG - Intergenic
947343044 2:229159996-229160018 AGGAACAGGATGAAGGAAGAGGG + Intronic
947462841 2:230318034-230318056 CAGAGCAGGAAGGAGGCAGAGGG + Intergenic
947510993 2:230754311-230754333 AGAAGAAGGAAGAAGGAAGAAGG - Intronic
948091955 2:235302235-235302257 AAGAGGAGGGAGGAGGAAGAGGG - Intergenic
948283248 2:236764847-236764869 AGGTGCAGGAGTAAGGGAGATGG - Intergenic
948360755 2:237418461-237418483 GAAGGCAGGAAGAAGGATGAGGG - Intergenic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
1169045532 20:2531848-2531870 AGAAGAAGGAAGAAGGAAGAAGG + Intergenic
1169275246 20:4229405-4229427 AAATGAAGCAGGAAGGAAGATGG + Intronic
1169359606 20:4936997-4937019 ACATGGAGGAAGAACGAAGAAGG + Intronic
1169549632 20:6688845-6688867 AAATGCGGGCAGAAAGAAGAAGG - Intergenic
1169586027 20:7086240-7086262 AAGGGAAGGAGAAAGGAAGAAGG - Intergenic
1169680435 20:8206253-8206275 AAATGCAGGAAAATGGGAGAAGG - Intronic
1169788780 20:9387600-9387622 AAATGCAGGAAATAGGGAGATGG + Intronic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170444992 20:16417137-16417159 AAGTGCAGGAGAGATGAAGAGGG + Intronic
1170596035 20:17806641-17806663 AGGAGGAGAAAGAAGGAAGAGGG + Intergenic
1171566649 20:26199178-26199200 ATGTGCAGGAACAAGAAATATGG - Intergenic
1171937508 20:31289205-31289227 AAGGGGAGGAAGAAGGCAAAAGG + Intergenic
1172718694 20:36983069-36983091 AAGTGCAGGAAAAAGATAGTAGG + Intergenic
1172905243 20:38364276-38364298 AAGTAGGGGAAGAAGGAGGAGGG - Intronic
1172906103 20:38370711-38370733 AAATGCCAGAAGAAGGAAGCAGG - Intronic
1173001989 20:39111473-39111495 TGGTGCAGGAAAAAGGAGGATGG + Intergenic
1173146016 20:40524949-40524971 ATGTGCATGAAGAAGAAAGCAGG - Intergenic
1173255241 20:41390064-41390086 AAGGGCAGGAGGAAGGTAGGAGG + Intergenic
1173343344 20:42175083-42175105 AAGAACATGGAGAAGGAAGAGGG - Intronic
1173590821 20:44223273-44223295 AAGAGCAGGAACAAGAGAGAGGG - Intergenic
1174150366 20:48482130-48482152 AGGAGGAGGAAGAAGAAAGACGG + Intergenic
1174214652 20:48906963-48906985 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
1174835121 20:53849706-53849728 GAGAGGAGGAAGAAGCAAGAGGG - Intergenic
1174960499 20:55151679-55151701 AGGAGGAGGAAGAAGGAAGGAGG - Intergenic
1174960667 20:55153702-55153724 AGAAGAAGGAAGAAGGAAGAAGG - Intergenic
1175045599 20:56101996-56102018 ATGTGAAGGAAGAAGGAATTAGG + Intergenic
1175153139 20:56951006-56951028 AAGGGGAGAAAGAAAGAAGAAGG + Intergenic
1175243765 20:57568788-57568810 AAGGGCAGGAGGGAGGAAGCAGG - Intergenic
1175293672 20:57894659-57894681 AAGGGAAGGAGGAAGGAAGAAGG + Intergenic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175712172 20:61230203-61230225 AGGTGCAGGCAGGAGGGAGAAGG + Intergenic
1175836259 20:61997002-61997024 AATTACAGGAAGAAAGAAAACGG - Intronic
1176069951 20:63221013-63221035 GAGTGCAGGTACAGGGAAGACGG + Intergenic
1177095133 21:16823259-16823281 AGAAGAAGGAAGAAGGAAGAAGG - Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177163937 21:17579050-17579072 AAGGGAAGGAAAAAGCAAGACGG + Intronic
1177303063 21:19275348-19275370 AAGAGCATAAAGAAAGAAGAAGG + Intergenic
1177521857 21:22237043-22237065 TAGAACAGAAAGAAGGAAGAAGG + Intergenic
1178066565 21:28910491-28910513 AAGTGTAGGAAGAATGTAGGTGG - Intergenic
1178327339 21:31656645-31656667 AAGAGAAAGAAGAAGGAAGGAGG - Intergenic
1178390068 21:32190999-32191021 ATGTGCAGAAAGAAGGAACCAGG + Intergenic
1178612759 21:34099660-34099682 AAGAGCAGAAAGAAGGTAGAGGG - Exonic
1179024855 21:37671430-37671452 ATGAGCAGCCAGAAGGAAGAAGG - Intronic
1179240081 21:39582132-39582154 AAGTGGAGGAGGGAGGCAGAAGG + Intronic
1179349298 21:40592624-40592646 ATGTGAAGGAAGAAGCCAGAAGG - Intronic
1179353541 21:40636394-40636416 AAGAGAGGGAAGAAGGAAGGGGG + Intronic
1180413269 22:12636379-12636401 AAGAGCAGGAGGAAGAGAGAGGG + Intergenic
1181037382 22:20176426-20176448 ATGTGGAGGGAGAAGGAAGAAGG - Intergenic
1181508451 22:23377591-23377613 AAGAGGAGGAGGAAGGGAGAAGG + Intergenic
1182005564 22:26956623-26956645 AAGCCCAGGAAGCAGGAAGAAGG - Intergenic
1182426913 22:30278441-30278463 CAGGGCAGGAAGATGGAAGGTGG + Intergenic
1182738436 22:32547954-32547976 AAGTGCAGACACAAGGCAGAGGG - Intronic
1182754589 22:32668547-32668569 GAGTGGAGGAAGGAGGAGGAAGG - Intronic
1182961434 22:34479075-34479097 GAGTGGAGGAAGGAGGAAGAGGG - Intergenic
1182962433 22:34488273-34488295 AAGGGAAGGAGGAAGGAAGGGGG - Intergenic
1183073283 22:35411118-35411140 AAGTGCAGGATTAAGGCAGAAGG + Intronic
1183226748 22:36555613-36555635 AAGGGCAAGGAGAAGGAAAAGGG - Intergenic
1183279034 22:36922434-36922456 ATGTGCAGGAGGAGGGAAGCGGG - Intronic
1183519571 22:38288932-38288954 GAATGCAGGAAGAAGCATGATGG + Intergenic
1183730893 22:39617804-39617826 AGGAGCAGGAGGAGGGAAGAGGG - Intronic
1184403262 22:44286111-44286133 ACCTGCAGGAAGGAGGGAGAGGG - Intronic
1184418981 22:44368727-44368749 ATCAGCAGGAAGAAGGGAGATGG - Intergenic
1184451848 22:44587143-44587165 AAGAGAAGGGAGAAGGAAGGGGG + Intergenic
1184606968 22:45579805-45579827 AAGAGGAGGGAGAAGGAAGTAGG - Intronic
1184702441 22:46185095-46185117 AAGAGCAGGAAGCAAGAACATGG - Intronic
1184733020 22:46381378-46381400 AATGGCAGGAAGAAGGAGGGCGG + Intronic
1184854971 22:47141742-47141764 AAAGGTGGGAAGAAGGAAGAAGG + Intronic
1185002494 22:48254413-48254435 ATATGCACAAAGAAGGAAGAGGG + Intergenic
1185418660 22:50723071-50723093 AAGTGCAGTAAGAAGATAGATGG + Intergenic
949351709 3:3129939-3129961 AACTGAAGGAAGAAGGAAATAGG + Intronic
949562949 3:5219577-5219599 CCTTGCAGAAAGAAGGAAGAGGG - Exonic
949606240 3:5657455-5657477 AAGTCAGGGAAGAAGGAAGAAGG - Intergenic
949709677 3:6860192-6860214 GATGGCAGGAAGAAGAAAGAGGG - Intronic
949828791 3:8191614-8191636 AAGAGGAAGAAGAAAGAAGAAGG - Intergenic
950235807 3:11319383-11319405 AAGTGCTGGTAGGAGGAGGAGGG - Intronic
950360871 3:12448568-12448590 AAGGGAAGGAAGGAAGAAGAAGG + Intergenic
950360915 3:12448760-12448782 AAGGGAAGGAAGGAAGAAGAAGG + Intergenic
950750785 3:15126470-15126492 ATGTGCAGGTGGAACGAAGAGGG + Intergenic
950753909 3:15156071-15156093 AAGGGAAGGAGGCAGGAAGAAGG + Intergenic
950840527 3:15964180-15964202 ACTAGCAGGAAGGAGGAAGATGG - Intergenic
951099366 3:18668848-18668870 AAGTGGAAGAGGAAGGCAGAAGG - Intergenic
951661106 3:25067734-25067756 AAGTGCAGGAAGCAAAAAGAAGG - Intergenic
951964997 3:28372058-28372080 AAATGAAGAAAGGAGGAAGAAGG - Intronic
952018245 3:28985470-28985492 AAGTGCAGGAATCAGTAATAGGG + Intergenic
952039854 3:29249000-29249022 AAGGGCAGGAAGAAGAGAGCAGG - Intergenic
952067376 3:29587292-29587314 GAGATCAGGAGGAAGGAAGAAGG + Intronic
952097847 3:29976296-29976318 AAGTACTTAAAGAAGGAAGAAGG - Intronic
952347365 3:32501328-32501350 AAGAGAAGGAAGAAGGAAGAAGG + Intronic
953098867 3:39806711-39806733 AAGGGAGGGAGGAAGGAAGAAGG + Intergenic
953512498 3:43556887-43556909 AACTGAAGGAAGAAAGAAAATGG + Intronic
953685415 3:45074417-45074439 AAGTGGTGGAAGTAGGAAGAAGG + Intergenic
953904755 3:46862947-46862969 AAGTCCAGGAAGAAGGGCAAGGG + Intronic
953935239 3:47036139-47036161 AATAGGTGGAAGAAGGAAGAGGG - Intronic
953984190 3:47428707-47428729 GAGCACAGGAAGAAGAAAGACGG + Intronic
954287781 3:49631012-49631034 AAGGACAGGAAGAAGGGAGAGGG - Intronic
954330447 3:49887201-49887223 AAGGGCAGGAACAAGGTGGAGGG + Exonic
954635417 3:52068400-52068422 AAAGGCAGGAGGAAGGGAGAGGG + Intergenic
954772448 3:52984036-52984058 ATGTGGAGGAAGATGTAAGATGG + Intronic
954813462 3:53262390-53262412 AGGAGGAGGAAGAGGGAAGAGGG - Intergenic
955307435 3:57848410-57848432 AAAAGAAGGAAGAAGAAAGAAGG - Intronic
955307477 3:57848682-57848704 AGGAGGAGGAAGAAAGAAGAAGG - Intronic
955603441 3:60672774-60672796 AAGGCAAGAAAGAAGGAAGAAGG - Intronic
955661544 3:61304731-61304753 AAGGGCTGGAGGAAGAAAGAGGG + Intergenic
956996328 3:74830134-74830156 ATGAGCAGTAAGAAGAAAGATGG - Intergenic
957017935 3:75091618-75091640 AAATGGAGGAAGATGGAGGAAGG - Intergenic
957070663 3:75565342-75565364 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
957111438 3:75964304-75964326 ATGTGCAGGAACAAGAAATATGG + Intronic
957111966 3:75973492-75973514 AAGTGATGGAAGGAGCAAGAGGG + Intronic
957274103 3:78068170-78068192 AAGAGAAGGCAGAAGGCAGAAGG + Intergenic
957369308 3:79271549-79271571 AAGAGCAGGAAGAAAGCATATGG - Intronic
957416910 3:79917361-79917383 AAGGGAAGAAAGAAGGAAAAAGG + Intergenic
957425575 3:80034991-80035013 AAGTGCAGAGTGAAGGGAGAAGG + Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
958455478 3:94325913-94325935 CAAGGCAGGAAGAAGGAGGAAGG + Intergenic
958475814 3:94580243-94580265 AAGTGCAGATAGAAAGAAAAGGG - Intergenic
958656935 3:97014426-97014448 AAGGAAAGGAAGAAGGAAGGTGG - Intronic
959044493 3:101457636-101457658 AACTGCTCGTAGAAGGAAGAAGG - Intronic
959098220 3:101980528-101980550 AAGGACAGAAAGAATGAAGAAGG - Intergenic
959254927 3:103997296-103997318 CAGTGCAGAGAGAAGGCAGAAGG + Intergenic
959359743 3:105373614-105373636 AAGTACAGGGAAAAGGAAAAGGG - Intronic
959560323 3:107772341-107772363 AAGACCTGGAAGAAGGAGGAAGG - Intronic
959630689 3:108504140-108504162 TAGTGCAGGAGGAAAGAAGGGGG + Intronic
959635251 3:108559616-108559638 AATTTCAGGAAGAAGGAAGGAGG + Intronic
959749233 3:109813469-109813491 ATTTGCAGGAAGAAGAAATAAGG + Intergenic
960165456 3:114396371-114396393 AAGTGATGGGAGCAGGAAGAGGG - Intronic
960418016 3:117409164-117409186 GAAAGAAGGAAGAAGGAAGAAGG - Intergenic
960662915 3:120080325-120080347 AGACGAAGGAAGAAGGAAGAAGG + Intronic
961262408 3:125612966-125612988 AAGGGCAAGAACAATGAAGAGGG - Intergenic
961283433 3:125781225-125781247 ATGTGCAGGTGGAACGAAGAGGG + Intergenic
961430083 3:126875212-126875234 CAGAGCAGGAAGAGGGAAGAAGG + Intronic
961440707 3:126951554-126951576 AAGACCAGAGAGAAGGAAGAGGG + Intronic
961523786 3:127483824-127483846 AAGAGGAGGGAGGAGGAAGAGGG + Intergenic
961625950 3:128263912-128263934 AAGTGAAAGAAGAAGAAACAAGG - Intronic
961908255 3:130285334-130285356 AAGTGCAGAAAGGAGGAATCAGG - Intergenic
962250468 3:133833111-133833133 AGGAGCAGGAACAAGGGAGAGGG - Intronic
962415795 3:135180581-135180603 CAGTGCAGGAAGATGGATGAGGG - Intronic
962653401 3:137518280-137518302 AGAAGCAGGAAGAAAGAAGAAGG - Intergenic
962748618 3:138416691-138416713 AAGTGAAAGAAAAAGGAGGAGGG - Intergenic
963035902 3:141028615-141028637 ATGTGTAGCAAGAAGGGAGATGG + Intergenic
963248171 3:143082119-143082141 AGGAGAGGGAAGAAGGAAGAAGG - Intergenic
963794368 3:149616900-149616922 AAGTGGAAGAAAAAGTAAGAAGG + Intronic
963796480 3:149635627-149635649 GAAAGGAGGAAGAAGGAAGAAGG + Intronic
963833655 3:150034824-150034846 AACTGCGGGAAGAAGGTACAGGG + Intronic
963843614 3:150132755-150132777 CTGTGCAGGAAGAGGGAAGGGGG + Intergenic
964385113 3:156138962-156138984 GAGTGCAGGAAAAAGCAACAAGG - Intronic
964560997 3:157996520-157996542 AAGTGGAAGCAGAAGGCAGAAGG + Intergenic
964821397 3:160774236-160774258 ACTTGCATGAAGAAGGAAGAAGG - Intronic
964931565 3:162031125-162031147 AAGTGCAGAATGAAGGATGTGGG + Intergenic
964949413 3:162269753-162269775 AAATGAAGGTAGGAGGAAGAGGG + Intergenic
965211592 3:165797149-165797171 AAGGGAGGGAAGAAGGAAGGAGG - Intronic
965282781 3:166775201-166775223 AAAGGAAGGAAGAAGGAAGGAGG + Intergenic
966598028 3:181745000-181745022 AAGGGCAGAAGGAAGGAAGGAGG - Intergenic
967391185 3:188956396-188956418 AAGTGGGGGATGAAGAAAGAGGG - Intronic
967442981 3:189530566-189530588 AAAAGAAGGAAGAAGGAAGCGGG - Intergenic
967934405 3:194715377-194715399 GAGTGAAGGAAGGAGGAGGAAGG - Intergenic
968126380 3:196163584-196163606 AAGGACGGGTAGAAGGAAGAGGG - Intergenic
968451618 4:678667-678689 AAGACCAAGAAGAAGGAAGGGGG + Exonic
968836871 4:2971576-2971598 AATAGCAGGAAGAAGAAAGCGGG + Intronic
968914402 4:3490996-3491018 ATGAGCAGGAAGAAGAAGGAAGG - Intronic
968925951 4:3548511-3548533 AAGTGCAGGAAGAAGTGTTATGG + Intergenic
969014279 4:4093008-4093030 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
969055769 4:4401718-4401740 GATTCCAGTAAGAAGGAAGAAGG + Intronic
969080977 4:4617802-4617824 AAGAGGAGGAAGAAGGAGGTAGG - Intergenic
969171641 4:5368718-5368740 AACTGCAGGAAGGTGGAAGATGG - Intronic
969474078 4:7411376-7411398 AAGGGAAGGAAAAAGGCAGAAGG - Intronic
969739691 4:9015404-9015426 ATGTGCAGGTGGAACGAAGAGGG + Intergenic
970274658 4:14385495-14385517 AAGTGGAAGAAGAAGACAGAAGG + Intergenic
970418816 4:15885341-15885363 GAGGGCAGGAAGGAAGAAGATGG - Intergenic
970573358 4:17404285-17404307 AAGGGAAGGAAGAAGGAGAAAGG + Intergenic
970673603 4:18423012-18423034 AAGTGGGGGAAGATGGAAAATGG - Intergenic
970738715 4:19206401-19206423 AAAAGTAGGAATAAGGAAGATGG - Intergenic
970828987 4:20313316-20313338 AAGAGCAGGAGGAAGAGAGAGGG + Intronic
971112356 4:23602552-23602574 AAGGAAAGGAAGAAGGAAGAAGG + Intergenic
971156462 4:24088366-24088388 AAAAGAAAGAAGAAGGAAGAAGG + Intergenic
971178205 4:24302125-24302147 AAATGAACCAAGAAGGAAGATGG - Intergenic
971189609 4:24414817-24414839 CATTCCAGCAAGAAGGAAGAAGG - Intergenic
971196989 4:24479180-24479202 AGAAGAAGGAAGAAGGAAGAAGG + Intergenic
971266329 4:25099153-25099175 AAGAGGAGAAAGAAGGAAAAGGG + Intergenic
971615650 4:28787922-28787944 GAGTACAGGAAGCAGGGAGAGGG + Intergenic
971734245 4:30425641-30425663 AAGGACAGGAGGAAGGAAGAAGG + Intergenic
971912694 4:32814855-32814877 AAGTGGAGAAAGAAAAAAGAGGG + Intergenic
972627859 4:40818789-40818811 TAGAGCAGGAAGGAGGGAGAAGG - Intronic
972765667 4:42151225-42151247 AAATGGAGGAAGAAGGAGAAAGG + Intronic
972840060 4:42920208-42920230 AGGTGAAGGATGAAGGAAGAGGG + Intronic
973064874 4:45776853-45776875 AAGAACAAAAAGAAGGAAGAAGG - Intergenic
973157669 4:46977225-46977247 GAGGGAAGGAGGAAGGAAGAAGG + Intronic
973205858 4:47559552-47559574 AAGTTTAGCAAGAAAGAAGATGG + Intronic
973778452 4:54265641-54265663 TATTGCAGGAAGAAGGGAGGAGG + Intronic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974522171 4:62995971-62995993 AAGGGAGGGAGGAAGGAAGAAGG + Intergenic
974949534 4:68571287-68571309 ATGGGCAGTAAGAAGAAAGAAGG + Intronic
974988259 4:69056097-69056119 ATGGGCAGTAAGAAGAAAGAAGG - Intronic
975340292 4:73232229-73232251 AAGAGCTAGAAGAAGGAAGGTGG - Intronic
975504451 4:75122856-75122878 AAGAGGAGGAGGAAGGAGGAAGG + Intergenic
975780553 4:77834968-77834990 TAGTGCAGGAAGTAAGAAGAGGG + Intergenic
975878352 4:78870351-78870373 AAGTGCTAGATGAAGGAATAAGG + Intronic
976757435 4:88513447-88513469 AAGAACAGGAAGAAGGAAAAGGG - Intergenic
977353874 4:95920886-95920908 AATTTCAGGAAGAAGTAATAGGG - Intergenic
977357215 4:95962054-95962076 GAGGGCAGGAAGAAGGTAGAAGG + Intergenic
977377434 4:96223753-96223775 ATGTGCAGAAAGTAAGAAGAGGG - Intergenic
977421092 4:96800748-96800770 AAGAACAGGAGGAAGAAAGAGGG - Intergenic
977775367 4:100913398-100913420 AAAAGCAGCCAGAAGGAAGAGGG - Intergenic
978560676 4:110030423-110030445 AAGGGCAGGCTGAAAGAAGAAGG - Intergenic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
978719092 4:111884964-111884986 AAGAGAAGAGAGAAGGAAGAAGG - Intergenic
978833938 4:113124651-113124673 AAGTAAAGGAACATGGAAGAAGG - Intronic
978834965 4:113137645-113137667 AAAGGAAGGAAGAAGGAAGAAGG - Intronic
978919607 4:114167068-114167090 AAGTGCTGGAACAAAAAAGAGGG - Intergenic
979263812 4:118678474-118678496 AGGAGGAGGAAGAAGAAAGAAGG + Intergenic
979480758 4:121214228-121214250 AAGTGCAGAAGGAAGGATGAGGG - Intronic
979926067 4:126566211-126566233 AAGAGCGGGAAGAGAGAAGAGGG + Intergenic
980159914 4:129148272-129148294 AAAGGGAGGAAGAAGGAAGTGGG + Intergenic
980281208 4:130722651-130722673 TAGTGCAGGTGGAGGGAAGAGGG - Intergenic
980400454 4:132277327-132277349 AAGGGAAGAAGGAAGGAAGAAGG - Intergenic
980533693 4:134087790-134087812 AAGGCCAGGAGGAAGGAAGAAGG - Intergenic
980563606 4:134508706-134508728 AAGTTCAGGAAGCTGGAGGAAGG - Intergenic
980841057 4:138261880-138261902 AAGAGGAAGAAGAAGGAAAAAGG - Intergenic
981038444 4:140196149-140196171 ACTTGTAGGAAGAAGTAAGAGGG - Intergenic
981132178 4:141169235-141169257 CAGAGCAGGAAGAAGAAAAAAGG - Intronic
981372232 4:143971705-143971727 AAGAGTAGGAAGAAGACAGATGG + Intergenic
981477816 4:145206254-145206276 AAGTACAGGAGGAAACAAGAAGG - Intergenic
981527519 4:145721044-145721066 AACTACAGGAAGAAAAAAGATGG + Intronic
981562288 4:146061255-146061277 AAAGGAAGGAAGAAGGAGGAAGG - Intergenic
981595125 4:146411878-146411900 AAGTGCAGATGAAAGGAAGAAGG + Intronic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982117232 4:152107759-152107781 AGGGGCAGGGAGATGGAAGAAGG + Intergenic
982406708 4:155028714-155028736 AAGAAGAGGAAAAAGGAAGATGG - Intergenic
982567834 4:157009056-157009078 GAGAGCAGGAAGAAGGATGAGGG + Intergenic
982786098 4:159538525-159538547 AAGTCAAGGAAGAAGGCACAGGG + Intergenic
982999245 4:162391050-162391072 AAATGAAGGAAGGAAGAAGAGGG + Intergenic
983445994 4:167852988-167853010 AAGTCCAGCAAGAAAGAAGGTGG - Intergenic
983489477 4:168371877-168371899 AAGTGAAGGAGGCAGGCAGAGGG + Intronic
983552567 4:169032466-169032488 AGGAAAAGGAAGAAGGAAGAGGG - Intergenic
983707196 4:170676080-170676102 AAGTGGAGGGGGAAGGAATAAGG - Intergenic
984459284 4:180012525-180012547 ATGAGCAGGAAGAAGGAGAAAGG - Intergenic
984612350 4:181855929-181855951 GAGGGAAGGAAGAAGAAAGAAGG + Intergenic
984710447 4:182879973-182879995 AAGTGCTGGAAATAGGAAGGAGG + Intergenic
984760074 4:183356342-183356364 AAGGGAAGGAAGAAAGAAAAAGG - Intergenic
985198933 4:187463514-187463536 AAGTGGAGGATGGAGGAAGTGGG + Intergenic
985388376 4:189468491-189468513 AAAGGCACGAAGAAGGGAGAAGG - Intergenic
985720318 5:1485439-1485461 GAATGCAGGAACAAGGCAGAGGG + Intronic
985911174 5:2884460-2884482 AAGTACAGGAAGATGTAAAAGGG + Intergenic
985993780 5:3584935-3584957 AAGGACAGGAGGAAGGAAGGAGG + Intergenic
986053593 5:4113486-4113508 CAGTGCTGGATCAAGGAAGAGGG + Intergenic
986060687 5:4187528-4187550 ATGTGCAGGGACAGGGAAGATGG - Intergenic
986279614 5:6312620-6312642 AAGTGCAAGAAGAAACGAGAAGG - Intergenic
986390881 5:7287240-7287262 AAGTCAAGGAGGAAGGAGGAGGG - Intergenic
986612193 5:9580386-9580408 AATAGCAGGAAGAATGAAGGGGG - Intergenic
986618292 5:9643009-9643031 AAGGGAGGGAAGAAGGAAAAAGG - Intronic
986630315 5:9766425-9766447 AAATGCTGGAAGAAGGTAGCAGG + Intergenic
986729367 5:10623841-10623863 AAGTGGAGGAAGCAGGATAATGG - Intronic
986796532 5:11218056-11218078 AAAGGAAGGAAGGAGGAAGAAGG - Intronic
987011455 5:13770329-13770351 AAGGGCAAGAAGAGGGAAGAGGG + Intronic
987335854 5:16896988-16897010 ACGGGAAGGCAGAAGGAAGAAGG + Intronic
987967897 5:24899825-24899847 ATGGGCAGGAAAAAGGAAAAAGG + Intergenic
988056873 5:26108578-26108600 AAGTAAAGGAAGAGGGAACAGGG - Intergenic
988097326 5:26633613-26633635 AAGAGCAGGAGAAAGGAAGATGG + Intergenic
988222551 5:28367996-28368018 AAGGGAAGGATGAAGAAAGAAGG - Intergenic
988228217 5:28442260-28442282 ATGTGCATTAAGAAGCAAGATGG + Intergenic
988246440 5:28688714-28688736 AAGGGAGGGAAGGAGGAAGAAGG - Intergenic
989029972 5:37108935-37108957 ATATGCAGTAAGAAGAAAGAGGG - Intronic
989135624 5:38151531-38151553 AAGTAGAGGAAGATGGATGATGG - Intergenic
989354515 5:40528420-40528442 TAGTAGAGGAGGAAGGAAGATGG - Intergenic
989411911 5:41129301-41129323 GAGAGAAAGAAGAAGGAAGAAGG - Intergenic
989431696 5:41362791-41362813 TAGTCCAGGAAGAAGAAATAAGG + Intronic
989557921 5:42818565-42818587 ATGGGCAGTAAGAAGAAAGATGG - Intronic
989559177 5:42831486-42831508 TAGTGGAGCAAGAATGAAGAAGG - Intronic
989756213 5:44958748-44958770 AGGAGAAGGAAGAAGGAAGAAGG - Intergenic
990333249 5:54747764-54747786 AAGAGCAGGTATAAGGAAGGAGG - Intergenic
990516715 5:56537151-56537173 AATTGCAGGAAAAGGGATGAAGG - Intronic
990754574 5:59054875-59054897 AAAGGGAGGAAGAGGGAAGAGGG - Intronic
990839169 5:60056369-60056391 ATGTGAATGATGAAGGAAGACGG + Intronic
990889911 5:60636677-60636699 TAGTGGAAGAAGAAAGAAGAAGG - Intronic
990938781 5:61178966-61178988 AACTGCTGGAACGAGGAAGAAGG - Intergenic
991180247 5:63742645-63742667 ATGTGCAGCAAGAGGGAGGATGG - Intergenic
991298026 5:65102164-65102186 AAGTGGAGAAAGAATAAAGATGG - Intergenic
991716342 5:69454310-69454332 TAATCCCGGAAGAAGGAAGAGGG + Intergenic
992248267 5:74851162-74851184 AGGTGAAGGAAGAAGAGAGAGGG + Intronic
992258324 5:74944535-74944557 AAGTGAAGGAAGATGGGAGAAGG + Intergenic
992562376 5:77965410-77965432 AAGTGCAAAAACAAGCAAGAGGG - Intergenic
992657028 5:78920831-78920853 AAGTGCAGTAACAAGCAACAAGG - Intronic
992829356 5:80579210-80579232 AAAGGAAGGAAGAAGAAAGAAGG + Intergenic
993130168 5:83886838-83886860 AAGTACATAAAGAAGGGAGAAGG + Intergenic
993524199 5:88944439-88944461 AAGTTGAGAAAGAACGAAGAGGG + Intergenic
994726982 5:103447799-103447821 AATTACAGGATGAAGGAAAATGG - Intergenic
994858633 5:105159134-105159156 AAGAGGAGGAAGAAATAAGAAGG + Intergenic
995088137 5:108139872-108139894 AAGTTCAGGAAGAATTCAGAAGG - Intronic
995466434 5:112453784-112453806 AAGAGCAGGTAGAATGAAGAAGG + Intergenic
995470718 5:112499411-112499433 GAAAGAAGGAAGAAGGAAGAAGG + Intergenic
995604361 5:113835453-113835475 TATTTCAGGAAAAAGGAAGAGGG + Intergenic
995986133 5:118176517-118176539 AAGTCCACCAAAAAGGAAGAAGG + Intergenic
996396832 5:123021901-123021923 AAGGGTAGGAAGCAGCAAGAAGG - Intronic
996658706 5:125972908-125972930 AGGTGGAGGAAGGAGGGAGAAGG - Intergenic
996732073 5:126726095-126726117 AAGAGGAGGAAGAAGAAAGAAGG + Intergenic
996855506 5:128001656-128001678 AAAAGGAGGAGGAAGGAAGATGG + Intergenic
997444686 5:133932676-133932698 AAGTGCAGGGCAGAGGAAGAAGG - Intergenic
997791442 5:136766002-136766024 AAGGGGAGGAAGCAGGAGGATGG - Intergenic
997804623 5:136904994-136905016 GAAAGGAGGAAGAAGGAAGAAGG - Intergenic
997844185 5:137271082-137271104 ATGTCCAGGATGAAGGAGGAGGG + Intronic
997862283 5:137428771-137428793 AGGTGGAGGAATTAGGAAGAGGG - Intronic
997954207 5:138265654-138265676 AGGAGAAGGAAGAAAGAAGAGGG - Intronic
998115034 5:139530325-139530347 ATGGGCAGTAAGAAGAAAGATGG - Intronic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998408066 5:141885766-141885788 ACTTCCAGGAAGAAGGGAGAGGG - Intergenic
998604037 5:143615486-143615508 AGGAGGAGGAAGAAAGAAGAAGG - Intergenic
998604068 5:143615606-143615628 AGGAGAAGAAAGAAGGAAGAAGG - Intergenic
998648285 5:144089059-144089081 ATGAGCAGGAAGAAGGCAGTGGG - Intergenic
999013512 5:148070109-148070131 AAAAGGAGGAAGAAGGAAGGAGG + Intronic
999093763 5:148959563-148959585 AAGTGCAGTCAGAAGCAATAAGG + Intronic
999496278 5:152101452-152101474 AGAAGTAGGAAGAAGGAAGAAGG + Intergenic
999585537 5:153085747-153085769 GAGAGAAGGAAGAAGGAAGAAGG + Intergenic
999626695 5:153528785-153528807 ACGTGGAGGAAGAGAGAAGAAGG - Intronic
999803236 5:155057304-155057326 AGGTACAGGAAGAAGGTACAGGG - Intergenic
1000202035 5:159020525-159020547 AACTGCAGGAAGGAGGAGGTGGG - Intronic
1000697207 5:164402128-164402150 AAGTGCAGAAAAAAAGAACATGG - Intergenic
1000940666 5:167356235-167356257 AAAGGCAGGAAGATGCAAGAGGG + Intronic
1002050011 5:176565372-176565394 GAGGGCAGGAAGGAGGAAGCAGG - Exonic
1002825386 6:768142-768164 AAGTACAGAAAGAAGGAAAGAGG - Intergenic
1002852676 6:1010522-1010544 AAATGAGGGAAGAAGGGAGAGGG - Intergenic
1002852683 6:1010546-1010568 AAATGAGGGAAGAAGGGAGAGGG - Intergenic
1002976478 6:2083245-2083267 AAGTGCAGGAAGTATGATTAAGG - Intronic
1003142219 6:3481150-3481172 AAGTGAAGGCAGCAGGAAGGGGG - Intergenic
1003361579 6:5431543-5431565 AAGTGCAGTAAGAACAAAAATGG - Intronic
1003454480 6:6269027-6269049 AAGTAAAGGCAGAAGGAAGAAGG + Intronic
1003518953 6:6841464-6841486 AAGTTTAGGAAGAATGAAGAAGG + Intergenic
1003577547 6:7312354-7312376 AAGAAGAGGAAGAAGGCAGAAGG + Intronic
1003603334 6:7538839-7538861 AAGCCCAGGAAGCAGTAAGATGG + Intergenic
1003693675 6:8380147-8380169 AAGAACAGCAAGAAGGAAGAGGG + Intergenic
1003974134 6:11326775-11326797 GAGTGGAGGGGGAAGGAAGATGG - Intronic
1004147564 6:13082466-13082488 CAGTTCAGGAAGAAGAAAAATGG + Intronic
1004484778 6:16056047-16056069 CAGTGCTGGAGGAATGAAGATGG + Intergenic
1004507428 6:16258409-16258431 AAGTGCAGGAAGGAGGGGGCTGG + Intronic
1004773515 6:18814981-18815003 AAGAGCAGGCAAAAGGAAGAAGG - Intergenic
1004918027 6:20350350-20350372 AAGTGGAGGAACAAGAATGATGG - Intergenic
1005065260 6:21811607-21811629 CAGTGGAGGAAAAAGGAACACGG - Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083678 6:21981824-21981846 CAGTGCAGGAAGGAGGAGGCAGG - Intergenic
1005143928 6:22665714-22665736 AAGTGCTGAAACAAAGAAGATGG - Intergenic
1005342903 6:24859831-24859853 AATTGCAGAAAGTAGAAAGAAGG + Intronic
1005396942 6:25392566-25392588 CAGTCCAGGAAGAAGCAAGCAGG - Intronic
1005805573 6:29471424-29471446 ATGGGCAGGAAGAGGGAGGAGGG + Intergenic
1006031886 6:31182178-31182200 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
1006209250 6:32379910-32379932 ACATGCAGGAAGAATGAAGTTGG + Intergenic
1006714797 6:36110279-36110301 AACTGGAGCAAGAAGGAAGGAGG + Exonic
1006903754 6:37519458-37519480 AATTCCAGGAATAGGGAAGAAGG + Intergenic
1006982434 6:38157281-38157303 AAGTGCCTGGAGCAGGAAGATGG + Intergenic
1007067079 6:39001621-39001643 GAGTGTGGGAAGAAGAAAGAAGG + Intronic
1007143505 6:39602438-39602460 AAGTCTAGGAGGGAGGAAGAGGG - Intronic
1007377440 6:41466538-41466560 AAGAGAGGGAAGAAGGAGGAAGG + Intergenic
1007498439 6:42277870-42277892 AGAAGAAGGAAGAAGGAAGAAGG + Intronic
1007786908 6:44285857-44285879 AAGAGAAGGAAATAGGAAGAAGG + Intronic
1007833158 6:44654233-44654255 AGTTGCAAGAAGCAGGAAGAGGG + Intergenic
1008068275 6:47073775-47073797 AGGTGAAGGAAAGAGGAAGAGGG + Intergenic
1008075438 6:47140549-47140571 AAGGCCATGTAGAAGGAAGAAGG + Intergenic
1008189068 6:48432008-48432030 AACAGCAGGATGGAGGAAGAGGG + Intergenic
1008282988 6:49618335-49618357 AAGAGGAGGAATAAGGAAGTGGG - Intronic
1008286180 6:49654040-49654062 GAGGGAGGGAAGAAGGAAGAAGG - Intergenic
1008581206 6:52908958-52908980 AGGAGGAGGAAGAAGAAAGAGGG + Intronic
1008832980 6:55791741-55791763 ACGTGGAGCAAGAGGGAAGATGG + Intronic
1008915862 6:56785866-56785888 AAGATCAAGAATAAGGAAGAGGG - Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009318187 6:62250504-62250526 AAGTAAAGAAGGAAGGAAGAAGG + Intronic
1009433856 6:63595727-63595749 AAGTGAAGGAACATGGAAGAGGG + Intergenic
1009497863 6:64373634-64373656 AAATTCAGGAAGAAGTAGGACGG + Intronic
1010017690 6:71123325-71123347 GGCTGCAGGAAGAAGGCAGATGG - Intergenic
1010311381 6:74389870-74389892 AAGAAGAGGAAGGAGGAAGAAGG - Intergenic
1010318084 6:74473374-74473396 ATGGGCAGTAAGAAGAAAGATGG - Intergenic
1010485668 6:76410450-76410472 AGAAGAAGGAAGAAGGAAGAAGG - Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1011041481 6:83034365-83034387 CACTGCAGGAAGAAGAAAAAAGG - Intronic
1011441057 6:87387837-87387859 GGGGGCAGGAAGATGGAAGAAGG + Intronic
1011657360 6:89563949-89563971 AGGTGCAGGAAGAAGCAGAAAGG + Intronic
1011871665 6:91901951-91901973 AAGAGGAGGAAGAAGGAAAATGG + Intergenic
1011919281 6:92550676-92550698 AAGAGCAGAAACAAGGAAAAGGG + Intergenic
1012330975 6:97986819-97986841 AAGTCCTGGCAGAAGGAAAATGG + Intergenic
1012535850 6:100295950-100295972 AGATGCAGTAAGAAGGAAAAGGG + Intergenic
1012790892 6:103694559-103694581 AAGGGCTGGAAGAGGGAAAATGG + Intergenic
1012979725 6:105816733-105816755 CTTTGAAGGAAGAAGGAAGAGGG - Intergenic
1013171097 6:107636729-107636751 AACTCCAGGAGGAAGGAAGCGGG + Intronic
1013558958 6:111285390-111285412 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
1014813100 6:125907094-125907116 AAGAGGAGGAGGAATGAAGAAGG - Intronic
1014881916 6:126734063-126734085 AAGTGCAGGAAACAAGAAGCTGG + Intergenic
1014996492 6:128152090-128152112 AAGGTCAGGAAGAAGGTAGAAGG + Intronic
1015539540 6:134300187-134300209 AAAGGCAGGGAGAAAGAAGATGG + Intronic
1015631528 6:135236553-135236575 AAAGGAAGGAAGAAGGAAGAAGG - Intergenic
1015983460 6:138862355-138862377 AAGAGCAGGAACAAGAGAGAGGG + Intronic
1016100887 6:140098745-140098767 AAGTGCAGGGGGAAGGGAGCAGG + Intergenic
1016229553 6:141786077-141786099 AAGAGAAGGAAGAAAGAGGAAGG - Intergenic
1016361282 6:143269998-143270020 TAGTGAAGGAAGAAGAAGGAAGG + Intronic
1016455434 6:144225615-144225637 AAGAGAAGAAAAAAGGAAGAAGG + Intergenic
1016583896 6:145662150-145662172 AAGAGAAGGAAGTGGGAAGAAGG - Intronic
1016641377 6:146353281-146353303 ACCTTCAGGAAGAAGGAAAAAGG + Intronic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1017462959 6:154668372-154668394 GAAAGGAGGAAGAAGGAAGAAGG + Intergenic
1017616322 6:156250406-156250428 AAGGGAAGGAAGGAGGAAGAAGG - Intergenic
1018246812 6:161831800-161831822 GAGAGGAGGCAGAAGGAAGAGGG + Intronic
1018265799 6:162023415-162023437 TGGGGCAGCAAGAAGGAAGACGG + Intronic
1018420151 6:163634135-163634157 AAGTTATGGAAGAGGGAAGAAGG + Intergenic
1018556673 6:165057866-165057888 AAAAGCAGGAAGAAGGGAGGAGG + Intergenic
1018691961 6:166353644-166353666 AAAGGAAGGAGGAAGGAAGAAGG - Intergenic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1019266798 7:121637-121659 AAATGCAGGAAGGAAGGAGAAGG + Intergenic
1019320794 7:414412-414434 AGGGGAAGGAAGGAGGAAGAGGG - Intergenic
1019484077 7:1280492-1280514 AGGAGGAAGAAGAAGGAAGAAGG + Intergenic
1019757379 7:2782802-2782824 AAGGTCAGGAGGAAGGAGGATGG - Intronic
1019758581 7:2791514-2791536 AATGGCAGGAAAAAGCAAGACGG + Intronic
1019841508 7:3450798-3450820 AATTGCATGAAGAGAGAAGAGGG + Intronic
1019941846 7:4298155-4298177 AAGGGCAGGAGGAAAGAAGAGGG - Intergenic
1020514526 7:9100145-9100167 AAGTGCTGGAAGAGGGGAAAAGG - Intergenic
1020535424 7:9390039-9390061 TGGTGGAGGAAGAAGCAAGATGG - Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020665274 7:11033321-11033343 AGGTGAAGCAAGAAGAAAGAAGG - Intronic
1020797416 7:12693359-12693381 AAGTGGAGGAAAAAGGAAGGTGG - Intergenic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1021015398 7:15525649-15525671 AAATGCAGGTACAAAGAAGACGG + Intronic
1021301642 7:18980792-18980814 AGGAGAAGGAAGAAGGAAGAAGG - Intronic
1021450988 7:20784137-20784159 CACAGAAGGAAGAAGGAAGAGGG + Intronic
1022315411 7:29240871-29240893 AGAAGAAGGAAGAAGGAAGAAGG - Intronic
1022523142 7:31020599-31020621 GAATGCAGGAGGAAGGTAGATGG + Intergenic
1022574805 7:31487306-31487328 AAGGACAGGAGGAAGGAGGAAGG - Intergenic
1022597061 7:31722771-31722793 GAGTGCAGGAAGCAGGGGGATGG + Intergenic
1022829829 7:34054825-34054847 GAGGGCAGGAAGAAGGAAACTGG + Intronic
1022921428 7:35019532-35019554 AGGAGAAGGAAGAAGAAAGAAGG + Intronic
1023022722 7:36024923-36024945 AGATGCAGGAAGATAGAAGAGGG - Intergenic
1023127011 7:36964713-36964735 ATGTGGAGGAGGAAGGAAGTAGG - Intronic
1023682632 7:42703224-42703246 AAGTGGTGGAGGAAGGAAGGAGG + Intergenic
1023765566 7:43507380-43507402 AAGCGGGGGAAGAAGGAAGTTGG + Intronic
1023883995 7:44338498-44338520 AAGGGCATGAAGAAGGAAGAGGG + Intergenic
1024193074 7:47032318-47032340 AAGTGAAGGGAGAAGACAGAAGG - Intergenic
1024331586 7:48160542-48160564 AAGTGCAGGGGGAAGGATGGAGG + Intergenic
1024425979 7:49226968-49226990 ACGTGATGGAAGAAGCAAGACGG + Intergenic
1024568187 7:50701729-50701751 AAGTGCAGGATGCAGGGGGAAGG - Intronic
1024833370 7:53487653-53487675 AGGGGAATGAAGAAGGAAGAAGG - Intergenic
1024852935 7:53742436-53742458 ATCTGCAGAAAGAAGGAAGGGGG + Intergenic
1025078395 7:55962847-55962869 GAGGGCAGGAGGAAGGAAGCTGG - Intronic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026492100 7:70872066-70872088 AAGGGCGGAAAGAAGGAAGGAGG + Intergenic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1026602468 7:71787920-71787942 AGGTGTGGGAAGAAGGAAGAGGG + Intronic
1026684925 7:72501464-72501486 AGGAGGAGGAAGAAGGAAGGAGG + Intergenic
1027645572 7:80793760-80793782 AAGTGAAGGAAGGAGGTAGGAGG + Intronic
1027719058 7:81715233-81715255 TGGTGTAGGAAGAAGGAAAAAGG - Intronic
1028002579 7:85518702-85518724 AAGTTCGGGGAGAAGGAAGGAGG + Intergenic
1028275476 7:88851187-88851209 AAGTGCCTGAAGAAGGAGTAGGG + Intronic
1028292173 7:89078814-89078836 AAATGGTGGAAGAAAGAAGAAGG - Intronic
1028642077 7:93053762-93053784 AAGTGAAGGAAGGAAGAAAAAGG + Intergenic
1028921376 7:96314108-96314130 AGGAGGAGGAAGAAGGAGGAAGG + Intronic
1029072946 7:97914646-97914668 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1029477039 7:100791346-100791368 GAAAGAAGGAAGAAGGAAGAAGG - Intronic
1029967462 7:104754991-104755013 ATGAGGAGGAAGAAGGAAGTGGG + Intronic
1030401447 7:109056345-109056367 CAGTGCAGAAAGGATGAAGATGG - Intergenic
1030462405 7:109855904-109855926 AAGAAGAGGAAGAAGGAAGAAGG + Intergenic
1030590810 7:111479090-111479112 AAATTCAGGAAGGAGGAAGAAGG - Intronic
1030628939 7:111874100-111874122 AGATGCAGGAAGTAGGAAGTAGG - Intronic
1030645689 7:112058873-112058895 AAGTGAAGGCAGAAAGAAGAAGG + Intronic
1031348050 7:120693569-120693591 AAGTGGAGGAAGAGGGAAAAAGG + Intronic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031739184 7:125407265-125407287 TAGTGGAGGAAGTAGGAAAAAGG + Intergenic
1031777027 7:125918015-125918037 AAGAGCAGGAGGAAGGATAAGGG - Intergenic
1031863850 7:127015129-127015151 AGGAGAAGGAAGAAGGAAGAAGG + Intronic
1032193192 7:129775924-129775946 AAGGACGGGAAGAAGGGAGAGGG + Intergenic
1032254221 7:130284326-130284348 AAGTCCAGGAAGGTGAAAGAGGG + Intronic
1032472724 7:132190099-132190121 AACAGGAGGGAGAAGGAAGAAGG - Intronic
1032727452 7:134604093-134604115 AAATGGAGGATAAAGGAAGATGG - Intergenic
1033252759 7:139775533-139775555 CAGCGCAGGAACAATGAAGAGGG + Intronic
1033440192 7:141371553-141371575 AAGTGGGGCTAGAAGGAAGAAGG + Intronic
1033482618 7:141757089-141757111 AGCTGCAGGAAAAAGAAAGATGG - Intronic
1033490049 7:141834564-141834586 AAGTGCAAAAGGAAGGCAGAAGG - Intergenic
1033605888 7:142928414-142928436 AAGTGCAGAAAGAAGAAAATAGG + Intronic
1033889585 7:145994835-145994857 GAAAGAAGGAAGAAGGAAGAAGG - Intergenic
1033889586 7:145994842-145994864 AAAAGAAGAAAGAAGGAAGAAGG - Intergenic
1033890425 7:146006381-146006403 AGGAGGAGGGAGAAGGAAGAGGG - Intergenic
1034281555 7:149858518-149858540 AAGTGAAGGACAAAGGAAAAGGG - Intronic
1034312179 7:150098526-150098548 AAGAGGAGGAAACAGGAAGATGG - Intergenic
1034589395 7:152127249-152127271 CAGTGCAGGAAAACAGAAGAGGG + Intergenic
1034605331 7:152307390-152307412 AAGGGAGGGGAGAAGGAAGAAGG + Intronic
1034794676 7:154002132-154002154 AAGAGGAGGAAACAGGAAGATGG + Intronic
1034915809 7:155037851-155037873 TAGTTCAGGAAAAAGAAAGATGG - Intergenic
1034978909 7:155463431-155463453 AGGAGCAGGAGGAAGGAGGAAGG - Exonic
1034983337 7:155491897-155491919 CAGAGCAGGAAGCAGGAAGGAGG + Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035143323 7:156786226-156786248 AAGAGAAGGAGGAAGGAGGAAGG + Intronic
1035522926 8:289962-289984 AAGGAAAGGAAGAGGGAAGAAGG - Intergenic
1036244734 8:7106623-7106645 ATGTGCAGGTGGAACGAAGAGGG + Intergenic
1036255999 8:7207093-7207115 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1036279364 8:7386392-7386414 AAGGGATGGAAAAAGGAAGAAGG - Intergenic
1036342150 8:7925480-7925502 AAGGGATGGAAAAAGGAAGAAGG + Intergenic
1036361488 8:8080406-8080428 ATGTGCAGGTGGAACGAAGAGGG + Intergenic
1036546189 8:9771798-9771820 AAGTGGGGGAGGAAGGGAGAAGG + Intronic
1036889490 8:12586617-12586639 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1036897090 8:12644809-12644831 ATGTGCAGGTGGAACGAAGAGGG - Intergenic
1036938616 8:13030228-13030250 AGGAGCATGAAGATGGAAGAAGG - Intronic
1037317454 8:17612342-17612364 AGGAGAAGGAAGAAGGAAGAGGG - Intronic
1037410650 8:18592418-18592440 AAGAGCAGAAAGAAGAAAGAGGG + Intronic
1037438377 8:18888869-18888891 AATTCCAGGCATAAGGAAGAGGG - Intronic
1037498785 8:19465653-19465675 AAGTGCCTGAAGAAGAGAGACGG - Intronic
1037591736 8:20318073-20318095 GAGAGAAGGAAGAGGGAAGAGGG - Intergenic
1038351514 8:26780155-26780177 AAGTGAATGAGGAATGAAGAAGG - Intronic
1038577635 8:28718264-28718286 AAGTGAAGGAAGTTGGAAAAGGG - Intronic
1038694598 8:29795148-29795170 TAGAGGAGGAAGAAGGAGGATGG - Intergenic
1038722259 8:30047422-30047444 CAGGGCAGGAAGAAGAGAGAAGG + Intergenic
1038732473 8:30139593-30139615 AAGTGCAGTAGTAAGGATGAAGG - Intronic
1038775461 8:30526751-30526773 AAATTTGGGAAGAAGGAAGAAGG + Intronic
1038839872 8:31174705-31174727 GAAGGAAGGAAGAAGGAAGAAGG - Intergenic
1038869911 8:31482425-31482447 AATTGCAGCAAGAGGGAAGGTGG - Intergenic
1038955031 8:32458677-32458699 AACTGCTGGGAGAAGGGAGAGGG - Intronic
1039053551 8:33515614-33515636 GAAAGAAGGAAGAAGGAAGAAGG - Intergenic
1039053552 8:33515621-33515643 AAGAAAAGAAAGAAGGAAGAAGG - Intergenic
1039125724 8:34199449-34199471 AAGTAGAGAAAGATGGAAGATGG - Intergenic
1039475789 8:37838853-37838875 AAGTGCAGGACCAAGGCTGACGG + Intronic
1039683254 8:39765609-39765631 AAAGGCAGAAAGAAAGAAGAGGG - Intronic
1039762164 8:40589712-40589734 AAGGAAAGGAAGAAGGAAGAAGG - Intronic
1039806188 8:41001730-41001752 AAGAGGAGGAGGAAGGAAGAAGG - Intergenic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1039807224 8:41010736-41010758 AAGTGCAGGAAGGAGGATCAGGG - Intergenic
1040894217 8:52349179-52349201 AAGGGAAGGGAGAAAGAAGAAGG - Intronic
1040898407 8:52391890-52391912 AATGGCAGGAAAAGGGAAGAAGG + Intronic
1041029874 8:53725754-53725776 AAGAGAAGGAAGAAAGGAGAGGG + Intronic
1041227476 8:55714835-55714857 ATGGGCAGTAAGAAGAAAGATGG - Intronic
1041437691 8:57860605-57860627 AAGTGCAAGAAGCAAGGAGAAGG + Intergenic
1041456250 8:58064036-58064058 TGGTGCAGGAAGAAGAGAGATGG + Intronic
1041905848 8:63032502-63032524 AGGGGCAGAAAGAAGGCAGAAGG + Intronic
1042264597 8:66895365-66895387 AGAAGAAGGAAGAAGGAAGAAGG - Intronic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042408862 8:68438901-68438923 AAGAGCAGAAGGAAGGAAGAAGG + Intronic
1042439501 8:68809693-68809715 AAGTGGAGGAAAAAGGAGGTAGG - Intronic
1042623786 8:70734718-70734740 TAGTTCAGGAACAAGGAAAATGG - Exonic
1042778654 8:72465652-72465674 AAATGCAGGAGGAGAGAAGAAGG - Intergenic
1043146466 8:76661648-76661670 AAAGGAAGGAAGAAGGAAAAAGG + Intergenic
1044056548 8:87577748-87577770 AAGTTCAGGAAGGATGAAAAGGG + Intronic
1044297250 8:90543525-90543547 AGGTTCAGAAAGAAGGAAAATGG + Intergenic
1044599881 8:93992850-93992872 CAGTGCTGGAACCAGGAAGAAGG + Intergenic
1044651978 8:94505372-94505394 ATTTGCTGGGAGAAGGAAGAGGG - Intronic
1044785868 8:95792006-95792028 AAGAGCAGGAAACAGGTAGAAGG + Intergenic
1045047080 8:98289496-98289518 AAAAGCAAGAAGAAGGAAGAGGG - Intronic
1045085406 8:98677542-98677564 AGAGGAAGGAAGAAGGAAGAAGG + Intronic
1045485976 8:102632102-102632124 AAGTGTAGGAGGAAGTTAGAAGG + Intergenic
1045538537 8:103059159-103059181 AAGTGCAGGAAGAATGATACTGG + Intronic
1045623956 8:104019705-104019727 TATTGCAGGAAAATGGAAGAAGG - Intronic
1046635475 8:116670499-116670521 AAGTGCATGATGAGGGAAGCTGG + Intronic
1046652223 8:116848982-116849004 AAGATCAGGAAGAAAGAAGATGG - Exonic
1046983231 8:120359922-120359944 AAGTGCAGTAGGAAGGAAAGAGG - Intronic
1047151766 8:122272081-122272103 AAGGGAAGAAAGAAGGAAGAAGG - Intergenic
1047522809 8:125608471-125608493 AAGTGCAACAGGAAGGAAGGGGG + Intergenic
1047658352 8:127003743-127003765 GAGTGGAGGAAAGAGGAAGAAGG - Intergenic
1048056360 8:130869962-130869984 AGGAGGAGGAAGAAGGAAGAAGG - Intronic
1048463371 8:134641271-134641293 AGGGGGAGGAAGAAGGAAGTGGG - Intronic
1048512826 8:135078079-135078101 GAGGGCAGAGAGAAGGAAGAGGG - Intergenic
1049109049 8:140631582-140631604 AAATGCAGGGAGAAGAGAGAGGG + Intronic
1049303281 8:141883159-141883181 AAGAGAAGGAAGAAGCAGGAGGG + Intergenic
1049400236 8:142423274-142423296 AACTGCAGGCAGAAGGCACAGGG + Intergenic
1049489718 8:142888944-142888966 AAGTGCAGCATGAAGGGTGAGGG - Intronic
1049566498 8:143341816-143341838 AAGAGGAAGAAGAAGGAAGAAGG - Intronic
1050105450 9:2161521-2161543 CAGTGGAGGAAGAAGAAAAAAGG - Intronic
1050495153 9:6232935-6232957 GAGTGGAGGAAGTAGAAAGATGG - Intronic
1050606154 9:7303525-7303547 AAGGAGAGGAAGAAGGGAGAGGG + Intergenic
1050775088 9:9249605-9249627 AAGAGAAAGAAGGAGGAAGAGGG - Intronic
1050796290 9:9548189-9548211 AAGTGAAGGAAGAAGAAAGCTGG + Intronic
1051106534 9:13587294-13587316 AATGACAGGAAGTAGGAAGATGG - Intergenic
1051214257 9:14779398-14779420 CAGAGAAGGAAGAAGAAAGAAGG + Intronic
1051274031 9:15381844-15381866 AGGTGCTGGAAGGAGCAAGAAGG - Intergenic
1051408519 9:16764930-16764952 AAGGGAAGGAAGAAAAAAGAAGG + Intronic
1051738292 9:20225981-20226003 AAGTGAAGGAAGGAGGAAACGGG + Intergenic
1051904364 9:22078335-22078357 AAGCACAGGAAGAGGGAAAATGG - Intergenic
1051973355 9:22918759-22918781 AACTAAAGGAAGAAGAAAGAAGG + Intergenic
1052224053 9:26062626-26062648 ATGTGCACAAAGATGGAAGAGGG + Intergenic
1052294103 9:26878603-26878625 AAGTGGAGGAAGATGGAGAATGG - Intronic
1052505736 9:29351345-29351367 AAGTGCAAGAAGAATGGAGGTGG + Intergenic
1052508434 9:29383464-29383486 ATGGGCAGTAAGAAGAAAGATGG - Intergenic
1054464049 9:65482108-65482130 AAGTGCAGGAAGAAGTGTTATGG - Intergenic
1054891152 9:70253374-70253396 AAGGGAGGGAAGAAGGCAGATGG - Intergenic
1055327605 9:75147864-75147886 AAATGTATGAAGAAGGAAGTGGG + Intergenic
1055473772 9:76641280-76641302 AAGAGCAGGAAGAAAGTAGCAGG + Intronic
1055540217 9:77296455-77296477 AATGACAGAAAGAAGGAAGAGGG - Intronic
1055738878 9:79363962-79363984 AAGAGTAGGAAGAAGGAAACTGG - Intergenic
1055813673 9:80180464-80180486 AAAAGTAGGTAGAAGGAAGACGG - Intergenic
1056185163 9:84127230-84127252 AAATGCACCAAGAAGTAAGATGG - Intergenic
1056317625 9:85406500-85406522 CAATGCAGGAAGATGGAAGAGGG - Intergenic
1056379055 9:86040957-86040979 AAGTGCCTGAAGCAGGAAGAGGG - Intronic
1056468919 9:86886302-86886324 AGGTCCAGGAAGAGGGAAGTGGG + Intergenic
1056608016 9:88103357-88103379 AAGAGGAGGAAGATGGAAGATGG - Intergenic
1056716816 9:89038117-89038139 ATGAGCAGGAAGGAGGCAGAGGG - Exonic
1057201826 9:93144582-93144604 ACTTGCAGGGAGAAGGAAGAAGG + Intergenic
1057275500 9:93674158-93674180 AGGTTCAGGAGGAAGCAAGATGG - Intronic
1057310943 9:93942915-93942937 AGGAGGAGGAGGAAGGAAGAGGG - Intergenic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057483010 9:95460586-95460608 GAGTGAAGGAAGAAGGAGCAGGG + Intronic
1059139916 9:111843300-111843322 ATGTGCAGTAAGAATAAAGATGG + Intergenic
1059214738 9:112550591-112550613 CAGTGCAGGGAAAAGGCAGACGG + Intronic
1059301261 9:113315319-113315341 AAGAGAGGGAAGAAGGAAGGTGG + Exonic
1059303396 9:113333950-113333972 AGGAGAAGGAAGAAGGAAGAAGG - Intronic
1059672319 9:116503160-116503182 AAAGGAAGGAAGAAGGAAGAAGG + Intronic
1059714468 9:116900764-116900786 AGGTGGAGGGAGAAGAAAGAGGG - Intronic
1059761248 9:117339761-117339783 AGGTGAAGGAAGAAGGAGAAAGG + Intronic
1059836269 9:118157419-118157441 AAGTGCAATCTGAAGGAAGAAGG + Intergenic
1060349186 9:122842731-122842753 GAGATCAGGAAGGAGGAAGAGGG - Intergenic
1060644347 9:125265259-125265281 AAAAGAAGGAAGAAGAAAGAAGG - Intronic
1061377602 9:130235499-130235521 AAGGGCAGGACGATGGAGGAAGG - Exonic
1061423308 9:130483886-130483908 AAGTGGAGGAGTAAGGAGGAAGG - Intronic
1061466610 9:130785508-130785530 AAGGGCAGGTAGAGTGAAGAGGG - Intronic
1061927982 9:133815688-133815710 ATGTCCATAAAGAAGGAAGATGG - Intronic
1061933549 9:133845532-133845554 AAGTGCAGGGAGGGGGAAGAGGG - Intronic
1062092579 9:134686214-134686236 AGGAGAAGGAGGAAGGAAGAAGG - Intronic
1062163784 9:135095321-135095343 AAGTGCAGAGTGAAGGAACAAGG - Intronic
1062303314 9:135888016-135888038 AAGTGCAGGAGGAACTCAGAGGG + Intronic
1062344148 9:136107107-136107129 AAGTTCAGGGAGAAGGAACCAGG - Intergenic
1062426932 9:136510445-136510467 AAGTGCAGGGAGGAGCAAGCCGG + Intronic
1062464857 9:136676423-136676445 AAGTGCAGGAAGGGGCAAGGAGG + Intronic
1185479215 X:433677-433699 AAGGCAATGAAGAAGGAAGAAGG + Intergenic
1185521118 X:740413-740435 AGCTGCAGGAAGGGGGAAGATGG + Intergenic
1185698584 X:2213846-2213868 AAGGGAAGGAGGAAGGAAGGAGG + Intergenic
1185698669 X:2214126-2214148 AAGGGAAGGAGGAAGGAAGGAGG + Intergenic
1186032427 X:5384397-5384419 AAGCTGAGGAAGAAGGAAGCCGG + Intergenic
1186077607 X:5898002-5898024 AAGGGAGGGAGGAAGGAAGAGGG - Intronic
1186181741 X:6980178-6980200 AAGAGAAGAAGGAAGGAAGAAGG - Intergenic
1186193180 X:7086048-7086070 AATTGCAGAAAGCAGGAAGAGGG - Intronic
1186206317 X:7204596-7204618 AAGGGAAGGAAGAAAGAAGATGG - Intergenic
1186400662 X:9256388-9256410 AAGTAAAGGAAGAAAGAAGATGG + Intergenic
1186402611 X:9273665-9273687 GAAGGCAGGAAGGAGGAAGAAGG + Intergenic
1186450370 X:9667693-9667715 AATGGCAGGGAAAAGGAAGAGGG + Intronic
1186497840 X:10026034-10026056 GGGTGTAGGGAGAAGGAAGAGGG - Intronic
1186623584 X:11267774-11267796 AAGTGCAGAAATAATGGAGAAGG + Intronic
1186684133 X:11906811-11906833 GAGTGCTAGAAGAAGAAAGAAGG - Intergenic
1186684225 X:11907946-11907968 AGGAGAAGGAAGAAGGAAAAGGG - Intergenic
1186827469 X:13354755-13354777 AAGGGTAGGAACCAGGAAGAGGG - Intergenic
1186838427 X:13460891-13460913 AAATGCAGAAAAAAGAAAGAAGG + Intergenic
1186955632 X:14678876-14678898 CAGTGCCGTAAGATGGAAGAAGG - Intronic
1187025743 X:15433919-15433941 AGGAGGAGGAAGGAGGAAGAAGG + Intronic
1187132222 X:16514086-16514108 ATGTGGAGAAGGAAGGAAGAAGG + Intergenic
1187187812 X:17003882-17003904 AAGTTCTGGAAGAAGGTTGAAGG - Intronic
1187231765 X:17430151-17430173 AAGGGAAGGAAGGAGAAAGAAGG - Intronic
1187264441 X:17718492-17718514 GAGGGAAGGAAAAAGGAAGAAGG + Intronic
1187273713 X:17801187-17801209 GGGTGCAGGCCGAAGGAAGATGG + Exonic
1187627865 X:21136968-21136990 AAGTGAAGGAAGAAGAGAGGAGG + Intergenic
1188038589 X:25345811-25345833 TAGACCAGGAAGAAGCAAGAAGG - Intergenic
1188300217 X:28498442-28498464 CAGGTCAGGAAAAAGGAAGAAGG + Intergenic
1188749117 X:33884193-33884215 AAGTGCAGAGTGAAGGAAGGGGG - Intergenic
1188966602 X:36561069-36561091 GAAGGAAGGAAGAAGGAAGAAGG - Intergenic
1189118840 X:38371712-38371734 AAGAGAAGGAAGGAGGACGAGGG + Intronic
1189720026 X:43906303-43906325 TGCTGCAGGAAGAAGAAAGAAGG + Intergenic
1190653201 X:52587642-52587664 AACTTAAGGAAGAAGGAAGCAGG + Intergenic
1190727458 X:53198931-53198953 AAGTGGGGCAAGAAGGAGGATGG - Intronic
1190831550 X:54063407-54063429 AAGAAGAGGAAGAAGTAAGATGG + Intergenic
1191250881 X:58259645-58259667 AAAAGCAGGAATGAGGAAGAGGG + Intergenic
1191715372 X:64190467-64190489 AAGAGGAGGAAGAAGGAGAATGG - Exonic
1191961752 X:66711109-66711131 AGGAACAGGAAGTAGGAAGAGGG - Intergenic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192353167 X:70373323-70373345 AAGGAAAGGAAGAAGGAAGAAGG + Intronic
1192617978 X:72647691-72647713 GAGTGAGGGAAGAAGTAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193103001 X:77636904-77636926 AGAAGAAGGAAGAAGGAAGAAGG + Intronic
1193103008 X:77636935-77636957 AGGAGAAGGAAGAAGGAGGAAGG + Intronic
1193103018 X:77636992-77637014 AGGAGGAGGAAGGAGGAAGAAGG + Intronic
1194490440 X:94539787-94539809 AAGTGGAGGAAGAAGGAAGTTGG + Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195018625 X:100802812-100802834 AAGATCAGGAAGAAAGAAGATGG + Intergenic
1195068879 X:101260969-101260991 AATTCCACGGAGAAGGAAGAGGG - Exonic
1195412892 X:104587879-104587901 AACTGTAGGAAGAAGGGAGCAGG + Intronic
1195944776 X:110198135-110198157 CAGGGAAGGAAGAAGGAAAACGG + Exonic
1195964093 X:110414403-110414425 AAGTGGAGGAAAAAGGATGAGGG + Intronic
1196040978 X:111203578-111203600 AAGTGCAGGAAAAGGGAAGTGGG - Intronic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1196204390 X:112922794-112922816 CAGAGCAGGAGGAAGAAAGATGG + Intergenic
1196348408 X:114696325-114696347 AAGTAGAGGTGGAAGGAAGAAGG - Intronic
1196414134 X:115453318-115453340 ACGTGGAGCAAGAAGGAAAATGG + Intergenic
1196464584 X:115959094-115959116 AGTTGGAGGAAGATGGAAGAGGG + Intergenic
1196505537 X:116436740-116436762 AAGTGCAGGGAGAAGGAGGTAGG + Exonic
1197115369 X:122826140-122826162 AAGTGCAAGAAGAAAAAAAAAGG + Intergenic
1197754551 X:129984428-129984450 AGGTGCTGGGAGAAGGAAGGGGG + Intronic
1197883781 X:131196654-131196676 CATGGAAGGAAGAAGGAAGAGGG - Intergenic
1198709519 X:139485920-139485942 ATGGGCAGGAAGAAGGAAAGAGG + Intergenic
1198713837 X:139534951-139534973 AAGAGAAGGATGAAGGCAGATGG + Intronic
1198932121 X:141872698-141872720 AGACGGAGGAAGAAGGAAGAGGG + Intronic
1199599764 X:149534993-149535015 ATGAGGAGGAAGAAGAAAGAAGG - Intergenic
1199599830 X:149535340-149535362 AGGTGGAGGAAGAAAGGAGAAGG - Intergenic
1199680936 X:150224163-150224185 AAGAGGAAGATGAAGGAAGAAGG - Intergenic
1199703497 X:150404000-150404022 AAAGGAAGGAAGAAAGAAGAAGG + Intronic
1199751540 X:150824092-150824114 AGAAGAAGGAAGAAGGAAGAAGG + Intronic
1199751575 X:150824249-150824271 AGGAGGAGGAAGAAGGAAGGAGG + Intronic
1199751590 X:150824340-150824362 GAAAGAAGGAAGAAGGAAGAAGG + Intronic
1199911118 X:152287876-152287898 AAGTGGAGGAAGAAGGGATTTGG + Intronic
1200812357 Y:7499272-7499294 ATGATGAGGAAGAAGGAAGAAGG - Intergenic
1201356143 Y:13098927-13098949 AAGGGCAAGAAGAAGGCAGTGGG + Intergenic
1201588896 Y:15591871-15591893 AAAGGAAGGAAGAAGTAAGAGGG - Intergenic
1201596803 Y:15679434-15679456 AAGTTGAGGAAGAAACAAGAAGG + Intergenic
1201680194 Y:16637285-16637307 ATGGGCAGTAAGAAGAAAGATGG + Intergenic
1201697191 Y:16839016-16839038 ATGGGCAGTAAGAAGAAAGATGG - Intergenic
1202046193 Y:20739010-20739032 AAATGGAGGAAGAAGCATGATGG - Intergenic