ID: 1162545357

View in Genome Browser
Species Human (GRCh38)
Location 19:11325812-11325834
Sequence GCCTGTAATCCTGGCACTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287393
Summary {0: 1, 1: 12, 2: 1336, 3: 23195, 4: 262849}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162545347_1162545357 23 Left 1162545347 19:11325766-11325788 CCTACCAATGATAAAAATCTGTG 0: 1
1: 0
2: 3
3: 27
4: 225
Right 1162545357 19:11325812-11325834 GCCTGTAATCCTGGCACTAAAGG 0: 1
1: 12
2: 1336
3: 23195
4: 262849
1162545355_1162545357 -5 Left 1162545355 19:11325794-11325816 CCAGGCGCAGGGGCTTATGCCTG 0: 4
1: 390
2: 8287
3: 44548
4: 109417
Right 1162545357 19:11325812-11325834 GCCTGTAATCCTGGCACTAAAGG 0: 1
1: 12
2: 1336
3: 23195
4: 262849
1162545349_1162545357 19 Left 1162545349 19:11325770-11325792 CCAATGATAAAAATCTGTGGCAG 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1162545357 19:11325812-11325834 GCCTGTAATCCTGGCACTAAAGG 0: 1
1: 12
2: 1336
3: 23195
4: 262849

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162545357 Original CRISPR GCCTGTAATCCTGGCACTAA AGG Intronic
Too many off-targets to display for this crispr