ID: 1162547396

View in Genome Browser
Species Human (GRCh38)
Location 19:11339088-11339110
Sequence CAGGAAACCTTTCCCCACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162547385_1162547396 25 Left 1162547385 19:11339040-11339062 CCACCCCGTGTTCCAGGAGAACG No data
Right 1162547396 19:11339088-11339110 CAGGAAACCTTTCCCCACGCAGG No data
1162547383_1162547396 27 Left 1162547383 19:11339038-11339060 CCCCACCCCGTGTTCCAGGAGAA No data
Right 1162547396 19:11339088-11339110 CAGGAAACCTTTCCCCACGCAGG No data
1162547390_1162547396 13 Left 1162547390 19:11339052-11339074 CCAGGAGAACGAGTTTAAGGAGG No data
Right 1162547396 19:11339088-11339110 CAGGAAACCTTTCCCCACGCAGG No data
1162547384_1162547396 26 Left 1162547384 19:11339039-11339061 CCCACCCCGTGTTCCAGGAGAAC No data
Right 1162547396 19:11339088-11339110 CAGGAAACCTTTCCCCACGCAGG No data
1162547387_1162547396 21 Left 1162547387 19:11339044-11339066 CCCGTGTTCCAGGAGAACGAGTT No data
Right 1162547396 19:11339088-11339110 CAGGAAACCTTTCCCCACGCAGG No data
1162547388_1162547396 20 Left 1162547388 19:11339045-11339067 CCGTGTTCCAGGAGAACGAGTTT No data
Right 1162547396 19:11339088-11339110 CAGGAAACCTTTCCCCACGCAGG No data
1162547386_1162547396 22 Left 1162547386 19:11339043-11339065 CCCCGTGTTCCAGGAGAACGAGT No data
Right 1162547396 19:11339088-11339110 CAGGAAACCTTTCCCCACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162547396 Original CRISPR CAGGAAACCTTTCCCCACGC AGG Intronic