ID: 1162551215

View in Genome Browser
Species Human (GRCh38)
Location 19:11359512-11359534
Sequence CGACTGCCACCAAGCCAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162551215_1162551223 26 Left 1162551215 19:11359512-11359534 CCGCCCTGGCTTGGTGGCAGTCG 0: 1
1: 0
2: 3
3: 18
4: 161
Right 1162551223 19:11359561-11359583 TGCTTACCGCCTGGAGTTCACGG 0: 1
1: 0
2: 2
3: 27
4: 630
1162551215_1162551221 17 Left 1162551215 19:11359512-11359534 CCGCCCTGGCTTGGTGGCAGTCG 0: 1
1: 0
2: 3
3: 18
4: 161
Right 1162551221 19:11359552-11359574 GATCCTGCTTGCTTACCGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162551215 Original CRISPR CGACTGCCACCAAGCCAGGG CGG (reversed) Intronic
900604195 1:3516557-3516579 GGACTGCCACCATCCCTGGGAGG + Intronic
904969260 1:34406250-34406272 CCACTGCCTCCCACCCAGGGAGG + Intergenic
906046741 1:42836812-42836834 CCACTGCAATCCAGCCAGGGTGG + Intronic
906046747 1:42836874-42836896 CCACTGCAATCCAGCCAGGGTGG + Intronic
906805446 1:48775964-48775986 CCTCTGCCACCTGGCCAGGGAGG + Intronic
911941009 1:104047992-104048014 TGACTGCCACCAAGGCAGATGGG + Intergenic
912756520 1:112329235-112329257 TGACTGCCACCACCCCAGGAGGG - Intergenic
912804870 1:112747834-112747856 CGCCAGCCACCAAGCCTGGCTGG + Intergenic
920114248 1:203608828-203608850 CGGCTGGAACCAAGGCAGGGAGG - Intergenic
921177487 1:212607557-212607579 CCTCTGCCCTCAAGCCAGGGTGG - Intronic
921192772 1:212724929-212724951 CGACTGCCACCCCGTCTGGGAGG + Intergenic
922306542 1:224349976-224349998 CGACTGCCACCCCGTCTGGGAGG - Intergenic
922560235 1:226564446-226564468 GGACTGCCACCAATCATGGGGGG + Intronic
922777999 1:228226235-228226257 AGACCCCCACCAAGTCAGGGAGG - Intronic
1064646603 10:17465854-17465876 TGACTGCCACCAAGCCTGGGTGG - Intergenic
1065604855 10:27407434-27407456 AGACTGCCACCATGCCAGAAAGG - Intronic
1066671235 10:37842471-37842493 AGGCTGTCACCAAGCCAAGGAGG - Intronic
1067098662 10:43319068-43319090 GGACTGTCTCAAAGCCAGGGTGG + Intergenic
1067758696 10:49026606-49026628 AGGCTGCCACCATGGCAGGGTGG - Intronic
1070689401 10:78513483-78513505 CAACTGCCCCCAACCCAGGCTGG + Intergenic
1071248551 10:83791430-83791452 CCTCTGCCACCAGACCAGGGAGG - Intergenic
1073928331 10:108544129-108544151 CCACTACCACCAAGGCACGGAGG + Intergenic
1075257026 10:120933430-120933452 GAAATGCCACCAAGCCTGGGAGG - Intergenic
1076121193 10:127937817-127937839 CCACTGCCCTCAAGCCTGGGAGG + Intronic
1077579485 11:3407705-3407727 CATCTGCCACCACGCCAGGGTGG + Intergenic
1078363563 11:10688712-10688734 CGATTTCCACCAAGCCGTGGTGG + Intronic
1081701479 11:45155385-45155407 CAACTGGGACCCAGCCAGGGCGG + Intronic
1083551572 11:63593971-63593993 ACACTGCCACCAGGCGAGGGAGG + Intronic
1084236518 11:67791243-67791265 CATCTGCCACCACGCGAGGGTGG + Intergenic
1084835909 11:71801750-71801772 TGTCTGCCACCACGCCAGGGTGG - Intergenic
1085296951 11:75436688-75436710 GCACTGACACCAAGCCATGGTGG + Intronic
1087568687 11:99896106-99896128 CTCCTGTCCCCAAGCCAGGGAGG + Intronic
1089273260 11:117315852-117315874 CGCCTGCCCCCAAGTCTGGGTGG + Exonic
1089465058 11:118679616-118679638 TCACAGCCACCATGCCAGGGAGG - Exonic
1092407420 12:8230654-8230676 TGTCTGCCACCACGCCAGGGTGG + Intergenic
1097879400 12:64673328-64673350 CGATTGCCAAGAAGCCAGGAGGG - Intronic
1101948169 12:109154180-109154202 CGAGTGCCTCCAGGACAGGGAGG - Intronic
1102603004 12:114047003-114047025 CTACTGCCCCCAACCCAGTGTGG - Intergenic
1108176233 13:47795625-47795647 AGTCTGCCCCCAACCCAGGGAGG - Intergenic
1108619203 13:52164756-52164778 CGCCAGCCACCAAGCCTGGCTGG + Intergenic
1112267842 13:97941818-97941840 CGCCTGCCACCAAACCCGGCTGG - Intergenic
1113751979 13:112782873-112782895 AGGCAGCCACCAGGCCAGGGAGG - Intronic
1114244574 14:20900657-20900679 CAACTGTCAGCAAGCCAGGAAGG - Intergenic
1114247565 14:20928800-20928822 CAACTGTCAGCAAGCCAGGAAGG - Intergenic
1116515961 14:45805798-45805820 AGACAGCCACCATGTCAGGGAGG - Intergenic
1116841074 14:49821186-49821208 CGGCAGCCACCACGCCCGGGAGG + Intronic
1119850087 14:77860966-77860988 TGGCTGTCCCCAAGCCAGGGTGG + Intronic
1119873692 14:78038220-78038242 AGACGGCCCACAAGCCAGGGAGG + Intergenic
1123020217 14:105394460-105394482 CGGCTGCCACCCAGCCTGGTGGG + Intronic
1124831665 15:33154749-33154771 TAACTGCTACCAAGTCAGGGAGG - Exonic
1128261836 15:66238130-66238152 GGGCTGCCACCCAGCCAGGAGGG + Intronic
1133348103 16:5083765-5083787 CGTCTGCCACCACGCCAGGGTGG + Intronic
1136276615 16:29182654-29182676 TCACCGCCACCAAGGCAGGGTGG - Intergenic
1136661398 16:31766201-31766223 CGACTGCCAGCAAGCAATGCAGG - Intronic
1139451787 16:67033465-67033487 CGCCTGCCACCACGCCTGGCTGG + Intronic
1139753575 16:69124568-69124590 CGCCCGCCACCACGCCAGGCTGG + Intronic
1141444623 16:84049961-84049983 CGGCTGCCACCCAGCAAAGGGGG + Intergenic
1141456500 16:84145569-84145591 CGACTGCCCCCCAGGGAGGGCGG + Intronic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1141767449 16:86067946-86067968 CCACTGCCTCCCAGACAGGGAGG + Intergenic
1141804612 16:86334606-86334628 TGACTGCCCCTAACCCAGGGTGG + Intergenic
1141909156 16:87046761-87046783 TGGCTGCCTACAAGCCAGGGAGG - Intergenic
1142080997 16:88148715-88148737 TCACCGCCACCAAGGCAGGGTGG - Intergenic
1142767753 17:2075214-2075236 ATACTGCCACCCAGCTAGGGGGG - Intronic
1143865038 17:9917375-9917397 AGACGGCGGCCAAGCCAGGGAGG + Intronic
1144278801 17:13703381-13703403 CACCTGCAACCAAGCCAGTGAGG - Intergenic
1144932932 17:18874741-18874763 CGTCTGCCACCAAACCAGGGTGG + Intronic
1147733418 17:42618444-42618466 CTACAGCCACCAACCCAGAGGGG + Intergenic
1147994484 17:44353536-44353558 TGTCTGCCTCCAAGCCGGGGAGG - Exonic
1148430923 17:47642875-47642897 CGTCTCCCACCAAGTCATGGTGG - Intergenic
1148932788 17:51140686-51140708 CAAGTGCCACCATGCCCGGGAGG - Intergenic
1149497059 17:57125656-57125678 TGCCTGTCACCAAGCCAGGGAGG - Intergenic
1150683863 17:67304692-67304714 CCACTGCCATCCAGCCTGGGCGG - Intergenic
1152070260 17:78130784-78130806 CGACTCCTGCCAAGCCAGGCAGG - Exonic
1152595566 17:81236144-81236166 GGACTGCCCCCAAGCCTGCGGGG + Intronic
1155750998 18:29422233-29422255 CGACTGCCAGCAAGCAATGCAGG - Intergenic
1157487914 18:48101846-48101868 AGACTCCCACCAGACCAGGGTGG + Intronic
1158568820 18:58579344-58579366 AGACAGCCACCAAGCAAGAGAGG - Exonic
1159420642 18:68215348-68215370 CCACTGCACCCAAGCCTGGGTGG - Intergenic
1160061599 18:75534139-75534161 CTCCTCCCACCAGGCCAGGGAGG + Intergenic
1160752316 19:740272-740294 GGGCTGCGGCCAAGCCAGGGAGG - Intronic
1160855216 19:1214247-1214269 TGACTGCCACCAGGCGGGGGTGG + Intronic
1162551215 19:11359512-11359534 CGACTGCCACCAAGCCAGGGCGG - Intronic
1164457296 19:28419367-28419389 CGCCTGCCACCAACCCACGCTGG - Intergenic
1166867369 19:45847999-45848021 CCACTGCCAGCAGGCCAGGAAGG + Exonic
1168209605 19:54881061-54881083 CTGCTGCCCCCAAGCCACGGAGG - Intronic
925528114 2:4827024-4827046 CGGCTGCCACAAAGACAGAGAGG + Intergenic
928315584 2:30242388-30242410 CGAGTGCCACCATGCCTGGCTGG + Intronic
930809563 2:55526479-55526501 CGACTGCAGTCCAGCCAGGGTGG - Intronic
932390883 2:71389858-71389880 CGACTGCCAACAAGCAATGCAGG + Intronic
934681589 2:96287548-96287570 GGACTGCCACCTATCCAGGAAGG + Exonic
936057059 2:109269275-109269297 GGACTGCCACCAAACAAGGCAGG + Intronic
937441379 2:121918923-121918945 ACACTTCCAACAAGCCAGGGAGG + Intergenic
937974836 2:127576430-127576452 GGACAGCAACCAAGCCAGGCTGG + Intronic
938421773 2:131152478-131152500 AGCCAGCCACCAAGCCAGGCAGG - Intronic
938543467 2:132305654-132305676 TGCCTGCCACCATGCCCGGGTGG - Intergenic
938768939 2:134483282-134483304 CGACGGCCACCAGGGGAGGGAGG - Intronic
942136713 2:172933390-172933412 CAACTGCCATCAACCGAGGGAGG + Intronic
942851739 2:180495278-180495300 CAGCTGCCACCCAGCCAGAGAGG - Intergenic
944517353 2:200525979-200526001 GGACCGCCACCAACACAGGGCGG + Intronic
946631383 2:221672719-221672741 TGACTGCCACCTGGCCAGTGAGG - Intergenic
948146138 2:235709445-235709467 TGACTGCCACTCAGCCAGGGCGG + Intronic
1171532857 20:25863557-25863579 CGACTTCCACCGAGGGAGGGAGG + Intronic
1172214388 20:33224797-33224819 CCACTGCCCCCAAGAAAGGGAGG + Intronic
1172250543 20:33476148-33476170 AGACTGCCACAAAGCCAGCCTGG + Intergenic
1173531340 20:43772025-43772047 GGCCACCCACCAAGCCAGGGAGG - Intergenic
1178266579 21:31148129-31148151 TGACACCCTCCAAGCCAGGGTGG - Intronic
1179803326 21:43822270-43822292 CGACTGCCACCCCGTCTGGGAGG + Intergenic
1179883016 21:44301185-44301207 TGAGTGGGACCAAGCCAGGGAGG + Intronic
1180124379 21:45778995-45779017 CTACTGCCACCAGGGCTGGGGGG - Intronic
1182178183 22:28315186-28315208 AGACTCTCAACAAGCCAGGGAGG + Intronic
1182406907 22:30142130-30142152 CGCATGCCACCACGCCTGGGTGG - Intronic
1183685580 22:39359664-39359686 GGACTGACACCAAGCTAGGGTGG - Intronic
1184283007 22:43449617-43449639 CACCTGCCACCCAGCGAGGGAGG + Intronic
1184734343 22:46389252-46389274 CGAGTGTCCCCGAGCCAGGGTGG + Intronic
952017107 3:28970808-28970830 CTACTGCCACCAAGGCTAGGGGG - Intergenic
953911729 3:46896629-46896651 AGCCTTTCACCAAGCCAGGGCGG + Intronic
957052460 3:75421027-75421049 TGTCTGCCACCACGCCAGGGTGG + Intergenic
959536897 3:107496890-107496912 CAACTGCCACCACCCCAGGATGG + Intergenic
959826444 3:110802871-110802893 TGACTTATACCAAGCCAGGGAGG + Intergenic
961302388 3:125930527-125930549 CATCTGCCACCACGCCAGGGTGG - Intronic
961886079 3:130097258-130097280 TGTCTGCCACCACGCCAGGGTGG + Intronic
965302328 3:167018788-167018810 CGACTGCCACCCCGTCTGGGAGG + Intergenic
966594747 3:181715586-181715608 CGGCTGCCCCAAAGCAAGGGTGG - Intergenic
968451374 4:677529-677551 CTTCTGTCACCAAGGCAGGGAGG + Intronic
968995263 4:3941401-3941423 CATCTGCCACTAAGCCAGGGTGG + Intergenic
969638067 4:8380876-8380898 CGGCTGCCCCCTAGACAGGGTGG + Intronic
969758725 4:9167391-9167413 TGTCTGCCACCACGCCAGGGTGG - Intergenic
969818693 4:9704854-9704876 CGTCTGCCACCACGCCCGGGTGG - Intergenic
973018725 4:45172815-45172837 GCACTTCCACCGAGCCAGGGAGG - Intergenic
977683108 4:99816746-99816768 CCAGTGCCTCCAGGCCAGGGTGG + Intergenic
978111014 4:104964041-104964063 CTACTGCCACCAAGGCATGGGGG - Intergenic
979174918 4:117651546-117651568 CTACTGCCCCCAAGCTGGGGAGG - Intergenic
981135765 4:141209184-141209206 CGACACCCACCAAGAAAGGGAGG + Intronic
982799657 4:159688413-159688435 CAACTTCCAGGAAGCCAGGGTGG + Intergenic
989655715 5:43745692-43745714 CGGCTGCCACCCAGTCTGGGAGG - Intergenic
992909634 5:81383111-81383133 CGCCTGCCACCACGCCCGGCTGG - Intronic
994644349 5:102450637-102450659 CTGGTGCCTCCAAGCCAGGGAGG - Intronic
996747070 5:126854664-126854686 CCACTGCCACCCAGCCGGGCAGG - Intergenic
998169221 5:139862434-139862456 TGGCTGCCACTCAGCCAGGGTGG + Intronic
999731726 5:154480203-154480225 AGAATGCCTCCAGGCCAGGGAGG - Intergenic
1002022521 5:176372973-176372995 CGACAGCCTCAAAGCCAGGTGGG - Exonic
1005996771 6:30936304-30936326 CCACTGCCACCATGGCTGGGTGG + Intergenic
1008985884 6:57542261-57542283 CTACTGCCACCATGCCCGGCTGG + Intronic
1009173906 6:60435123-60435145 CTACTGCCACCATGCCCGGCTGG + Intergenic
1009947094 6:70352720-70352742 CAACTGCCACCAGGCAAGGTGGG + Intergenic
1010644800 6:78373747-78373769 CCACTACCACCAACCCATGGAGG - Intergenic
1015900802 6:138063601-138063623 CGCCTGCCACCAAGCCCAGCTGG - Intergenic
1015921550 6:138270959-138270981 CCACAGACTCCAAGCCAGGGTGG + Intronic
1017717627 6:157223482-157223504 CCACTGCCACCACGCGGGGGGGG - Intergenic
1019734656 7:2644780-2644802 CCACCTCCACCCAGCCAGGGAGG - Intronic
1020319538 7:6929728-6929750 CATCTGCCACCACGCCAGGGTGG + Intergenic
1022149396 7:27585471-27585493 TGACTGCCACAAAGACTGGGTGG + Intronic
1023121216 7:36910834-36910856 AGACAGACACAAAGCCAGGGAGG - Intronic
1027055005 7:75043666-75043688 CGCCTGCCACCACGCCTGGCTGG - Intronic
1027734070 7:81909921-81909943 GGGCTCCCACAAAGCCAGGGTGG + Intergenic
1029506624 7:100967014-100967036 CGACCCCCACCAGGGCAGGGAGG + Intronic
1032021029 7:128407183-128407205 AGCCAGCCACCAAGCCAGGGAGG - Intronic
1033660690 7:143399804-143399826 CCACTTCCACCAACCCAGCGGGG + Exonic
1034241095 7:149611502-149611524 TGGCTGCTCCCAAGCCAGGGTGG - Intergenic
1035549046 8:506069-506091 CCACTGCCACAAAGACAGAGGGG + Intronic
1035772515 8:2159295-2159317 CGACTTACAGCAAACCAGGGAGG - Intronic
1036847788 8:12181573-12181595 TGTCTGCCACCACGCCAGGGTGG + Intergenic
1036869156 8:12423888-12423910 TGTCTGCCACCACGCCAGGGTGG + Intergenic
1038441595 8:27574445-27574467 GGACTGCCACCAAGGGTGGGTGG + Intergenic
1047391117 8:124452081-124452103 CACCAGCCACCAAGCCAGAGTGG + Exonic
1047969764 8:130074670-130074692 CCACGGCCACCATGCCAGGCAGG + Intronic
1049568358 8:143355354-143355376 AGCCTGCCATCAAGCCACGGAGG + Intronic
1052947585 9:34180359-34180381 CGCCTGCCACCACGCCCGGCTGG - Intronic
1054790081 9:69248369-69248391 AGACTGCAACCATGCCAGCGTGG - Intronic
1057305448 9:93909722-93909744 GGAATGCCACAATGCCAGGGAGG - Intergenic
1060701044 9:125748369-125748391 CGACAGCCAGCAAGCCCCGGCGG - Intronic
1060849594 9:126862694-126862716 CGAGTGCCACAAAGCCATGGGGG - Intronic
1060977596 9:127774144-127774166 TGGCTGCCTCCAAGCCTGGGGGG + Exonic
1188274045 X:28178391-28178413 CGCCTGCTACCAGGCCAGGTAGG - Intergenic
1188306478 X:28565604-28565626 CGCCTGCCACCATGCCTGGCTGG - Intergenic
1192443260 X:71190854-71190876 CCAGTGTCACCAAGTCAGGGGGG - Intergenic
1192718081 X:73664488-73664510 CAACTGCCAGCAAGCAAGGCAGG - Intronic
1199623712 X:149721581-149721603 CGACTGCCAGCAAGCAATGCAGG + Intergenic
1200185657 X:154181563-154181585 CCACTGCCCTCCAGCCAGGGTGG + Intergenic
1200191310 X:154218703-154218725 CCACTGCCCTCCAGCCAGGGTGG + Intergenic
1200197065 X:154256507-154256529 CCACTGCCCTCCAGCCAGGGTGG + Intergenic
1200202716 X:154293624-154293646 CCACTGCCCTCCAGCCAGGGTGG + Intronic