ID: 1162551725

View in Genome Browser
Species Human (GRCh38)
Location 19:11361824-11361846
Sequence CTAGCGCCTGTAGCATCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162551725_1162551733 9 Left 1162551725 19:11361824-11361846 CCCCAGGATGCTACAGGCGCTAG 0: 1
1: 0
2: 1
3: 6
4: 81
Right 1162551733 19:11361856-11361878 GGCAGACTGGGCAGATGGGACGG 0: 1
1: 0
2: 7
3: 36
4: 454
1162551725_1162551731 4 Left 1162551725 19:11361824-11361846 CCCCAGGATGCTACAGGCGCTAG 0: 1
1: 0
2: 1
3: 6
4: 81
Right 1162551731 19:11361851-11361873 TAGCTGGCAGACTGGGCAGATGG 0: 1
1: 0
2: 2
3: 16
4: 287
1162551725_1162551730 -3 Left 1162551725 19:11361824-11361846 CCCCAGGATGCTACAGGCGCTAG 0: 1
1: 0
2: 1
3: 6
4: 81
Right 1162551730 19:11361844-11361866 TAGATATTAGCTGGCAGACTGGG 0: 1
1: 0
2: 2
3: 8
4: 150
1162551725_1162551734 17 Left 1162551725 19:11361824-11361846 CCCCAGGATGCTACAGGCGCTAG 0: 1
1: 0
2: 1
3: 6
4: 81
Right 1162551734 19:11361864-11361886 GGGCAGATGGGACGGCCCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 227
1162551725_1162551732 5 Left 1162551725 19:11361824-11361846 CCCCAGGATGCTACAGGCGCTAG 0: 1
1: 0
2: 1
3: 6
4: 81
Right 1162551732 19:11361852-11361874 AGCTGGCAGACTGGGCAGATGGG 0: 1
1: 0
2: 3
3: 37
4: 286
1162551725_1162551729 -4 Left 1162551725 19:11361824-11361846 CCCCAGGATGCTACAGGCGCTAG 0: 1
1: 0
2: 1
3: 6
4: 81
Right 1162551729 19:11361843-11361865 CTAGATATTAGCTGGCAGACTGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162551725 Original CRISPR CTAGCGCCTGTAGCATCCTG GGG (reversed) Intronic
901192483 1:7420888-7420910 CTTGAGCCTGAAGCACCCTGAGG + Intronic
901861476 1:12077452-12077474 CTAGGGACTGTGGCATCCTTTGG - Intronic
906081260 1:43090090-43090112 CTGTAGCCTGTAGCATTCTGAGG - Intergenic
906112343 1:43332348-43332370 CTAGTGAATGGAGCATCCTGAGG + Intergenic
911967383 1:104385506-104385528 CTGTACCCTGTAGCATCCTGAGG - Intergenic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
924929254 1:248712996-248713018 CTAGCTCCTGTATCATCTGGAGG - Intergenic
1069176130 10:65290454-65290476 CTAGAGCTTTTAGCATCCTGAGG + Intergenic
1072546350 10:96442419-96442441 CTGGCGCCGACAGCATCCTGAGG + Intronic
1073078414 10:100839416-100839438 CCAGCCTCTGCAGCATCCTGAGG - Intergenic
1077850460 11:6070935-6070957 CTGTAGCCTGTAGCATTCTGAGG + Intergenic
1080920078 11:36700178-36700200 GTTGCCCCTGTAGCATTCTGTGG + Intergenic
1082197324 11:49321981-49322003 CTATACCCTGTAGCATCCTGAGG + Intergenic
1086658493 11:89386143-89386165 CTATACCCTGTAGCATCCTGAGG - Intronic
1089406408 11:118201197-118201219 GTAGCGCCTACAGCAGCCTGTGG - Intronic
1091722559 12:2823985-2824007 CCAGCTCCTGCAGCATGCTGTGG - Intronic
1103205308 12:119124339-119124361 CTAGCTCCTGAAGCTGCCTGAGG + Intronic
1104056529 12:125234991-125235013 CTAGAGCCTGTAGCATCATGGGG + Intronic
1104950963 12:132439798-132439820 CTTGCGCCTGTTGCAGCCTGTGG - Intergenic
1105603790 13:21910181-21910203 CTGGGGCCTGTGGCATCATGGGG + Intergenic
1112674992 13:101690958-101690980 TTAGCTCCTGCAGCAACCTGGGG + Intronic
1123995379 15:25714310-25714332 CAAGTGCCTGGAGCATCCTGTGG - Intronic
1126780435 15:52134912-52134934 CTACTGCTTGTACCATCCTGGGG + Intronic
1130561689 15:84963943-84963965 CAAGCGTCTGGAGCAGCCTGTGG - Intergenic
1133304102 16:4799238-4799260 ATAGGGCCTGTAGCACCCTAGGG + Intronic
1135662466 16:24308355-24308377 CTAGTGCCTGCAGCAATCTGAGG + Intronic
1138543584 16:57703291-57703313 CTTGTGTCTGTAGCAGCCTGTGG - Intronic
1139929426 16:70513871-70513893 GTAGGTCCTGTACCATCCTGGGG - Intronic
1140676246 16:77333292-77333314 CTAGGGCCTGTCGCATGGTGGGG + Intronic
1143585413 17:7848141-7848163 CGGGCGCCTGAAGCTTCCTGAGG - Exonic
1145738083 17:27247552-27247574 CCAGGGCCTGGTGCATCCTGGGG + Intergenic
1147138438 17:38448192-38448214 CAAGAGCCTGTAGGAACCTGAGG + Intronic
1157639253 18:49196722-49196744 CTAGAGAATGTAGCATCCTAAGG + Intronic
1159956605 18:74522810-74522832 CTAACACCTGCAGCAGCCTGCGG + Exonic
1161687616 19:5711176-5711198 CTAGGCCCTGCAGCAGCCTGGGG + Intronic
1162551725 19:11361824-11361846 CTAGCGCCTGTAGCATCCTGGGG - Intronic
1164425566 19:28138506-28138528 CTTGAGCCTGCAGCCTCCTGGGG - Intergenic
1166391753 19:42412416-42412438 CTTGTGCCAGTAGCAGCCTGGGG + Intronic
926178659 2:10620006-10620028 GTAGTGCCTTTAGCATCCTTGGG - Intronic
927863094 2:26572698-26572720 CCAGCGCCTGTCTCATTCTGAGG - Intronic
929384030 2:41383484-41383506 CTGTACCCTGTAGCATCCTGAGG - Intergenic
934527759 2:95062154-95062176 TCAGCGACTGAAGCATCCTGTGG + Intergenic
944025209 2:195157229-195157251 GTAGCGCCTGTAGAATATTGGGG - Intergenic
948609963 2:239160616-239160638 CTGGCGCCTGCAGCAGCTTGGGG - Intronic
1169225887 20:3856663-3856685 CTAGCTCCTGCAGGATTCTGTGG + Intronic
1172320216 20:33990778-33990800 CTAGCCCCTGTAGACACCTGAGG + Intergenic
1174209417 20:48865602-48865624 CAAGAGCTTTTAGCATCCTGAGG + Intergenic
1179043941 21:37829026-37829048 CCAGGGCCTGTGCCATCCTGGGG + Intronic
1182253010 22:29016812-29016834 CAAGCACCTGTAGCATGCTAGGG + Intronic
1183334028 22:37236598-37236620 CTAGTGCCTGTAGAACTCTGAGG + Intronic
1185218542 22:49617217-49617239 CTGGCACCTGGAGCAGCCTGGGG - Intronic
950073370 3:10170136-10170158 CTGAGGCCTGCAGCATCCTGTGG + Intronic
959000478 3:100958731-100958753 CTAGCTTCTATAGCATCCAGTGG - Intronic
961205212 3:125076258-125076280 CTATGGCCTGCAGCAGCCTGAGG - Intergenic
964227923 3:154428837-154428859 CTCGGGCCTGGAGCATCCTCTGG + Exonic
968866888 4:3218797-3218819 TTAGGGCCTGCAGCATCCTCAGG + Intronic
969317360 4:6390266-6390288 CTGTGGCCAGTAGCATCCTGTGG - Intronic
980389266 4:132122797-132122819 CTGTCCCCTGTAGCATTCTGAGG - Intergenic
983056194 4:163101410-163101432 CTGTACCCTGTAGCATCCTGTGG + Intergenic
983846538 4:172526974-172526996 CTAGTGACTGTATCATCCAGGGG - Intronic
985126008 4:186695241-186695263 CTATTGCCTGTATCATCCTCTGG - Intronic
990765492 5:59177867-59177889 CTAGTGCCTGGAGCAGCATGAGG - Intronic
991470986 5:66969011-66969033 CTAGCCCATGTAGCATAATGTGG + Intronic
993822926 5:92643087-92643109 CTAGACCCTGTAGAATCCTAGGG + Intergenic
993891294 5:93477655-93477677 CTATCACCTGTAGCATTCTGAGG + Intergenic
1003236488 6:4299905-4299927 CTTGCACCAGTAGCCTCCTGGGG + Intergenic
1005187565 6:23180373-23180395 CTGGCGCCTGCAGCTTGCTGGGG - Intergenic
1009749836 6:67869212-67869234 CTGTACCCTGTAGCATCCTGAGG + Intergenic
1013480697 6:110550450-110550472 CCACCGCCTGTGGCCTCCTGTGG + Intergenic
1017781996 6:157722448-157722470 CTAGAGGGCGTAGCATCCTGTGG - Intronic
1018869932 6:167774674-167774696 CTACTGCCTGGAGCATCCTCTGG - Intergenic
1021173139 7:17419254-17419276 CTGTACCCTGTAGCATCCTGAGG - Intergenic
1021901694 7:25291755-25291777 CTAGCCCCCGAAGCATCATGAGG - Intergenic
1033147031 7:138880047-138880069 ATAGCTACTCTAGCATCCTGAGG - Intronic
1033405967 7:141072162-141072184 GTAGCGCCTGTGGCTTTCTGGGG + Intergenic
1035092893 7:156329246-156329268 CTGGCACCTGTACCAGCCTGTGG + Intergenic
1035880282 8:3239063-3239085 CTATACCCTGTAGCATTCTGAGG + Intronic
1038860876 8:31387900-31387922 CTTGCACCTCTAGCATCCAGTGG - Intergenic
1047851469 8:128862209-128862231 CAAGAGCTTGTAGCATGCTGGGG + Intergenic
1049817965 8:144616751-144616773 CGAGTGCCAGTGGCATCCTGTGG + Intergenic
1051513555 9:17906193-17906215 CCAGCCCCTGGAGCATCTTGCGG + Intergenic
1055986732 9:82061345-82061367 CTGGCTCCTGCAGCCTCCTGGGG - Intergenic
1061217116 9:129227851-129227873 CTAGCCCGTGTAGCCTCTTGAGG + Intergenic
1061476685 9:130872257-130872279 CCAGCGCCTGTGTCACCCTGGGG - Intronic
1062587757 9:137257106-137257128 CTAGCGCCTTCAGCTGCCTGGGG + Intronic
1195427165 X:104747431-104747453 GTAGGGCCTGTATCTTCCTGAGG - Intronic
1198513218 X:137375099-137375121 CCAGCGCCTAAAGCATCCAGTGG + Intergenic
1199985817 X:152949382-152949404 CTAAATCCTGTAGCATGCTGGGG + Intronic
1200675656 Y:6143802-6143824 CTATACCCTGTAGCATTCTGAGG - Intergenic