ID: 1162554392

View in Genome Browser
Species Human (GRCh38)
Location 19:11377908-11377930
Sequence GACTCAAGACTTATGGAACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162554392_1162554397 26 Left 1162554392 19:11377908-11377930 CCCTGTTCCATAAGTCTTGAGTC 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1162554397 19:11377957-11377979 ATCCCTGATCATCTGCAGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 218
1162554392_1162554396 3 Left 1162554392 19:11377908-11377930 CCCTGTTCCATAAGTCTTGAGTC 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1162554396 19:11377934-11377956 ACTGGTTCTCTGAGTCATATTGG 0: 1
1: 1
2: 0
3: 12
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162554392 Original CRISPR GACTCAAGACTTATGGAACA GGG (reversed) Exonic