ID: 1162554392

View in Genome Browser
Species Human (GRCh38)
Location 19:11377908-11377930
Sequence GACTCAAGACTTATGGAACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162554392_1162554396 3 Left 1162554392 19:11377908-11377930 CCCTGTTCCATAAGTCTTGAGTC 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1162554396 19:11377934-11377956 ACTGGTTCTCTGAGTCATATTGG 0: 1
1: 1
2: 0
3: 12
4: 118
1162554392_1162554397 26 Left 1162554392 19:11377908-11377930 CCCTGTTCCATAAGTCTTGAGTC 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1162554397 19:11377957-11377979 ATCCCTGATCATCTGCAGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162554392 Original CRISPR GACTCAAGACTTATGGAACA GGG (reversed) Exonic
900825262 1:4921131-4921153 GACTAATGACTTTTGGAAGATGG - Intergenic
901977967 1:13010442-13010464 GAGTCATGGCTTGTGGAACAGGG + Intronic
902004119 1:13218495-13218517 GAGTCATGGCTTGTGGAACAGGG - Intergenic
902023343 1:13364236-13364258 GAGTCATGGCTTGTGGAACAGGG - Intergenic
902573455 1:17361541-17361563 GACTCATGACCCATGGAAAATGG + Intronic
903385845 1:22925829-22925851 GACTCTGGCCTTGTGGAACAGGG - Intergenic
904593050 1:31625924-31625946 GACTCAAGAATTACTCAACAAGG + Intronic
904840337 1:33368363-33368385 GACTGAGGCCTTCTGGAACAGGG + Intronic
905483703 1:38280506-38280528 GACTCAACAGGTATGAAACAAGG - Intergenic
910973152 1:92877604-92877626 TACTCAAGCCTTTTGGTACAGGG - Intronic
911695695 1:100888917-100888939 AACTCAAGGCTTATGGACAATGG - Intronic
912980675 1:114368883-114368905 GACTCCAGACATCTGGAACACGG - Intergenic
913526626 1:119699888-119699910 TAATCAAGACTTGTGGAAGAAGG - Intronic
915095801 1:153461259-153461281 GACCCAAGACCTATAGCACAGGG - Intergenic
918206672 1:182315632-182315654 AACTCAAAACAGATGGAACAGGG + Intergenic
918780995 1:188701000-188701022 GACACAAGACTCATGAAAAAAGG - Intergenic
1063276996 10:4580283-4580305 GAGTCATGGCTTGTGGAACAGGG + Intergenic
1064488408 10:15822058-15822080 GACTCAATACCTATGTAAAAGGG + Intronic
1065659280 10:27989012-27989034 GACTCATGACTCATGGCTCATGG - Intronic
1065828064 10:29589689-29589711 CAATCAAGACTCCTGGAACAGGG + Intronic
1065949692 10:30640916-30640938 CAGTCAAGACTCCTGGAACAGGG - Intergenic
1066740052 10:38511676-38511698 AACTCAAGTGTAATGGAACATGG + Intergenic
1068284335 10:54914545-54914567 AACTCAAAACATATGGAATAGGG + Intronic
1072634728 10:97170598-97170620 AACTCATGACTTTTGGAAGAGGG - Intronic
1073377633 10:103050598-103050620 GACCCAAGGGTTCTGGAACAAGG - Intronic
1075479460 10:122767543-122767565 AACTCAAGACTTAAGGCTCAGGG - Intergenic
1081982622 11:47278045-47278067 GCCTCAAGAGTTTTGGAAGAGGG + Intronic
1082254201 11:50014498-50014520 AACTCAAGACTGAGGAAACAAGG + Intergenic
1084411643 11:69009392-69009414 GACTCATGACTAATGGACCCTGG + Intronic
1086427655 11:86702612-86702634 GATTGAAGACTTAGGAAACAGGG - Intergenic
1086834110 11:91600341-91600363 GACTCTAGAATTTTGGAGCAAGG + Intergenic
1091549612 12:1528039-1528061 GAGTCAAAACTTGTGGCACAGGG - Intergenic
1095377442 12:41547323-41547345 GACACAAAATTTATGGATCATGG + Intronic
1095385904 12:41649446-41649468 GACTCATGACTTATACCACATGG - Intergenic
1096717553 12:53500366-53500388 GACCCAAGACTCATGGAAGAGGG + Intergenic
1098418889 12:70269821-70269843 GACTGAAGATTTATAGAACCTGG + Intronic
1104156779 12:126141036-126141058 AACACACGGCTTATGGAACATGG + Intergenic
1105949075 13:25213502-25213524 TATTCAAGACTGTTGGAACAGGG - Intergenic
1107300922 13:38964899-38964921 AACTCTAGACTTCTGGAACAAGG + Intergenic
1109605558 13:64689641-64689663 GACACGAGACTTATGAATCAAGG - Intergenic
1113007667 13:105725674-105725696 GAGTCATGACTCATGGAAAATGG - Intergenic
1118783005 14:69022547-69022569 GACTGATGACTTATGATACAGGG + Intergenic
1118783155 14:69023738-69023760 GACTGATGACTTATGATACAGGG + Intergenic
1118810739 14:69271306-69271328 AGCTCAAGACCTATGGAACTTGG + Intronic
1124883615 15:33663779-33663801 AACTTGAGACCTATGGAACAGGG + Intronic
1126562279 15:50057081-50057103 GACTAAACACTTATGGACAAAGG + Intronic
1127468014 15:59263807-59263829 TACTGAAGAGTTATGGAAGAAGG + Intronic
1140827331 16:78718903-78718925 GACTCATGACCTAAAGAACATGG + Intronic
1144466788 17:15503479-15503501 GACTGAAGATTGTTGGAACACGG + Intronic
1151109914 17:71664060-71664082 GAATCAAGGATTATGGAAAAAGG - Intergenic
1156833422 18:41523392-41523414 GAGTCAAGACATATTGAAAAAGG + Intergenic
1162554392 19:11377908-11377930 GACTCAAGACTTATGGAACAGGG - Exonic
1165925922 19:39326313-39326335 GACTCAAAACTTAGGGAGCTTGG + Intergenic
926362556 2:12103938-12103960 GACTCAAGACATGTGGAAAGAGG - Intergenic
929174864 2:38966379-38966401 GACACATGACTTTGGGAACAAGG - Intronic
930337974 2:50074353-50074375 AACACAAGATTTATGGAAAAAGG + Intronic
931183865 2:59930815-59930837 GCCCCAGGACTGATGGAACAGGG + Intergenic
931228218 2:60352072-60352094 GACTCTCGACTCAGGGAACAGGG + Intergenic
931452767 2:62382304-62382326 GACTCAATTCTTATGGAAAAGGG - Intergenic
944609900 2:201392537-201392559 GACTCAAGATTTATTGAAAGAGG + Intronic
948249739 2:236516770-236516792 GACTTATGACTTATTAAACAGGG - Intergenic
1169315057 20:4583632-4583654 GACTCCATCCTTAGGGAACAGGG + Intergenic
1169503202 20:6181626-6181648 GCCTCAAGACTCATGGCTCAGGG + Intergenic
1175189450 20:57201342-57201364 GACACAAAACACATGGAACAAGG + Intronic
1177506918 21:22031143-22031165 GACTCAATTTTTATGGTACATGG - Intergenic
1177864533 21:26497499-26497521 AAGTCAAGATTTATGGAATAGGG - Intronic
1178152083 21:29807008-29807030 GAATCAAGTCGTATGGAAAAGGG - Intronic
1182981205 22:34673206-34673228 GCCTCTAGAGTTCTGGAACAAGG + Intergenic
951908401 3:27725167-27725189 GACCCAGGATTTTTGGAACATGG + Intergenic
955471263 3:59288756-59288778 GAGTCAAGACCTAGGGAATAGGG + Intergenic
959296317 3:104539150-104539172 GAAACAAGAGTTATGGAAAAGGG + Intergenic
959519279 3:107307073-107307095 GAATGAAGACTTAAAGAACAGGG + Intergenic
961185717 3:124913419-124913441 GACTTTAGACATATGGACCATGG - Intronic
962515361 3:136144837-136144859 GACTTAAGCTTTAAGGAACAGGG + Intronic
963272001 3:143294427-143294449 CACTCAATACGTATGCAACAAGG + Intronic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
966875439 3:184319222-184319244 GACTCAAGTTAAATGGAACAGGG + Intronic
970923107 4:21418196-21418218 GACATAAGACTTCTGGATCATGG + Intronic
975492343 4:75002832-75002854 GACCCAAGACTAATGGGACAAGG - Intronic
977668182 4:99665212-99665234 AACTCAAGTCTTATGGAAGGGGG - Intergenic
977970602 4:103209515-103209537 GACTCAAGACTTCTGGGACAAGG + Intergenic
987265249 5:16246624-16246646 GGGTCAAGAGTTATGGAAGAGGG - Intergenic
987575287 5:19720192-19720214 ATCTGTAGACTTATGGAACAAGG + Intronic
988137132 5:27188264-27188286 GCCTCAAGACTTCTGAATCAAGG - Intergenic
993264169 5:85700247-85700269 GAGTCAAGACTGATGGCAGATGG - Intergenic
994291381 5:98032024-98032046 GCCTCAAGAATTTTGGAGCAAGG - Intergenic
996038714 5:118787083-118787105 GTCTTAAAACTTATGGAACTGGG - Intergenic
1001486982 5:172126919-172126941 GACACACGGCTTCTGGAACAGGG + Intronic
1003464880 6:6369417-6369439 CACTTAAGACTTATAGAACCAGG + Intergenic
1004309321 6:14530431-14530453 CACTCAAAACTTATCTAACAGGG - Intergenic
1004605745 6:17193645-17193667 GCCTCATGGCTTTTGGAACATGG + Intergenic
1006171242 6:32094592-32094614 GAATAAAGACTTAGGGAAAAGGG + Intronic
1008152523 6:47971725-47971747 GACTCAAGATTTAAGAAACAAGG + Intronic
1010514737 6:76759577-76759599 AACTGAAGACTGATGGAACAAGG - Intergenic
1012442719 6:99276562-99276584 CACTCAAGACATACTGAACATGG + Exonic
1013352161 6:109315627-109315649 AAATCCAGACTTATAGAACAGGG - Intergenic
1014859556 6:126448194-126448216 GACTCAAGACTTACTGAATCAGG + Intergenic
1016048067 6:139501123-139501145 GACTCAAGGGTTAAGGGACAAGG - Intergenic
1021568019 7:22033489-22033511 GAGTCAAGACTTTTTGAAAATGG + Intergenic
1021849619 7:24795089-24795111 GAGTCCAGACATCTGGAACACGG - Intergenic
1023450017 7:40273892-40273914 ATCTCAAGATTTATGGGACATGG - Intronic
1027626393 7:80550064-80550086 GCCTTAAGACTTATTGAACTAGG - Intronic
1028427239 7:90703572-90703594 GACACAAGTCTTTTGAAACAAGG + Intronic
1030525462 7:110648040-110648062 AACTAAAGACTAATGGAACCAGG - Intergenic
1033151364 7:138917548-138917570 AACTCAAGATTTGTGGAACTGGG + Exonic
1034244986 7:149637132-149637154 GATTCCAGACTTGTGGCACAGGG + Intergenic
1037310292 8:17548665-17548687 GACAAAAGACCTATGGAAAAAGG - Exonic
1037966607 8:23139016-23139038 GAGGCAAGACTTTTGGAAGAGGG + Intronic
1039236350 8:35506858-35506880 GGGTCAAGACTTTTGGAAAAGGG + Intronic
1044082183 8:87898860-87898882 GATTCAAAACCTATGGAACATGG - Intergenic
1044675830 8:94727787-94727809 GAGTCAAGAATTTTGGGACATGG - Intronic
1053458017 9:38246039-38246061 GAATCAAGACTTCTGCACCAGGG + Intergenic
1054844563 9:69779904-69779926 AAATCAAGACTTCTGGGACACGG - Intergenic
1055120073 9:72649752-72649774 GATTCAAATCTTATGGAAGATGG + Intronic
1055699456 9:78926903-78926925 GACTTAAGAACTATGGAACAAGG + Intergenic
1186606468 X:11097988-11098010 GAGCTAACACTTATGGAACAGGG + Intergenic
1188634556 X:32413050-32413072 GAGTCAAAATTTATGGTACAGGG - Intronic
1188665091 X:32809716-32809738 CACTCAAGACTTAAGGACTATGG - Intronic
1189634515 X:42991600-42991622 AACTCAAGATTTCTGGAACAAGG - Intergenic
1194059450 X:89179185-89179207 GACTCAAAAATTATAAAACAAGG + Intergenic
1202036698 Y:20643780-20643802 GAGTCCAGACATCTGGAACATGG + Intergenic