ID: 1162554966

View in Genome Browser
Species Human (GRCh38)
Location 19:11381156-11381178
Sequence TGCTGAGCAACCTGCGGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 188}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162554966_1162554978 15 Left 1162554966 19:11381156-11381178 CCGGCCCCGCAGGTTGCTCAGCA 0: 1
1: 0
2: 0
3: 7
4: 188
Right 1162554978 19:11381194-11381216 CCTCCAGGATCTCCACCTGGGGG 0: 1
1: 0
2: 3
3: 32
4: 276
1162554966_1162554980 18 Left 1162554966 19:11381156-11381178 CCGGCCCCGCAGGTTGCTCAGCA 0: 1
1: 0
2: 0
3: 7
4: 188
Right 1162554980 19:11381197-11381219 CCAGGATCTCCACCTGGGGGCGG 0: 1
1: 0
2: 1
3: 29
4: 245
1162554966_1162554971 -9 Left 1162554966 19:11381156-11381178 CCGGCCCCGCAGGTTGCTCAGCA 0: 1
1: 0
2: 0
3: 7
4: 188
Right 1162554971 19:11381170-11381192 TGCTCAGCACACACTCGGTGCGG 0: 1
1: 0
2: 1
3: 12
4: 113
1162554966_1162554982 26 Left 1162554966 19:11381156-11381178 CCGGCCCCGCAGGTTGCTCAGCA 0: 1
1: 0
2: 0
3: 7
4: 188
Right 1162554982 19:11381205-11381227 TCCACCTGGGGGCGGAATCAGGG 0: 1
1: 0
2: 0
3: 12
4: 72
1162554966_1162554972 0 Left 1162554966 19:11381156-11381178 CCGGCCCCGCAGGTTGCTCAGCA 0: 1
1: 0
2: 0
3: 7
4: 188
Right 1162554972 19:11381179-11381201 CACACTCGGTGCGGCCCTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 83
1162554966_1162554981 25 Left 1162554966 19:11381156-11381178 CCGGCCCCGCAGGTTGCTCAGCA 0: 1
1: 0
2: 0
3: 7
4: 188
Right 1162554981 19:11381204-11381226 CTCCACCTGGGGGCGGAATCAGG 0: 1
1: 0
2: 0
3: 9
4: 98
1162554966_1162554973 12 Left 1162554966 19:11381156-11381178 CCGGCCCCGCAGGTTGCTCAGCA 0: 1
1: 0
2: 0
3: 7
4: 188
Right 1162554973 19:11381191-11381213 GGCCCTCCAGGATCTCCACCTGG 0: 1
1: 0
2: 3
3: 22
4: 252
1162554966_1162554976 14 Left 1162554966 19:11381156-11381178 CCGGCCCCGCAGGTTGCTCAGCA 0: 1
1: 0
2: 0
3: 7
4: 188
Right 1162554976 19:11381193-11381215 CCCTCCAGGATCTCCACCTGGGG 0: 1
1: 0
2: 3
3: 14
4: 254
1162554966_1162554974 13 Left 1162554966 19:11381156-11381178 CCGGCCCCGCAGGTTGCTCAGCA 0: 1
1: 0
2: 0
3: 7
4: 188
Right 1162554974 19:11381192-11381214 GCCCTCCAGGATCTCCACCTGGG 0: 1
1: 0
2: 3
3: 18
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162554966 Original CRISPR TGCTGAGCAACCTGCGGGGC CGG (reversed) Exonic
900151412 1:1180788-1180810 TGCTCAGCACCCTTCGGGGACGG + Exonic
900320333 1:2080384-2080406 TGCTCTGCATCCTGAGGGGCCGG + Intronic
900396459 1:2455092-2455114 TGCTGAGCCCCCAGCGGAGCCGG + Intronic
900916587 1:5643899-5643921 TGCTGAGCCATCTGCCGTGCAGG + Intergenic
901825692 1:11859396-11859418 TGCTGCGCTACGTGCGGGCCAGG - Intergenic
904860691 1:33535739-33535761 TGCTTAGCAGCCTGGGGGCCTGG - Intronic
905657224 1:39692487-39692509 GGCTGGGCCACGTGCGGGGCAGG + Intronic
905873147 1:41416324-41416346 GGCTGAGGAACCTGCTGGGTGGG + Intergenic
906001811 1:42432878-42432900 TGCTGGGAAGCCTGCAGGGCAGG - Intronic
906223706 1:44103744-44103766 TGCCGAGCAGCCTGAGGAGCTGG - Intergenic
913602133 1:120431812-120431834 TCCAGACCAACCTGAGGGGCGGG + Intergenic
914084917 1:144444823-144444845 TCCAGACCAACCTGAGGGGCGGG - Intronic
914190927 1:145409980-145410002 TCCAGACCAACCTGAGGGGCGGG - Intergenic
914363306 1:146955422-146955444 TCCAGACCAACCTGAGGGGCGGG + Intronic
914488370 1:148131717-148131739 TCCAGACCAACCTGAGGGGCGGG - Intronic
914588732 1:149086833-149086855 TCCAGACCAACCTGAGGGGCGGG - Intronic
916749898 1:167714392-167714414 GGCTGAGGAAAGTGCGGGGCGGG - Intergenic
919182660 1:194104843-194104865 AGCTGGGCAGCCTGCTGGGCTGG - Intergenic
921882783 1:220273033-220273055 TGCTCAGCACCCTGCGTGGCTGG - Intergenic
924383985 1:243486500-243486522 TGCTTTGCAACCTGGGGGCCTGG - Intronic
1065435398 10:25699865-25699887 TGCTCCGCAAGCTGAGGGGCTGG + Intergenic
1073403164 10:103275528-103275550 TGATGAGGAACCAGAGGGGCAGG + Intergenic
1074190420 10:111130571-111130593 CCCTGAGCTACCTGAGGGGCTGG + Intergenic
1075797876 10:125134336-125134358 TGCTGAGCAAGGCACGGGGCGGG - Intronic
1076150855 10:128160929-128160951 TACAGAGCAGCCTGCAGGGCGGG + Intergenic
1076727403 10:132420006-132420028 TGCTGGTGACCCTGCGGGGCTGG - Intergenic
1078141225 11:8694403-8694425 GGCTGAGCACCCTGCAGGGAGGG + Intronic
1079090504 11:17476940-17476962 TGCTCCACCACCTGCGGGGCCGG + Intergenic
1083913950 11:65727946-65727968 TGCTGAGCAGCGTGGGGAGCTGG + Intergenic
1088920955 11:114259489-114259511 TGCTGGGCAGGATGCGGGGCAGG + Intronic
1089712694 11:120327467-120327489 TGCTGTGCAGCCTGTGTGGCTGG + Exonic
1096617169 12:52839933-52839955 TGCTGAGCAGCGTGGGGAGCTGG - Exonic
1098264701 12:68706640-68706662 TGCTGAGCAGCATGGGGAGCTGG + Intronic
1098308263 12:69123015-69123037 GGCTGAGCAGCCTGCTGCGCTGG + Intergenic
1101514903 12:105425657-105425679 TGGTGAGTTACCTGTGGGGCAGG + Intergenic
1102708522 12:114904897-114904919 AGCTGAGTGACCTGCTGGGCAGG - Intergenic
1103304891 12:119956206-119956228 TGGTGAGTAACCTGCTGTGCAGG - Intergenic
1111189725 13:84791421-84791443 AACTGACCAACCTGCTGGGCTGG - Intergenic
1113806854 13:113115066-113115088 TGGTGTGCATCCTGCAGGGCAGG + Intronic
1115027209 14:28759285-28759307 TGGAGAGCAGCCTGTGGGGCTGG - Intergenic
1119707341 14:76791349-76791371 TGCAGAGCGACCTGCGGGTTGGG - Exonic
1119820990 14:77616340-77616362 CGCTGGGCAATCCGCGGGGCGGG - Intronic
1121125482 14:91404067-91404089 TGCTGAGCAGCCTGGAGGACAGG - Intronic
1121388970 14:93558087-93558109 AGCTGACCAATCTGCAGGGCTGG + Intronic
1122075511 14:99232310-99232332 AGCTGAGCGAGCTGTGGGGCTGG - Intronic
1122605289 14:102944090-102944112 TGCTGAGCATCCAGGGGGACGGG - Exonic
1122720365 14:103718499-103718521 TCCTCAGGAACCTGTGGGGCAGG + Intronic
1122798954 14:104220446-104220468 GGCTGGGCCTCCTGCGGGGCGGG - Intergenic
1122976081 14:105171314-105171336 TGCGGAGCAAAGTGAGGGGCTGG + Intergenic
1124412886 15:29451377-29451399 AGCTGAGCCACCTGCTGGCCTGG - Intronic
1124694535 15:31853018-31853040 TGCAGAGCAGCCTGGGGGGAAGG - Intronic
1128183293 15:65623713-65623735 AGCTCAGGAACCTGGGGGGCTGG + Intronic
1128877707 15:71215465-71215487 TGCAGAGCAGCGTGCGAGGCAGG - Intronic
1129887201 15:79046976-79046998 TGCAGAGCTTCCTGCGGGGCTGG - Exonic
1130979840 15:88804670-88804692 GGCAGAGCAAGCTGCGGGGGTGG + Intronic
1131215948 15:90535274-90535296 TGAAGAGCAACCAGAGGGGCAGG + Intronic
1132409990 15:101569384-101569406 CGCTGAGCAACCTGGGAGCCAGG - Intergenic
1132853241 16:2034108-2034130 TGCACAGCGGCCTGCGGGGCAGG - Intronic
1133970281 16:10562767-10562789 TGCTGAGCAACCTTGGGCACTGG - Intronic
1134235209 16:12459765-12459787 TGCTGGGCCTCCTGAGGGGCAGG - Intronic
1134884057 16:17774257-17774279 TGCTGATGTACCTGAGGGGCTGG - Intergenic
1135125413 16:19805475-19805497 TGCTAGGCAACCTGCAGGGAAGG + Intronic
1136346404 16:29679021-29679043 TGCTGAGGAATCTGCAGGCCTGG + Exonic
1139705255 16:68737030-68737052 TAGTGAGCCACCGGCGGGGCTGG + Intergenic
1141470832 16:84237282-84237304 TCCTGATCAACGTGGGGGGCAGG - Exonic
1142305392 16:89281606-89281628 TGCTAAGAAACCGCCGGGGCTGG - Exonic
1144230928 17:13202934-13202956 TGCTGAGCCAACTGTGTGGCTGG + Intergenic
1145712498 17:26990535-26990557 GGCTGAGCGATCTGCTGGGCTGG + Intergenic
1146472373 17:33134811-33134833 TGTGGAGCAACCTTTGGGGCAGG - Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1148128482 17:45248618-45248640 TGCTGTTCAAGCTGCTGGGCCGG - Intergenic
1148864919 17:50623530-50623552 TTGTGAGCCACCTGCAGGGCTGG + Intronic
1148913324 17:50954906-50954928 TGGTGAGCAGCCTTCGGGTCTGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151549717 17:74815128-74815150 TGATGAGGAAACTGGGGGGCTGG - Intronic
1153476278 18:5502062-5502084 TGCTGAGCCACCTCAGAGGCAGG - Intronic
1160905872 19:1451554-1451576 CTCTGAGGAACCTGCAGGGCAGG - Exonic
1161453259 19:4358171-4358193 TGGTGAGCTCGCTGCGGGGCGGG + Intronic
1161681003 19:5679753-5679775 TGATGAGGAACCTGCGGGCAGGG + Exonic
1162554966 19:11381156-11381178 TGCTGAGCAACCTGCGGGGCCGG - Exonic
1162779190 19:12997747-12997769 TGCTGTGAAATCTGAGGGGCTGG - Intronic
1163509703 19:17727348-17727370 CGCTGAGCCCACTGCGGGGCGGG + Exonic
1168315960 19:55484915-55484937 TGCTGAGCAACCTGAGCGCCGGG - Intergenic
1168343762 19:55640908-55640930 TGCGGAGCGCCCTGCGGGGAGGG - Intronic
926023714 2:9519958-9519980 TGCTGAGCACCCTGAGAGGTTGG - Intronic
927707376 2:25304821-25304843 TGCTGATAAACCTGAGGGGAAGG - Intronic
927727792 2:25440894-25440916 TGCTGACCAACCTGTGGTACAGG + Intronic
928099246 2:28425752-28425774 TCCTGAGCAACCTGTGGTGAAGG - Intergenic
928730758 2:34229415-34229437 TGCTGAGCAAGTTAAGGGGCAGG - Intergenic
929239401 2:39638509-39638531 TGGTGAGAAACCTGAGGGACAGG + Intergenic
929541744 2:42828251-42828273 TGCTGAGCACCCAGCGGGAGAGG + Intergenic
930632309 2:53767434-53767456 TGCTTTGCTACCTGCGGTGCTGG + Intronic
930865488 2:56118707-56118729 TGCTGAGTGAGCTGCAGGGCCGG + Intergenic
931470638 2:62535251-62535273 TGCAGAGCAAGCTGTGGGACAGG + Intergenic
933354787 2:81197325-81197347 TGCCAAGAAACCTCCGGGGCTGG - Intergenic
933811744 2:86036967-86036989 TGCCGACCTACCTGCTGGGCTGG + Intronic
934769592 2:96899385-96899407 AGCTGAGCAACCTGAGTGCCAGG - Intronic
936554397 2:113481343-113481365 TCCTGAGCAACCAGCTGGGAAGG + Intronic
937288394 2:120767312-120767334 TGCTGAGCAGGGTGCTGGGCTGG + Intronic
937975150 2:127577759-127577781 TGCTGCGCATCCAGGGGGGCAGG - Intronic
938235199 2:129700126-129700148 TGCTTACCATCCTGAGGGGCAGG + Intergenic
939035525 2:137126459-137126481 AGCTGAGGAAGCTGTGGGGCAGG - Intronic
942558643 2:177198112-177198134 TGCTGAGCAGCGTGGGGAGCTGG + Intergenic
945028024 2:205637852-205637874 TCCTAAGCAGCCTGCGAGGCAGG - Intergenic
945927218 2:215818000-215818022 TGCCAAGCAACTTGCAGGGCTGG - Intergenic
946322136 2:218960301-218960323 GGCGGCGCCACCTGCGGGGCTGG - Exonic
948129333 2:235588927-235588949 TGCTGAGAAACCTAGGGGCCAGG - Intronic
948322326 2:237080642-237080664 AGCTGAGCTAGGTGCGGGGCTGG + Intergenic
948798329 2:240418517-240418539 TGCTGTGCCACCCGGGGGGCAGG - Intergenic
948900520 2:240954575-240954597 TGCTGAGCACACTGGGGTGCAGG - Intronic
1172143951 20:32743402-32743424 GGCGGTGGAACCTGCGGGGCTGG - Exonic
1174112181 20:48204630-48204652 TGCTGAGCAAGCTGGGGGCCGGG + Intergenic
1174346824 20:49936442-49936464 TGCTGCGCAGCTGGCGGGGCCGG + Exonic
1176242722 20:64082584-64082606 TTCTGTGCAGCCTGCTGGGCAGG + Intronic
1178926658 21:36780938-36780960 TGCTGTGCAGCCTGGGGGGTGGG - Intronic
1180850933 22:19019787-19019809 TCCTGAGCCAGCTGCTGGGCCGG - Intergenic
1181543032 22:23584086-23584108 TCCTGGGGACCCTGCGGGGCTGG + Intergenic
1182451435 22:30424116-30424138 TACTGAGCAGCTGGCGGGGCAGG - Exonic
1183273450 22:36876223-36876245 TGCTGCCTAACCTGCAGGGCTGG - Intronic
1183731549 22:39621426-39621448 TCCTGAGCGCCCTGTGGGGCTGG + Intronic
1184254631 22:43280121-43280143 TGCTGAGCAAGGCGCTGGGCAGG + Intronic
1184653105 22:45928198-45928220 TCCTGAGGAAGCTGGGGGGCAGG + Intronic
1184937581 22:47736256-47736278 AGATGAGCAACCTGCTGGCCTGG + Intergenic
952611547 3:35216121-35216143 TGCCGAGCAGCCTGGGGAGCTGG - Intergenic
954090819 3:48282671-48282693 TGCTGAGCTACATGCAGAGCTGG + Intronic
954392832 3:50276345-50276367 TGCTGCGCAGGCTGCGGCGCCGG + Exonic
956793535 3:72698726-72698748 AGCTGAGAAAACTGAGGGGCAGG + Intergenic
957966174 3:87324274-87324296 TGCTGAGCAGCATGGGGAGCTGG + Intergenic
962712820 3:138101900-138101922 TGCCGAGCAACGTGGGGAGCTGG - Intronic
963133063 3:141876343-141876365 TCCTAAGCAACCTGCGGCGCGGG + Intronic
963511153 3:146250962-146250984 TGCCCAGCATTCTGCGGGGCAGG - Exonic
964802246 3:160568834-160568856 TGCTGAGCATCGTGGGGAGCTGG + Intergenic
966526306 3:180923243-180923265 TGCTCAGCATCCTGGAGGGCTGG + Intronic
968901196 4:3432744-3432766 GGCTGAGGAGCCAGCGGGGCGGG - Intronic
969481040 4:7447003-7447025 TGCTGAGATACATCCGGGGCTGG + Intronic
976220525 4:82753527-82753549 GGCTGAGTCACCTGCGGGGAAGG + Intronic
985731054 5:1549170-1549192 TGCTCAGCAACCTTCTGGGGTGG - Intergenic
985731802 5:1553658-1553680 TGCAGAGGAAACTGCAGGGCTGG - Intergenic
994008051 5:94864159-94864181 TCCTGAGCAGCCTACGAGGCAGG - Intronic
997335311 5:133104350-133104372 TGCTCAGCAGCCTGGGGGCCTGG - Exonic
997443463 5:133925179-133925201 TGATGAACAGCCTGCGGGGAGGG - Intergenic
997976797 5:138445758-138445780 TGCTCTGCAGCCTGCGGGGGTGG - Exonic
998474573 5:142409426-142409448 TGCTGGGCAAACTGTGGGGAAGG + Intergenic
1001333595 5:170779671-170779693 TGCTGGGCAACTTCAGGGGCTGG - Intronic
1001519500 5:172381130-172381152 TGCTGAGCAGCCAGCGTGGCGGG - Intronic
1002599682 5:180347079-180347101 TGCTGAGCGCCCAGAGGGGCTGG + Intronic
1006984863 6:38169523-38169545 GGCTGAGCAGCCTTCAGGGCAGG - Exonic
1016753307 6:147655267-147655289 TGCTAAGCAACCTGCATGACAGG + Intronic
1018863105 6:167726290-167726312 GGCTGAGCAACCTTCCGCGCTGG - Intergenic
1019415284 7:924169-924191 TGCTGTGTAACCTGGAGGGCGGG - Intronic
1019415293 7:924207-924229 TGCTGTGTAACCTGGAGGGCGGG - Intronic
1019505528 7:1388641-1388663 TGGTGAGCAGCCAGCGGGACAGG - Intergenic
1019661735 7:2228001-2228023 TGCTGAGCCCCCGGCGTGGCAGG - Intronic
1025908464 7:65808450-65808472 TGCTGAGCACCGTGCAGGGCAGG - Intergenic
1026143061 7:67722573-67722595 TGCTCAGGACTCTGCGGGGCAGG - Intergenic
1027637822 7:80697752-80697774 TGCAGAGCAACTTGCAGGACTGG + Intergenic
1030536821 7:110777565-110777587 TGCTGAGAAAGCTGCAGAGCTGG + Intronic
1031963497 7:128010554-128010576 TGCTGAACAACCTGTGGGTGGGG - Intronic
1032503817 7:132420506-132420528 TGCAGAGGCACCTGTGGGGCAGG - Intronic
1035105600 7:156439788-156439810 TGCTGAGCCACCTGCATGTCGGG + Intergenic
1035105611 7:156439859-156439881 TGCTGAGCCACCTGCATGTCAGG + Intergenic
1036688599 8:10927483-10927505 TGCTGGGCCACCTGTGAGGCTGG - Intronic
1037937624 8:22925853-22925875 TGCTGAGTGAGCTGAGGGGCTGG - Intronic
1038614055 8:29076601-29076623 TGGTGAGCACCCTGCTGAGCGGG - Intronic
1044591237 8:93916599-93916621 GGCTGAGCAGGCTGCGGGGTCGG - Intronic
1048063129 8:130941307-130941329 TTCTGAGCATCCTGAGGGGAAGG + Intronic
1048526767 8:135210017-135210039 TGCTGAACACCATGCTGGGCAGG - Intergenic
1049366239 8:142238204-142238226 TTCTGAGCAACCTGGGAGGGTGG - Intronic
1049418018 8:142504374-142504396 TGCTGGGTTACCTGCTGGGCTGG + Intronic
1049836363 8:144738135-144738157 TGCTGGGCCGCCTGCTGGGCCGG - Intronic
1049898610 9:135841-135863 TCCTGAGCAACCAGCTGGGAAGG - Intronic
1051579701 9:18657729-18657751 TGCTCAGCAACCTGTGGAGGAGG + Exonic
1053741661 9:41146145-41146167 TCCTGAGCAACCAGCTGGGAAGG - Intronic
1054346874 9:63975627-63975649 TCCTGAGCAACCAGCTGGGAAGG - Intergenic
1054444654 9:65302290-65302312 TCCTGAGCAACCAGCTGGGAAGG - Intergenic
1054686681 9:68285154-68285176 TCCTGAGCAACCAGCTGGGAAGG + Intronic
1057950164 9:99363488-99363510 TGCTGGGGAACTTGCGGGTCAGG + Intergenic
1060495264 9:124113606-124113628 TGCAGAGCCACCCTCGGGGCTGG - Intergenic
1061365476 9:130170804-130170826 TGCTGAGCATCCTGCCTGGGAGG - Intergenic
1062043484 9:134414824-134414846 CGCTGAGCAGCCCCCGGGGCAGG - Intronic
1062115329 9:134805436-134805458 TGCTGGGCAGCCTGGAGGGCGGG + Intronic
1062475197 9:136723238-136723260 TGGAGAGCACCCTGCAGGGCAGG - Exonic
1186876104 X:13819875-13819897 TGCTTAGAAACCTGCTGGGTAGG + Intronic
1194331747 X:92591527-92591549 AACTGACCAACCTGCAGGGCTGG - Intronic
1199943713 X:152649171-152649193 TGCTGAGGAAACTGCAGGGGTGG - Intronic