ID: 1162555435

View in Genome Browser
Species Human (GRCh38)
Location 19:11383314-11383336
Sequence TTTTCTTATCGGGTCCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 26}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162555435_1162555452 30 Left 1162555435 19:11383314-11383336 CCTGGGCGGACCCGATAAGAAAA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1162555452 19:11383367-11383389 TCCCTTGGAGGGGTCCGCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 116
1162555435_1162555441 6 Left 1162555435 19:11383314-11383336 CCTGGGCGGACCCGATAAGAAAA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1162555441 19:11383343-11383365 CGCCCTGCCATCTTCCCAAGCGG 0: 1
1: 0
2: 1
3: 16
4: 159
1162555435_1162555450 20 Left 1162555435 19:11383314-11383336 CCTGGGCGGACCCGATAAGAAAA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1162555450 19:11383357-11383379 CCCAAGCGGGTCCCTTGGAGGGG 0: 1
1: 0
2: 1
3: 7
4: 81
1162555435_1162555448 19 Left 1162555435 19:11383314-11383336 CCTGGGCGGACCCGATAAGAAAA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1162555448 19:11383356-11383378 TCCCAAGCGGGTCCCTTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1162555435_1162555442 7 Left 1162555435 19:11383314-11383336 CCTGGGCGGACCCGATAAGAAAA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1162555442 19:11383344-11383366 GCCCTGCCATCTTCCCAAGCGGG 0: 1
1: 0
2: 2
3: 26
4: 213
1162555435_1162555446 15 Left 1162555435 19:11383314-11383336 CCTGGGCGGACCCGATAAGAAAA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1162555446 19:11383352-11383374 ATCTTCCCAAGCGGGTCCCTTGG 0: 1
1: 0
2: 0
3: 4
4: 84
1162555435_1162555447 18 Left 1162555435 19:11383314-11383336 CCTGGGCGGACCCGATAAGAAAA 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1162555447 19:11383355-11383377 TTCCCAAGCGGGTCCCTTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162555435 Original CRISPR TTTTCTTATCGGGTCCGCCC AGG (reversed) Intronic
1081376918 11:42369971-42369993 TTTTCTTATAGAGTCCTGCCTGG + Intergenic
1084165347 11:67372760-67372782 TTTTCCTGCCGGGTCCGGCCCGG + Intronic
1087916118 11:103812828-103812850 TTTTCTTATGGGGTCAGCAGGGG + Intergenic
1092202176 12:6592506-6592528 TTTTTTTATCTGGTCCTCCTTGG + Exonic
1092862072 12:12726865-12726887 TTTTCTTATAGTGTCCACCCTGG - Intronic
1094059471 12:26298182-26298204 TTTTCATATCTGTTCCTCCCAGG + Intronic
1097261412 12:57722375-57722397 TTTTCTTATCCTGTGAGCCCGGG - Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1118203698 14:63701668-63701690 TTTTCTTATGGTGGCCTCCCAGG - Intronic
1121738785 14:96237052-96237074 TTTTCTTCTCTGTTCAGCCCAGG + Exonic
1125600127 15:40911081-40911103 TGTTCTTAGCGAGTCTGCCCCGG + Intergenic
1127795013 15:62429974-62429996 TTTTCTTATCAGTTCGGGCCAGG - Intronic
1129084978 15:73079748-73079770 TTTTATTATCGTTTCCGCCCAGG - Intronic
1138398190 16:56724145-56724167 TTTTCTTGTAGGGTCCTGCCAGG + Intronic
1143583551 17:7839895-7839917 TTTTCTTTTAGGTTCCCCCCAGG + Exonic
1146188503 17:30744519-30744541 CTATCTTATAGGGTCCTCCCTGG - Intergenic
1162555435 19:11383314-11383336 TTTTCTTATCGGGTCCGCCCAGG - Intronic
1166848193 19:45743326-45743348 GTTTCTTGTCGGGTCTGCCAAGG + Intronic
927496372 2:23554357-23554379 TTTTCTGATCGGGGCCGGCCGGG + Intronic
940481488 2:154237998-154238020 TTTTCTTATCATGTCAGCCAAGG + Intronic
1168880651 20:1203713-1203735 TTTCCTTCCCGGGTCCCCCCTGG + Intronic
1169680373 20:8205232-8205254 TTTTCTTATCTGGTCTTCTCTGG + Intronic
958720874 3:97841776-97841798 ATTTCATAACGGGTCAGCCCTGG + Intronic
961073629 3:123961481-123961503 TTTTCTCGGCGGCTCCGCCCCGG - Intergenic
961309940 3:125990335-125990357 TTTTCTCGGCGGCTCCGCCCCGG + Intergenic
974982425 4:68975879-68975901 TTATCTTATCACTTCCGCCCTGG - Intergenic
978746152 4:112196755-112196777 TTTTCTTATCTTGTCCTCCATGG + Intergenic
1026672986 7:72405870-72405892 TTCTCTTGTCAGGTCCCCCCAGG + Intronic
1034445513 7:151112067-151112089 TTTGCTCATTGGGTCAGCCCAGG - Intronic
1049295111 8:141828925-141828947 TTTTCTTATTGTGTCCTCCATGG + Intergenic