ID: 1162560031

View in Genome Browser
Species Human (GRCh38)
Location 19:11411781-11411803
Sequence GTGTCTACAAATAATTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2140
Summary {0: 1, 1: 8, 2: 124, 3: 679, 4: 1328}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162560031_1162560037 19 Left 1162560031 19:11411781-11411803 CCCAGCTAATTATTTGTAGACAC 0: 1
1: 8
2: 124
3: 679
4: 1328
Right 1162560037 19:11411823-11411845 CAGGCTAGTCTCAATCTCCTGGG 0: 10
1: 856
2: 12493
3: 22822
4: 31608
1162560031_1162560033 0 Left 1162560031 19:11411781-11411803 CCCAGCTAATTATTTGTAGACAC 0: 1
1: 8
2: 124
3: 679
4: 1328
Right 1162560033 19:11411804-11411826 AAAGTTTCAACATGTTGCCCAGG 0: 1
1: 35
2: 1225
3: 14342
4: 81892
1162560031_1162560036 18 Left 1162560031 19:11411781-11411803 CCCAGCTAATTATTTGTAGACAC 0: 1
1: 8
2: 124
3: 679
4: 1328
Right 1162560036 19:11411822-11411844 CCAGGCTAGTCTCAATCTCCTGG 0: 17
1: 1558
2: 23702
3: 45311
4: 60727

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162560031 Original CRISPR GTGTCTACAAATAATTAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr