ID: 1162561597

View in Genome Browser
Species Human (GRCh38)
Location 19:11420813-11420835
Sequence GACTCGTCCTGACACCCACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 306}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162561597_1162561602 28 Left 1162561597 19:11420813-11420835 CCTGGTGGGTGTCAGGACGAGTC 0: 1
1: 1
2: 0
3: 17
4: 306
Right 1162561602 19:11420864-11420886 TGTGACTTTCGATTAATTTCTGG 0: 1
1: 0
2: 0
3: 7
4: 142
1162561597_1162561603 29 Left 1162561597 19:11420813-11420835 CCTGGTGGGTGTCAGGACGAGTC 0: 1
1: 1
2: 0
3: 17
4: 306
Right 1162561603 19:11420865-11420887 GTGACTTTCGATTAATTTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 115
1162561597_1162561599 -2 Left 1162561597 19:11420813-11420835 CCTGGTGGGTGTCAGGACGAGTC 0: 1
1: 1
2: 0
3: 17
4: 306
Right 1162561599 19:11420834-11420856 TCTAGGACCTCCGAGAGCGACGG 0: 1
1: 0
2: 0
3: 0
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162561597 Original CRISPR GACTCGTCCTGACACCCACC AGG (reversed) Exonic
900146850 1:1162302-1162324 GACCGATCCTGAGACCCACCTGG + Intergenic
900189526 1:1347446-1347468 TTCTGCTCCTGACACCCACCGGG - Intronic
900693024 1:3993062-3993084 CAGGAGTCCTGACACCCACCTGG - Intergenic
904456895 1:30653318-30653340 GACCTGTCCTGACACTCAACTGG - Intergenic
905060347 1:35134728-35134750 GACTGACCCTGACACCCATCAGG - Intergenic
909776503 1:79490963-79490985 GACTGACCCTGACACCCATCAGG - Intergenic
910002555 1:82357253-82357275 GACTGACCCTGACACCCATCAGG - Intergenic
911072909 1:93846696-93846718 CACGCGTGCTGACACCCTCCCGG + Intronic
911147802 1:94569260-94569282 GACTGACCCTGACACCCATCAGG - Intergenic
911984009 1:104599289-104599311 GACTGACCCTGACACCCATCAGG + Intergenic
918714221 1:187767905-187767927 GACTGACCCTGACACCCATCAGG - Intergenic
920526225 1:206668680-206668702 GCCTCTTCCTGACACCTGCCTGG - Intronic
920821378 1:209384660-209384682 GAACCTTCCTGACACCCACGGGG - Intergenic
922934998 1:229415685-229415707 GACTAATCCTGACACCCATCAGG + Intergenic
923770563 1:236934662-236934684 GACTGACCCTGACACCCATCAGG - Intergenic
924180837 1:241437281-241437303 GACTGACCCTGACACCCATCAGG + Intergenic
1062930934 10:1352043-1352065 GACTGACCCTGACACCCATCAGG + Intronic
1063363336 10:5474421-5474443 GACTGACCCTGACACCCATCAGG + Intergenic
1064272855 10:13880711-13880733 ACCACGTCCAGACACCCACCTGG + Intronic
1064342194 10:14497578-14497600 GACTGCTCCTGACACCCACGTGG - Intergenic
1064886822 10:20121562-20121584 GACTGACCCTGACACCCATCAGG - Intronic
1072011149 10:91304140-91304162 GACTGACCCTGACACCCATCAGG - Intergenic
1073709312 10:106020014-106020036 GACTGACCCTGACACCCACCAGG - Intergenic
1074687268 10:115972380-115972402 GACTGTTTCTGACACCCAGCTGG + Intergenic
1075381442 10:122022011-122022033 GAAGCTTCCTGACACCCACCTGG - Exonic
1076745386 10:132510266-132510288 GGATCCTCCTGCCACCCACCTGG + Intergenic
1077589720 11:3482080-3482102 GACTGAACCTGACACCCATCAGG - Intergenic
1077883537 11:6369118-6369140 GACTGACCCTGACACCCACCAGG + Intergenic
1079076496 11:17388247-17388269 GACTCTTCCTTACCTCCACCTGG + Exonic
1079230694 11:18646355-18646377 GACTGACCCTGACACCCATCAGG + Intergenic
1079847509 11:25489621-25489643 GACTGACCCTGACACCCATCAGG - Intergenic
1080227544 11:29976710-29976732 GACTGACCCTGACACCCATCAGG + Intergenic
1080421034 11:32110543-32110565 GTCTCGCACTGTCACCCACCTGG - Intergenic
1082197588 11:49323825-49323847 GACTGACCCTGACACCCATCAGG - Intergenic
1084232476 11:67762977-67762999 GACTGACCCTGACACCCATCAGG + Intergenic
1084245438 11:67853854-67853876 GACTGACCCTGACACCCATCAGG - Intergenic
1084355729 11:68637016-68637038 GACTGACCCTGACACCCATCAGG + Intergenic
1084827246 11:71740724-71740746 GACTGACCCTGACACCCATCAGG + Intergenic
1084966935 11:72749938-72749960 AACCTGTCCTGACCCCCACCAGG + Intronic
1086136093 11:83445302-83445324 GACTGACCCTGACACCCATCAGG - Intergenic
1086658238 11:89384302-89384324 GACTGACCCTGACACCCATCAGG + Intronic
1087167899 11:95022897-95022919 GACTGACCCTGACACCCATCAGG - Intergenic
1087839363 11:102906482-102906504 GACTGACCCTGACACCCATCAGG - Intergenic
1089349266 11:117812579-117812601 GACTGACCCTGACACCCATCAGG + Intronic
1089611556 11:119672267-119672289 GTCTCCTCCCGACACCCACAGGG + Intronic
1089866874 11:121640326-121640348 GACTGACCCTGACACCCATCAGG - Intergenic
1089987849 11:122830426-122830448 GACTGACCCTGACACCCATCAGG + Intergenic
1090235357 11:125142847-125142869 GACTGGCCATGACACTCACCAGG - Intergenic
1090546324 11:127771478-127771500 GACTGACCCTGACACCCATCAGG - Intergenic
1092047251 12:5440614-5440636 CAGTCCTCCTAACACCCACCTGG + Intronic
1092416014 12:8290986-8291008 GACTGACCCTGACACCCATCAGG - Intergenic
1092789882 12:12061697-12061719 GACTGACCCTGACACCCATCAGG + Intronic
1093584348 12:20819411-20819433 GACTGACCCTGACACCCATCAGG - Intronic
1093951251 12:25166457-25166479 GACTGACCCTGACACCCATCAGG + Intronic
1094315869 12:29137384-29137406 GACTGACCCTGACACCCATCAGG - Intergenic
1094400860 12:30059291-30059313 GACTCACCCTGACACCCATCAGG + Intergenic
1094460792 12:30695462-30695484 CCCTCGTCCTCACCCCCACCGGG - Intronic
1095998841 12:48112522-48112544 GACTGACCCTGACACCCATCAGG - Intronic
1097398763 12:59105144-59105166 GACTGACCCTGACACCCATCAGG + Intergenic
1097542013 12:60954386-60954408 GACTGACCCTGACACCCATCAGG - Intergenic
1097671661 12:62546726-62546748 GTCTCGTCCTGTCACCCAGGAGG - Intronic
1098653652 12:73004415-73004437 GACTGACCCTGACACCCATCAGG - Intergenic
1099291920 12:80785481-80785503 GACTGACCCTGACACCCATCGGG - Intergenic
1100468847 12:94873216-94873238 GCCTCGACCTGTCGCCCACCTGG + Intergenic
1100940527 12:99718809-99718831 GACTGACCCTGACACCCATCAGG + Intronic
1102096822 12:110247629-110247651 GTCTCGGCTTGCCACCCACCAGG + Intergenic
1104094010 12:125539448-125539470 GACCCGTTGTGACACCCATCTGG + Intronic
1106468334 13:30032954-30032976 GACTCTCCCTGACCCCCACGTGG + Intergenic
1107682960 13:42869816-42869838 GACTGACCCTGACACCCATCAGG - Intergenic
1108803689 13:54130087-54130109 GACTGACCCTGACACCCATCAGG - Intergenic
1109353091 13:61208114-61208136 GACTGACCCTGACACCCAACAGG + Intergenic
1110650313 13:77935726-77935748 GACTGACCCTGACACCCAACAGG - Intergenic
1110765660 13:79277443-79277465 GACTGACCCTGACACCCATCAGG + Intergenic
1110845520 13:80186989-80187011 GACTGACCCTGACACCCATCAGG + Intergenic
1112237005 13:97645626-97645648 GACTGACCCTGACACCCATCAGG + Intergenic
1112889154 13:104210507-104210529 GACTGACCCTGACACCCATCAGG - Intergenic
1113904444 13:113812779-113812801 GACCTGTCCTGTGACCCACCCGG - Exonic
1116490401 14:45497782-45497804 GACTGACCCTGACACCCATCAGG - Intergenic
1117957735 14:61135821-61135843 GACTGACCCTGACACCCATCAGG - Intergenic
1120251216 14:82063484-82063506 GACTGACCCTGACACCCATCAGG - Intergenic
1120618418 14:86734631-86734653 GACTGACCCTGACACCCATCAGG + Intergenic
1121980408 14:98449522-98449544 GACTGACCCTGACACCCATCAGG - Intergenic
1122381146 14:101308113-101308135 GACTGACCCTGACACCCATCAGG - Intergenic
1122507811 14:102242933-102242955 GACTGACCCTGACACCCATCAGG + Intronic
1122788697 14:104175494-104175516 TTCTGGTCCAGACACCCACCAGG + Exonic
1123882316 15:24687980-24688002 GACTGACCCTGACACCCATCAGG - Intergenic
1123990437 15:25679603-25679625 GACTCCTCAGGACACCCTCCTGG + Exonic
1125045951 15:35242085-35242107 GACTGACCCTGACACCCATCAGG + Intronic
1125213037 15:37238613-37238635 GACTGACCCTGACACCCATCAGG - Intergenic
1125849257 15:42887787-42887809 GACTGACCCTGACACCCATCAGG + Intronic
1126529976 15:49701538-49701560 GACTGACCCTGACACCCACCAGG - Intergenic
1129172880 15:73818502-73818524 GGCTCCTCCTGACAACCAGCAGG + Intergenic
1129259612 15:74357239-74357261 GACTGACCCTGACACCCATCAGG + Intronic
1130133510 15:81162615-81162637 TACTGGTGCTGACTCCCACCTGG - Intronic
1130304731 15:82705566-82705588 GACTGTCCCTGACACCCATCAGG + Intronic
1130781242 15:87042960-87042982 GACTGACCCTGACACCCATCGGG + Intergenic
1130855284 15:87834580-87834602 GACTGACCCTGACACCCATCAGG + Intergenic
1131447922 15:92514821-92514843 GACTGACCCTGACACCCATCAGG + Intergenic
1132263192 15:100443602-100443624 GACTGACCCTGACACCCATCAGG + Intronic
1132340593 15:101075851-101075873 GACTGACCCTGACACCCATCAGG + Intronic
1132541029 16:509815-509837 GACTCGTCCTGGCTCCCATGTGG + Intronic
1132549563 16:548723-548745 GAGTCGTGCTGCCACCCACTGGG + Intronic
1132642064 16:982474-982496 GACCCGCCCTGACACCCGCCCGG - Intronic
1133651574 16:7818009-7818031 GACTGATCCTGACACCCATTAGG + Intergenic
1133938352 16:10286469-10286491 GACTGACCCTGACACCCATCAGG + Intergenic
1137363602 16:47841840-47841862 GACTGACCCTGACACCCATCAGG + Intergenic
1139444583 16:66988989-66989011 GACTTGTCCAGACTCCCAGCTGG - Intronic
1143414172 17:6734033-6734055 GACTGACCCTGACACCCATCAGG - Intergenic
1150622750 17:66820827-66820849 GTCTCGCCCTGTCACCCACCAGG + Intergenic
1152535260 17:80947142-80947164 GATACCTCCTGAAACCCACCGGG - Intronic
1152867567 17:82733463-82733485 GACTCACCCTGACACCTCCCTGG + Intergenic
1155174003 18:23287362-23287384 GACTGACCCTGACACCCATCAGG + Intronic
1155941722 18:31807111-31807133 GACTGACCCTGACACCCATCAGG + Intergenic
1156237539 18:35219078-35219100 GACTGACCCTGACACCCATCAGG + Intergenic
1156302432 18:35847232-35847254 GACTGACCCTGACACCCATCAGG + Intergenic
1156958361 18:42994189-42994211 GACTGACCTTGACACCCACCAGG + Intronic
1157696018 18:49724384-49724406 GACTCTTCCTGACACTGGCCGGG - Intergenic
1157906213 18:51572433-51572455 GACTGACCCTGACACCCATCAGG - Intergenic
1158394468 18:57069025-57069047 GACTGACCCTGACACCCATCAGG - Intergenic
1160462622 18:79050671-79050693 GTCTCGTTCTGTCACCCAGCTGG - Intergenic
1161681658 19:5682651-5682673 GTCTCCTCCTGACAACCTCCAGG - Intronic
1162561597 19:11420813-11420835 GACTCGTCCTGACACCCACCAGG - Exonic
1163043773 19:14623935-14623957 GACTCTTCCTCATACCCTCCAGG + Intronic
1163725415 19:18920682-18920704 GCCTCGTCCTGACACCCACCAGG + Exonic
1165496826 19:36157821-36157843 GACTGACCCTGACACCCATCAGG - Intergenic
1165510142 19:36261888-36261910 GACTTACCCTGACACCCATCAGG - Intergenic
1166112688 19:40632499-40632521 GACCCCTCCTGACACTCAGCGGG - Intergenic
1166498758 19:43325905-43325927 GACTGACCCTGACACCCATCAGG - Intergenic
1166805660 19:45485577-45485599 GAGTGATCCTGACACCCACCGGG + Exonic
1166926958 19:46275730-46275752 GACTGACCCTGACACCCATCAGG - Intergenic
1167099642 19:47396354-47396376 GACTGACCCTGACACCCATCAGG + Intergenic
1167644952 19:50700472-50700494 GACTCTTCCTTTCACCCACAAGG - Intronic
926121087 2:10241473-10241495 GATTCATCCTCACACCCACCGGG + Intergenic
928770637 2:34699490-34699512 GACTGTCCCTGACACCCATCAGG - Intergenic
928770973 2:34701659-34701681 GACTGACCCTGACACCCATCAGG + Intergenic
928778482 2:34793018-34793040 GACTGACCCTGACACCCATCAGG + Intergenic
928779535 2:34803363-34803385 GACTGACCCTGACACCCATCAGG - Intergenic
928857348 2:35816394-35816416 GACTGACCCAGACACCCACCAGG + Intergenic
929023489 2:37577021-37577043 GACTCAGCCTTCCACCCACCAGG + Intergenic
930487181 2:52024506-52024528 GACTGACCCTGACACCCATCAGG - Intergenic
930958574 2:57232200-57232222 GACTGACCCTGACACCCATCAGG + Intergenic
931202051 2:60106896-60106918 GACTCCTCCAGACATCCCCCAGG + Intergenic
931948432 2:67334913-67334935 GACTGACCCTGACACCCATCAGG + Intergenic
932296022 2:70623943-70623965 GACTGGCCCTGACACCCATTAGG + Intronic
933179597 2:79214245-79214267 GACTGACCCTGACACCCATCAGG - Intronic
939307580 2:140429449-140429471 GACTGACCCTGACACCCATCAGG + Intronic
939460562 2:142492241-142492263 GACTGACCCTGACACCCATCAGG - Intergenic
940107526 2:150115917-150115939 GACTGACCCTGACACCCATCAGG + Intergenic
940183131 2:150956354-150956376 GACTGACCCTGACACCCATCAGG + Intergenic
940217007 2:151312151-151312173 GACTGACCCTGACACCCATCAGG + Intergenic
940530361 2:154870627-154870649 GACTGACCCTGACACCCATCAGG + Intergenic
940675636 2:156722462-156722484 GACTGACCCTGACACCCATCAGG - Intergenic
941750796 2:169133854-169133876 GACTGAACCTGACACCCATCAGG + Intronic
943061743 2:183047200-183047222 GACTGACCCTGACACCCATCAGG + Intergenic
943450312 2:188036519-188036541 GACTGACCCTGACACCCATCAGG + Intergenic
943461017 2:188171602-188171624 GACTGACCCTGACACCCATCAGG - Intergenic
943806816 2:192133726-192133748 GACTGACCCTGACACCCATCAGG + Intronic
943951121 2:194133283-194133305 GACTGACCCTGACACCCATCAGG - Intergenic
944387628 2:199182680-199182702 GACTGACCCTGACACCCATCAGG + Intergenic
946780867 2:223192234-223192256 GACTGACCCTGACACCCATCAGG - Intronic
1170680261 20:18520000-18520022 GACTGACCCTGACACCCATCAGG - Intronic
1172201859 20:33132345-33132367 GACTCTTCCTGAAACCCTCTTGG - Intergenic
1173455434 20:43197647-43197669 GTCTGGTCCTGAGAACCACCAGG + Intergenic
1173763601 20:45586598-45586620 AACTGACCCTGACACCCACCAGG - Intergenic
1176055040 20:63140905-63140927 GCCTCCTCCAAACACCCACCTGG + Intergenic
1177030996 21:15982192-15982214 GACTGACCCTGACACCCATCAGG - Intergenic
1177062899 21:16396123-16396145 GACTGATCCTGACACCCATCAGG - Intergenic
1177840575 21:26230447-26230469 GACTGACCCTGACACCCATCAGG - Intergenic
1178001369 21:28164516-28164538 GACTGACCCTGACACCCATCAGG + Intergenic
1179121128 21:38546916-38546938 GATTCATCCTGCCAGCCACCAGG - Intronic
1180718786 22:17891187-17891209 AACTGGTTTTGACACCCACCTGG - Intronic
1181536660 22:23549726-23549748 GACACGTCCTGACACACAGTCGG - Intergenic
1182059222 22:27385124-27385146 CACTCTGCCTGACACACACCAGG - Intergenic
1182447234 22:30397027-30397049 GACTCGTCCTCGCCGCCACCCGG - Exonic
1182998775 22:34837625-34837647 GACTGACCCTGACACCCATCAGG + Intergenic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
1183727676 22:39598466-39598488 GACCCTTCCTCACTCCCACCTGG + Intronic
1184164475 22:42719775-42719797 GACCTGGCCTGAGACCCACCAGG + Intronic
1185316887 22:50183196-50183218 GACTCCTCCTCACTCCCCCCAGG + Intergenic
950728201 3:14933244-14933266 AACTCATCCGGACACACACCTGG + Exonic
950926668 3:16747627-16747649 GACTGACCCTGACACCCATCAGG + Intergenic
951316147 3:21191596-21191618 GACTGACCCTGACACCCATCAGG - Intergenic
951762612 3:26162770-26162792 GACTGACCCTGACACCCATCAGG - Intergenic
952792015 3:37207397-37207419 GACTGACCCTGACACCCATCAGG + Intergenic
953533627 3:43759786-43759808 TACTGGTCCTCACACCCACTGGG - Intergenic
955253550 3:57306993-57307015 GACTGACCCTGACACCCATCAGG + Intronic
956709391 3:72026304-72026326 GACTGACCCTGACACCCATCAGG + Intergenic
957451614 3:80388192-80388214 GACTGACCCTGACACCCATCAGG + Intergenic
958183056 3:90084375-90084397 GACTAACCCTGACACCCATCAGG + Intergenic
958676625 3:97275378-97275400 GACTGACCCTGACACCCATCAGG - Intronic
959485599 3:106925123-106925145 GACTGACCCTGACACCCATCAGG - Intergenic
960282695 3:115795898-115795920 GACTGACCCTGACACCCATCAGG - Intergenic
960309946 3:116107716-116107738 GACTGACCCTGACACCCATCAGG - Intronic
961293662 3:125866905-125866927 GACTGACCCTGACACCCATCAGG + Intergenic
961881222 3:130062578-130062600 GACTGACCCTGACACCCATCAGG + Intergenic
961893561 3:130149598-130149620 GACTGACCCTGACACCCATCAGG - Intergenic
962660813 3:137598789-137598811 GACTGATCCTGACACCCATCAGG + Intergenic
963058802 3:141208280-141208302 GACTGACCCTGACACCCATCAGG + Intergenic
964125278 3:153229087-153229109 GACTGACCCTGACACCCATCAGG - Intergenic
964940784 3:162156533-162156555 GACTGACCCTGACACCCATCAGG - Intergenic
966067008 3:175831006-175831028 GACTGACCCTGACACCCATCAGG + Intergenic
966279484 3:178210849-178210871 GACTGACCCTGACACCCATCAGG + Intergenic
966397824 3:179520168-179520190 GACTGACCCTGACACCCATCAGG + Intergenic
966398264 3:179523319-179523341 GACTGACCCTGACACCCATCAGG - Intergenic
967005174 3:185376933-185376955 GACTGACCCTGACACCCATCAGG - Intronic
967476402 3:189925579-189925601 GACTAGTCCTGTCACCAACAGGG - Intergenic
967657928 3:192073484-192073506 GACTGACCCTGACACCCATCAGG - Intergenic
967740649 3:192998998-192999020 GACTGACCCTGACACCCATCAGG + Intergenic
968993555 4:3930684-3930706 GACTGACCCTGACACCCATCAGG + Intergenic
969003650 4:4002660-4002682 GACTGACCCTGACACCCATCAGG - Intergenic
969254403 4:5992523-5992545 GACACCTCCTGACACCCACGAGG - Intergenic
969810275 4:9642166-9642188 GACTGACCCTGACACCCATCAGG + Intergenic
970029055 4:11656143-11656165 GACTGACCCTGACACCCATCAGG - Intergenic
970087718 4:12367078-12367100 GACTGACCCTGACACCCATCAGG + Intergenic
971180731 4:24326521-24326543 GACTGACCCTGACACCCATCAGG + Intergenic
971552826 4:27977276-27977298 GACTGACCCTGACACCCACCAGG + Intergenic
974173256 4:58293713-58293735 GACTGACCCTGACACCCATCAGG - Intergenic
976558739 4:86477897-86477919 GACTGACCCTGACACCCATCAGG + Intronic
978031657 4:103944448-103944470 GACTGACCCTGACACCCATCAGG + Intergenic
978438793 4:108712462-108712484 GACTGACCCTGACACCCATCAGG + Intergenic
979171235 4:117602714-117602736 GACTGACCCTGACACCCATCAGG - Intergenic
980285112 4:130770674-130770696 GACTGACCCTGACACCCATCAGG + Intergenic
980472263 4:133266091-133266113 GACTGACCCTGACACCCATCAGG - Intergenic
980575452 4:134680311-134680333 GACTGACCCTGACACCCATCAGG - Intergenic
980611601 4:135169698-135169720 GACTGACCCTGACACCCATCAGG - Intergenic
983707843 4:170680805-170680827 GACTGACCCTGACACCCACCAGG + Intergenic
984437441 4:179723758-179723780 GACTGACCCTGACACCCATCAGG + Intergenic
985057218 4:186046601-186046623 GACTGACCCTGACACCCATCAGG - Intergenic
985435887 4:189929165-189929187 GACTGACCCTGACACCCATCAGG + Intergenic
985710350 5:1424331-1424353 CACTCCTCCTGCCACACACCAGG + Intronic
987755999 5:22098149-22098171 GACTGACCCTGACACCCATCAGG + Intronic
991913982 5:71587836-71587858 GACTCCACCTGAGACCCACAAGG - Intronic
992493676 5:77270858-77270880 GAGTCCTCCTAACTCCCACCCGG - Intronic
992961004 5:81956566-81956588 GACTGACCCTGACACCCATCAGG + Intergenic
994125926 5:96169287-96169309 GACTGACCCTGACACCCATCAGG - Intergenic
994375606 5:99013720-99013742 GACTGACCCTGACACCCATCAGG - Intergenic
994775851 5:104034921-104034943 GACTGACCCTGACACCCATCAGG + Intergenic
995124991 5:108570869-108570891 GACTGACCCTGACACCCAACAGG - Intergenic
996574811 5:124969010-124969032 GACTGACCCTGACACCCATCAGG - Intergenic
998693524 5:144613752-144613774 GACTGACCCTGACACCCATCAGG - Intergenic
1000519233 5:162277802-162277824 GACTGACCCTGACACCCATCAGG - Intergenic
1000885148 5:166741495-166741517 GACTGACCCTGACACCCATCAGG - Intergenic
1001963258 5:175893417-175893439 GACTCCTCCTGAGAGCCTCCAGG + Intergenic
1002274043 5:178092420-178092442 GTCTCGTCCTGTCACCAAGCTGG - Intergenic
1004768397 6:18756469-18756491 GACTGACCCTGACACCCATCAGG - Intergenic
1004837177 6:19542214-19542236 GACTGACCCTGACACCCATCAGG + Intergenic
1008476764 6:51941821-51941843 GACTGACCCTGACACCCATCAGG + Intronic
1009269993 6:61603412-61603434 GACTGACCCTGACACCCATCAGG + Intergenic
1009379315 6:63008634-63008656 GACTGACCCTGACACCCATCAGG + Intergenic
1010071548 6:71750950-71750972 GACTGACCCTGACACCCATCAGG - Intergenic
1010829523 6:80512716-80512738 GACTGACCCTGACACCCATCAGG - Intergenic
1010841126 6:80650161-80650183 GACTGACCCTGACACCCATCAGG - Intergenic
1011367724 6:86600773-86600795 GACTGACCCTGACACCCATCAGG - Intergenic
1013407715 6:109858163-109858185 GACTGACCCTGACACCCATCAGG - Intergenic
1014612261 6:123559936-123559958 GACTGACCCTGACACCCATCAGG + Intronic
1014614496 6:123584692-123584714 GACTGACCCTGACACCCACTAGG - Intronic
1015165393 6:130195649-130195671 GACTGACCCTGACACCCATCAGG + Intronic
1015293416 6:131563251-131563273 GTCTCGTTCTGTCACCCAGCTGG - Intergenic
1015801205 6:137063723-137063745 GACTGACCCTGACACCCATCAGG - Intergenic
1015892598 6:137983468-137983490 GGCTCGTCCTTACACACACCAGG + Intergenic
1016518979 6:144926480-144926502 GACTGACCCTGACACCCATCAGG + Intergenic
1016853448 6:148643112-148643134 GACTGACCCTGACACCCATCAGG + Intergenic
1018084320 6:160288974-160288996 GACTGACCCTGACACCCATCAGG - Intergenic
1018135890 6:160778192-160778214 GACTGACCCTGACACCCATCAGG + Intergenic
1019517677 7:1446977-1446999 GACTGGGGCTGCCACCCACCTGG - Intronic
1019686156 7:2383419-2383441 GAGCCAGCCTGACACCCACCAGG - Intergenic
1020316223 7:6907090-6907112 GACTGACCCTGACACCCATCAGG + Intergenic
1020532542 7:9355823-9355845 GACTGACCCTGACACCCATCAGG - Intergenic
1020540967 7:9460960-9460982 GACTTACCCTGACACCCATCAGG - Intergenic
1021172852 7:17417160-17417182 GACTGACCCTGACACCCATCAGG + Intergenic
1022709249 7:32835681-32835703 GACTGACCCTGACACCCATCAGG + Intergenic
1026975898 7:74498029-74498051 AACTCCACCTCACACCCACCAGG - Intronic
1028229717 7:88292140-88292162 GACTCCTCCTGACCCACACTTGG - Intronic
1028670679 7:93397243-93397265 GACTGACCCTGACACCCATCAGG + Intergenic
1031296787 7:120012189-120012211 GACTGACCCTGACACCCATCAGG + Intergenic
1031355014 7:120779542-120779564 GACTGACCCTGACACCCATCAGG - Intergenic
1031704432 7:124963035-124963057 GACTGACCCTGACACCCATCAGG - Intergenic
1032194578 7:129781584-129781606 GACTCGTCCAGTTATCCACCTGG - Intergenic
1033464866 7:141581226-141581248 GACTGACCCTGACACCCATCAGG - Intronic
1035330526 7:158094172-158094194 GACTGGTCATGCCACCCAGCAGG - Intronic
1035880497 8:3240614-3240636 GACTGACCCTGACACCCATCAGG - Intronic
1036070742 8:5439039-5439061 GACTGACCCTGACACCCATCAGG - Intergenic
1036281654 8:7405744-7405766 GACTGACCCTGACACCCATCAGG + Intergenic
1036339816 8:7905828-7905850 GACTGACCCTGACACCCATCAGG - Intergenic
1036472163 8:9061840-9061862 GACTGACCCTGACACCCATCAGG - Intronic
1037175205 8:15939098-15939120 GACTTGTCCTAACACCAAGCAGG - Intergenic
1038685095 8:29708994-29709016 AACTTGTCCTGATCCCCACCAGG - Intergenic
1038984741 8:32796086-32796108 GCCTTGTCTTGCCACCCACCTGG - Intergenic
1041651671 8:60308893-60308915 GACTGACCCTGACACCCATCAGG - Intergenic
1043837907 8:85066282-85066304 GACTGACCCTGACACCCATCAGG + Intergenic
1046294295 8:112199135-112199157 GACTGACCCTGACACCCATCAGG + Intergenic
1047536923 8:125728455-125728477 AACACGTCCTGACATCCATCAGG - Intergenic
1048143936 8:131822500-131822522 GACTGACCCTGACACCCATCAGG + Intergenic
1048585252 8:135769551-135769573 GACTGACCCTGACACCCATCAGG - Intergenic
1049146164 8:141002043-141002065 GGCTCGCCCCGACACCGACCCGG + Intronic
1050117787 9:2278873-2278895 GACTGACCCTGACACCCATCAGG + Intergenic
1050257929 9:3813567-3813589 GACTGACCCTGACACCCATCAGG - Intergenic
1050896252 9:10888082-10888104 GACTGACCCTGACACCCATCAGG + Intergenic
1052653516 9:31329715-31329737 GACTGACCCTGACACCCATCAGG + Intergenic
1052720467 9:32166928-32166950 GACTGACCCTGACACCCATCAGG - Intergenic
1053058204 9:35006795-35006817 GACTGACCCTGACACCCATCAGG + Intergenic
1054807311 9:69407149-69407171 GACTGACCCTGACACCCATCAGG - Intergenic
1055347545 9:75354183-75354205 GACTGACCCTGACACCCATCAGG - Intergenic
1055626898 9:78184120-78184142 GACTGACCCTGACACCCATCAGG + Intergenic
1057378164 9:94543123-94543145 GACTGACCCTGACACCCATCAGG + Intergenic
1057812407 9:98268213-98268235 GACTGACCCTGACACCCATCAGG - Intergenic
1058970853 9:110081650-110081672 GGCTCTTCCTGCCAGCCACCAGG + Intronic
1059574791 9:115476657-115476679 GACTGACCCTGACACCCATCAGG + Intergenic
1061583244 9:131550381-131550403 GACTGACCCTGACACCCATCAGG + Intergenic
1188332838 X:28895017-28895039 GACTGACCCTGACACCCATCAGG - Intronic
1188419678 X:29978652-29978674 GACTGACCCTGACACCCATCAGG + Intergenic
1188431206 X:30106657-30106679 GACTGACCCTGACACCCATCAGG + Intergenic
1188552834 X:31380812-31380834 GACTGACCCTGACACCCATCAGG + Intronic
1191111227 X:56804297-56804319 GTCTCATCCTGACAGACACCTGG - Intergenic
1192706321 X:73530985-73531007 GACTGACCCTGACACCCATCAGG + Intergenic
1193537247 X:82730147-82730169 GACTGACCCTGACACCCATCAGG + Intergenic
1193635944 X:83948983-83949005 GACTTGTCCTCAGACCCACTGGG + Intergenic
1193953958 X:87835550-87835572 GACTTGTCCTCAGACCCCCCTGG + Intergenic
1194660859 X:96627339-96627361 GACTGACCCTGACACCCATCAGG + Intergenic
1194873625 X:99161832-99161854 GACTGACCCTGACACCCATCAGG - Intergenic
1196227038 X:113179196-113179218 GACTGACCCTGACACCCATCAGG - Intergenic
1198287792 X:135209723-135209745 GACTCATCCTGGCACCCGACAGG - Intergenic
1198983579 X:142425970-142425992 GACTGACCCTGACACCCATCAGG - Intergenic
1200049189 X:153419760-153419782 GATTCCTTCTGACACTCACCAGG + Intronic
1200813014 Y:7504047-7504069 GACTGACCCTGACACCCATCAGG + Intergenic