ID: 1162561689

View in Genome Browser
Species Human (GRCh38)
Location 19:11421189-11421211
Sequence TCCTCGCCAGCTTAGAGGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162561689_1162561695 -8 Left 1162561689 19:11421189-11421211 CCTTCCCTCTAAGCTGGCGAGGA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1162561695 19:11421204-11421226 GGCGAGGAACTAAGCGGGGATGG 0: 1
1: 0
2: 0
3: 9
4: 110
1162561689_1162561703 18 Left 1162561689 19:11421189-11421211 CCTTCCCTCTAAGCTGGCGAGGA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1162561703 19:11421230-11421252 GCGAGAGAGGAAGGTGGGCGGGG 0: 1
1: 0
2: 2
3: 59
4: 724
1162561689_1162561697 5 Left 1162561689 19:11421189-11421211 CCTTCCCTCTAAGCTGGCGAGGA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1162561697 19:11421217-11421239 GCGGGGATGGGAAGCGAGAGAGG 0: 1
1: 0
2: 0
3: 59
4: 625
1162561689_1162561706 25 Left 1162561689 19:11421189-11421211 CCTTCCCTCTAAGCTGGCGAGGA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1162561706 19:11421237-11421259 AGGAAGGTGGGCGGGGCCAGGGG 0: 1
1: 0
2: 6
3: 78
4: 780
1162561689_1162561702 17 Left 1162561689 19:11421189-11421211 CCTTCCCTCTAAGCTGGCGAGGA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1162561702 19:11421229-11421251 AGCGAGAGAGGAAGGTGGGCGGG 0: 1
1: 0
2: 23
3: 125
4: 1693
1162561689_1162561696 -7 Left 1162561689 19:11421189-11421211 CCTTCCCTCTAAGCTGGCGAGGA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1162561696 19:11421205-11421227 GCGAGGAACTAAGCGGGGATGGG 0: 1
1: 0
2: 0
3: 8
4: 51
1162561689_1162561699 12 Left 1162561689 19:11421189-11421211 CCTTCCCTCTAAGCTGGCGAGGA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1162561699 19:11421224-11421246 TGGGAAGCGAGAGAGGAAGGTGG 0: 1
1: 0
2: 10
3: 149
4: 1441
1162561689_1162561701 16 Left 1162561689 19:11421189-11421211 CCTTCCCTCTAAGCTGGCGAGGA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1162561701 19:11421228-11421250 AAGCGAGAGAGGAAGGTGGGCGG 0: 1
1: 0
2: 14
3: 174
4: 1599
1162561689_1162561704 23 Left 1162561689 19:11421189-11421211 CCTTCCCTCTAAGCTGGCGAGGA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1162561704 19:11421235-11421257 AGAGGAAGGTGGGCGGGGCCAGG 0: 1
1: 0
2: 3
3: 85
4: 954
1162561689_1162561698 9 Left 1162561689 19:11421189-11421211 CCTTCCCTCTAAGCTGGCGAGGA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1162561698 19:11421221-11421243 GGATGGGAAGCGAGAGAGGAAGG 0: 1
1: 1
2: 13
3: 192
4: 1760
1162561689_1162561700 13 Left 1162561689 19:11421189-11421211 CCTTCCCTCTAAGCTGGCGAGGA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1162561700 19:11421225-11421247 GGGAAGCGAGAGAGGAAGGTGGG 0: 1
1: 3
2: 118
3: 5330
4: 5069
1162561689_1162561705 24 Left 1162561689 19:11421189-11421211 CCTTCCCTCTAAGCTGGCGAGGA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1162561705 19:11421236-11421258 GAGGAAGGTGGGCGGGGCCAGGG 0: 1
1: 0
2: 7
3: 81
4: 755

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162561689 Original CRISPR TCCTCGCCAGCTTAGAGGGA AGG (reversed) Exonic
901751628 1:11413652-11413674 TCCTCCTCTGCTGAGAGGGAGGG + Intergenic
907410508 1:54280158-54280180 TGCTCACCAGCTAAGAAGGACGG - Intronic
910033626 1:82763311-82763333 TCATTGCCATCTGAGAGGGAAGG + Intergenic
912954707 1:114146721-114146743 TCTTCTTCAGCTTAGAGAGAAGG + Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
916207554 1:162330273-162330295 TCCTTGCCTGCTTAGAAGGGAGG - Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
922182478 1:223246245-223246267 TCCTCACAAGCTGAGAAGGATGG + Intronic
922804781 1:228379643-228379665 TCCTGGCCAGCTTAGATTTATGG + Intergenic
924618311 1:245634400-245634422 TGCTCCCAATCTTAGAGGGAAGG + Intronic
1067770123 10:49116595-49116617 TCCTCACTCCCTTAGAGGGAAGG - Intergenic
1079003661 11:16777856-16777878 TCATGGCCTGGTTAGAGGGAAGG + Intergenic
1088643699 11:111898454-111898476 TCCACAGCAGCTTACAGGGAGGG - Intergenic
1090137051 11:124209777-124209799 CCCTCTCCAGCTTGGAGGTAGGG + Intergenic
1090603873 11:128401329-128401351 TCCTCGCCAGATCAGTGGAAGGG + Intergenic
1096452018 12:51751194-51751216 TCCTCTCTACCTTAGAGAGAAGG + Intronic
1096529028 12:52231988-52232010 ACCTGGCCAGCTTATTGGGAGGG + Intergenic
1097601073 12:61694328-61694350 TGCTCCCCAGCTGGGAGGGAGGG - Intergenic
1098551152 12:71762616-71762638 TCCTCTCCAGCTTAGGCGAAAGG - Intronic
1099894963 12:88633942-88633964 TCCTTCCCAGTTTGGAGGGAAGG - Intergenic
1102545446 12:113651562-113651584 TCCTTGCCAATTTGGAGGGAAGG + Intergenic
1113896268 13:113766326-113766348 TCCACGCCAGCTCACAGGGCTGG + Intronic
1117012828 14:51488283-51488305 TCCACGACAGCTGAGAGGAAGGG + Intergenic
1122747123 14:103904662-103904684 TCCTGGCCAGGCCAGAGGGAAGG - Intergenic
1125579286 15:40774226-40774248 TCCAGGCCAGCTTAGAGCCAAGG - Intronic
1125607821 15:40952331-40952353 TCCTGGCCAGTTTAGAGAGAAGG + Intergenic
1128088101 15:64899493-64899515 TCCTGGGCACCTTTGAGGGAAGG - Intronic
1129894779 15:79095058-79095080 TCCTCTCCACCTTTGAGGGAGGG - Intergenic
1130939881 15:88498582-88498604 TCCTCACCAGGTTTGAGAGATGG - Intergenic
1135177408 16:20242854-20242876 TCTTCCCCAGCTAACAGGGATGG + Intergenic
1141217607 16:82039676-82039698 TCCTGCCAAGCTTAGAGGGTAGG - Intronic
1152151510 17:78604152-78604174 TCCTGGCCAGCTTGGCAGGATGG - Intergenic
1155202461 18:23529129-23529151 TCTTCGGCATCTTAGAGGAAGGG - Intronic
1158220554 18:55146274-55146296 TCCTCCCCAGGTTGGTGGGAAGG + Intergenic
1160312325 18:77807401-77807423 TCACCGCCAGCTAAGAGTGAAGG + Intergenic
1162561689 19:11421189-11421211 TCCTCGCCAGCTTAGAGGGAAGG - Exonic
1164540896 19:29120856-29120878 TCCTCCCCAACTTGGAAGGAGGG - Intergenic
1168113600 19:54208728-54208750 TCCACGGCAGCCTGGAGGGAGGG + Intronic
1168308510 19:55449690-55449712 TCCTCCACAGCTGAGGGGGAAGG + Intergenic
1168667616 19:58216731-58216753 TTCTCGCGAGCTGCGAGGGAAGG - Intergenic
926054884 2:9768670-9768692 TTCTCCCCAGCTGAGAAGGAGGG - Intergenic
926893283 2:17657481-17657503 ACCTCACCAGCCTATAGGGAAGG - Intergenic
927406743 2:22779205-22779227 TCCTCGTCACCTTAGAAAGAAGG + Intergenic
927719929 2:25376136-25376158 TCCTCGCCAGGATTGAGGAAAGG + Intergenic
929619607 2:43341442-43341464 TCCTCTGCAGCTAAGAGGAAGGG - Intronic
931370842 2:61661173-61661195 TCCCTGCCCTCTTAGAGGGAGGG + Intergenic
942961869 2:181839157-181839179 TCCTTTCCAGCTTAGAAGGCTGG - Intergenic
1170715555 20:18828157-18828179 CCCACCCCAGCTCAGAGGGAGGG - Intronic
1170742302 20:19068876-19068898 TCAGCAACAGCTTAGAGGGAAGG - Intergenic
1171359009 20:24573550-24573572 TCATCGCCAGCTTACACTGATGG + Intronic
1173672041 20:44805646-44805668 TTCCCACCATCTTAGAGGGAAGG + Intronic
1174096367 20:48092697-48092719 TCATCACCAGCTTTGATGGATGG - Intergenic
1183505047 22:38203989-38204011 TCCTGCCCAGCTTTGAGGGTGGG - Intronic
1184892083 22:47386301-47386323 TCCTCGCCAGCCAGTAGGGACGG + Intergenic
1184892313 22:47387559-47387581 TCCTCGCCAGCCAGTAGGGACGG + Intergenic
1184922869 22:47618151-47618173 TCCTCGGCAGCAGGGAGGGAAGG - Intergenic
950120193 3:10476627-10476649 TCCATGCCAGCTTGGCGGGAGGG + Intronic
950734439 3:14993980-14994002 TCCACAGCAGCTTAGAGGCAGGG + Intronic
952905751 3:38138276-38138298 TCCTCGCCATCCTCGAGGGCAGG + Intergenic
954090098 3:48277356-48277378 TCCTCGGAAGCTTAATGGGATGG + Intronic
956182229 3:66528136-66528158 TCCTTGCCAGCTTCTAGGGATGG - Intergenic
963433063 3:145234232-145234254 ACATTGCCAGCTTAGAGGGGCGG + Intergenic
963841070 3:150107072-150107094 TCATCACCAGCTTTGATGGATGG - Intergenic
967772443 3:193348968-193348990 TCCTAACCACCTGAGAGGGAGGG - Intronic
968281980 3:197484241-197484263 TTCTCGCAAGGGTAGAGGGAAGG - Intergenic
969148321 4:5143723-5143745 TGCTGGCCAGTTTGGAGGGAGGG - Intronic
976016499 4:80560885-80560907 ACCTCGCCACCCTAAAGGGAAGG + Intronic
982090770 4:151878242-151878264 TACTGGCCAGCTTTGAGGGCAGG + Intergenic
985361145 4:189177468-189177490 TCCTCCCCAGCTAATGGGGAAGG + Intergenic
1003394897 6:5744601-5744623 TCCTCAGCAGCTTATCGGGAAGG + Intronic
1005059239 6:21761128-21761150 TCCCCGCGAGCTGAGAGGGCCGG - Intergenic
1006022742 6:31126895-31126917 TCCTCGCAAGATAAGAGGGGTGG - Intronic
1013528961 6:111001743-111001765 TTATCACCAGCTTAGTGGGAGGG + Intronic
1015197159 6:130536711-130536733 TCCTGCCCAGTTAAGAGGGATGG - Intergenic
1016996900 6:149967162-149967184 TCAGGTCCAGCTTAGAGGGATGG - Intronic
1018239009 6:161754145-161754167 GCCTCAACAGCTTACAGGGAAGG + Intronic
1019770475 7:2881061-2881083 TCCTCGGCAGCCTTGTGGGAGGG - Intergenic
1021130919 7:16912726-16912748 ACCTCGCCACCCTGGAGGGAAGG - Intergenic
1022242958 7:28530628-28530650 TCTTCAGCAGCGTAGAGGGAGGG - Intronic
1034407136 7:150912182-150912204 TCCTCCCCAACTTAGGGGGAGGG - Intergenic
1039573462 8:38605023-38605045 ACCTGGCCAGCTTAGACGTAAGG - Intergenic
1040636451 8:49279947-49279969 TACTGGCCATCTAAGAGGGAAGG + Intergenic
1042421304 8:68592437-68592459 TTATTGCCAGCATAGAGGGATGG + Intronic
1048373407 8:133800222-133800244 GCGTGGCCAGCTGAGAGGGAGGG + Intergenic
1049205483 8:141361637-141361659 CCCCCGCCAGCCTGGAGGGAGGG + Intronic
1049291525 8:141805498-141805520 TCCTGGCCAGCATGGAGGGAAGG + Intergenic
1058961902 9:109999459-109999481 GCCTCTCCAGTTTAGGGGGATGG + Intronic
1059384210 9:113951227-113951249 TCCTCATCAGATTAAAGGGAGGG + Intronic
1061942420 9:133890923-133890945 TCCTTGCCAGTTTGCAGGGATGG - Intronic
1194818945 X:98481924-98481946 TCCTGGCAAGCTGTGAGGGATGG + Intergenic
1199796313 X:151200938-151200960 TCCTCGCCAGCAAAGCTGGACGG + Intergenic