ID: 1162561827

View in Genome Browser
Species Human (GRCh38)
Location 19:11421751-11421773
Sequence TTTCCTCCACGAGGCCCAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162561822_1162561827 22 Left 1162561822 19:11421706-11421728 CCTGCACGTCGTGGCCCTGGAGC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1162561827 19:11421751-11421773 TTTCCTCCACGAGGCCCAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 161
1162561824_1162561827 7 Left 1162561824 19:11421721-11421743 CCTGGAGCTGCGCCTGCAGTTTC 0: 1
1: 0
2: 1
3: 19
4: 237
Right 1162561827 19:11421751-11421773 TTTCCTCCACGAGGCCCAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 161
1162561825_1162561827 -5 Left 1162561825 19:11421733-11421755 CCTGCAGTTTCAGCAGCTTTTCC 0: 1
1: 0
2: 1
3: 36
4: 277
Right 1162561827 19:11421751-11421773 TTTCCTCCACGAGGCCCAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 161
1162561823_1162561827 8 Left 1162561823 19:11421720-11421742 CCCTGGAGCTGCGCCTGCAGTTT 0: 1
1: 0
2: 1
3: 16
4: 150
Right 1162561827 19:11421751-11421773 TTTCCTCCACGAGGCCCAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162561827 Original CRISPR TTTCCTCCACGAGGCCCAGC AGG Exonic
900206791 1:1435060-1435082 CTTCCTCCAAGAAGCCCAGGTGG + Intronic
900458245 1:2787591-2787613 TCTCCTCCAGGCGGCCCAGGCGG + Exonic
904625581 1:31800107-31800129 TCTCCTTCAGGAGGCACAGCAGG - Exonic
904988691 1:34573886-34573908 TCTTCTCCAAGAGGCCCTGCTGG - Intergenic
907237326 1:53061661-53061683 TTTCCGGGAAGAGGCCCAGCAGG + Intergenic
909036946 1:70604255-70604277 TTCTCTCCATGAAGCCCAGCTGG - Intergenic
911182732 1:94875509-94875531 TGTCCTCCAGGAGGCTCAGAAGG - Intronic
915191542 1:154154855-154154877 TTTCCTGCTGGAGGCCCAGCGGG - Exonic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
918184036 1:182111569-182111591 TTAGCTCCATGAGACCCAGCTGG - Intergenic
920101888 1:203522006-203522028 TTCCCTCCACGGAGGCCAGCTGG - Intergenic
922218737 1:223541644-223541666 TTCCCTCCACTGGGCCCACCGGG + Exonic
1065686723 10:28293019-28293041 TTTCCTACACAAGACCCAGAAGG + Intronic
1067549441 10:47223530-47223552 TTTCCTGCACCAGGCTCAGTGGG + Intergenic
1068112302 10:52694409-52694431 TCTCCTCCTGGAGGCCCAACAGG + Intergenic
1069744843 10:70708613-70708635 GGTCCCCCACCAGGCCCAGCAGG - Exonic
1069807316 10:71134067-71134089 TTTCCACCACCAGGCCCTCCTGG + Intergenic
1070734878 10:78856590-78856612 TCTGCTCCAAGAAGCCCAGCTGG + Intergenic
1070914471 10:80144267-80144289 GCTCCTCCAGCAGGCCCAGCAGG - Exonic
1074248206 10:111714904-111714926 TTACCTCCAGGAGCCCCACCAGG + Intergenic
1075266304 10:121001978-121002000 TTTCCTCCATCAGGCTCAGGTGG + Intergenic
1075921791 10:126219374-126219396 TTTTCTCCCCGTGGGCCAGCAGG + Intronic
1076209066 10:128626117-128626139 TTTCCTCCTCACTGCCCAGCAGG + Intergenic
1076875059 10:133211708-133211730 CCACCTCCAGGAGGCCCAGCAGG - Exonic
1076902247 10:133345496-133345518 TTTCCTCGACAACCCCCAGCGGG - Intronic
1079069486 11:17330941-17330963 ATTCCTCCATCAGGGCCAGCTGG + Exonic
1080861748 11:36155929-36155951 TTTCCTCCACAGAGCCCTGCAGG - Intronic
1084595348 11:70113491-70113513 TTTCCTCCAGAGGACCCAGCCGG + Intronic
1088315071 11:108498615-108498637 TTTCCTCCACGGGGCCTATGGGG - Intergenic
1089690421 11:120183697-120183719 TGTCCTCCAAGAGGCCCTCCTGG + Intronic
1091433090 12:453185-453207 TTTCCTCTCCGGGGCCGAGCGGG + Intergenic
1091433112 12:453256-453278 TTTCCTCTCCGGGGCCGAGCGGG + Intergenic
1091433134 12:453327-453349 TTTCCTCTCCGGGGCCGAGCGGG + Intergenic
1091433156 12:453398-453420 TTTCCTCTCCGGGGCCGAGCGGG + Intergenic
1091433178 12:453469-453491 TTTCCTCTCCGGGGCCGAGCGGG + Intergenic
1092163586 12:6329371-6329393 TGTCCTCCAGGCAGCCCAGCAGG + Exonic
1096092789 12:48914502-48914524 TTTCCTCCAGGAGACTGAGCCGG - Exonic
1096229163 12:49887931-49887953 GTTCCTCCACCATGCACAGCTGG - Intronic
1097083361 12:56449374-56449396 TTTCCGCCACCAGGCTCAGCTGG + Exonic
1097130722 12:56809144-56809166 TTTTGTCCACTTGGCCCAGCAGG + Intergenic
1103344198 12:120238443-120238465 CTCCCTCCACCATGCCCAGCTGG + Intronic
1104872728 12:132011936-132011958 TTTCCCCCTGGAGGCCCTGCTGG + Intronic
1104981469 12:132574802-132574824 TCTGCTCCCCGTGGCCCAGCCGG - Intronic
1105037988 12:132940414-132940436 TTTCCTCCATGAGGCCCACAGGG - Intronic
1105704418 13:22960553-22960575 TCTCCTCCTCTAGGGCCAGCAGG + Intergenic
1110761689 13:79237699-79237721 TGTACACCACGATGCCCAGCTGG - Intergenic
1113086759 13:106576737-106576759 TTTCCTCCAGGAACCCCACCAGG - Intergenic
1116257310 14:42572020-42572042 TCAGCTCCAGGAGGCCCAGCAGG + Intergenic
1118370820 14:65135852-65135874 TTTCCTCCAGGACACTCAGCAGG + Intergenic
1118736790 14:68706735-68706757 TCTCCTCCTCTAGGCCCAGCAGG + Intronic
1118919165 14:70133975-70133997 TTCCCTCCACAGAGCCCAGCTGG - Intronic
1119724700 14:76914904-76914926 TTTCCTCCCTGAGGCCCACCTGG - Intergenic
1121004822 14:90483507-90483529 TCTCCAACAGGAGGCCCAGCAGG - Intergenic
1121017321 14:90556641-90556663 TTTCCACCACGAGGATCAGTCGG - Intronic
1121183054 14:91943829-91943851 TTTCCTCCATCAGGACCTGCTGG - Intronic
1121216466 14:92252231-92252253 TTTCCTAAAGCAGGCCCAGCAGG - Intergenic
1122237420 14:100339746-100339768 CTTCTTCCCCAAGGCCCAGCAGG - Intronic
1122701886 14:103595289-103595311 TTTCCTCCCCGTGGCCCACTGGG + Intronic
1124439787 15:29677662-29677684 CTTCCTCCACGAAGCCCTCCAGG - Intergenic
1125448386 15:39782631-39782653 GTTCCTCGAGGAGGCCCGGCGGG - Exonic
1127661178 15:61101738-61101760 TTTCCTCCACCACACACAGCAGG - Intronic
1132727056 16:1343447-1343469 TGTCCTCCAGCAGCCCCAGCAGG - Exonic
1133332267 16:4982117-4982139 TGTCCTCCACCAGGGCCAGGAGG - Intronic
1134091149 16:11392313-11392335 TCACCTCCACATGGCCCAGCAGG + Exonic
1138602701 16:58066144-58066166 ACTTCTCCATGAGGCCCAGCAGG - Intergenic
1139890893 16:70252729-70252751 TTACATCCCCGAGGCGCAGCTGG + Exonic
1142207717 16:88791905-88791927 TTTACTCCACGAGACCACGCGGG - Intergenic
1142667018 17:1469044-1469066 CTTCCTACACGAGGCCCAGCAGG + Intronic
1142854930 17:2724177-2724199 GTTCCTCCGCGGGGCCGAGCGGG - Intergenic
1145016215 17:19400079-19400101 TTTGCTCCACAAGGGCCAGCTGG + Intergenic
1146821115 17:35984276-35984298 TTCCCTCCAGGAGGCCCTGCTGG + Intronic
1146945217 17:36869084-36869106 TTCCCCCCATGAGGCCCAGGGGG - Intergenic
1148862824 17:50613423-50613445 CCTCCTCCAAGAGGCCCAGAAGG - Intronic
1149627842 17:58092408-58092430 TCTCCTCCAGGAAGCCCTGCAGG - Exonic
1151197933 17:72445307-72445329 TTTCTTCCAGGAGGCCCTGCTGG + Intergenic
1151750190 17:76032753-76032775 TGTGCTCCTCTAGGCCCAGCTGG - Intergenic
1152317726 17:79590611-79590633 TTTCCTGGAGGAGCCCCAGCTGG - Intergenic
1152358711 17:79819884-79819906 TTGCCTGCAAGAGACCCAGCTGG + Intergenic
1153791891 18:8586479-8586501 TTTTGTCCAAGAGGGCCAGCTGG + Intergenic
1155322637 18:24633673-24633695 TATTCTCCAAGAGGACCAGCAGG + Intergenic
1161025320 19:2034046-2034068 CTTCCTCCTCTAGGCCCAGCTGG + Intronic
1161126283 19:2559908-2559930 GTTCCTCCACGAGGCCCTGAGGG + Intronic
1161425418 19:4200178-4200200 CTCCCTCCCCGGGGCCCAGCTGG - Intronic
1161562067 19:4978947-4978969 CTTCCACCAAGAGGCCCTGCGGG - Intronic
1161605398 19:5212081-5212103 CTTCATCCACGAGGCCCTGCTGG - Exonic
1162561827 19:11421751-11421773 TTTCCTCCACGAGGCCCAGCAGG + Exonic
1164512342 19:28907846-28907868 TTTCATCAAGGAGGCCCAGGAGG - Intergenic
1165407768 19:35641612-35641634 AATCCTCCACCAGGCCCAGTAGG - Intergenic
1167506558 19:49873948-49873970 TGTCCTGCACAAGGCCCAGGGGG + Intronic
925925143 2:8664892-8664914 TTTCCTCCACAGGGCCTATCAGG + Intergenic
927207963 2:20621917-20621939 TTTTCTCCTCCAGGCCCAGCTGG + Intronic
927957554 2:27218098-27218120 TTTTCTGCAGGATGCCCAGCAGG - Intronic
929599245 2:43194629-43194651 TCTCCTCCAGAAGGCCCACCAGG - Intergenic
932676558 2:73786687-73786709 TTTCCTCCACAAAACCCATCAGG + Intronic
932677143 2:73791585-73791607 TTTCCTCCACAAAACCCATCAGG + Intronic
932677728 2:73796482-73796504 TTTCCTCCACAAAACCCATCAGG + Intronic
932678314 2:73801380-73801402 TTTCCTCCACAAAACCCATCAGG + Intronic
932678900 2:73806280-73806302 TTTCCTCCACAAAACCCATCAGG + Intronic
937709588 2:124964077-124964099 TGTGCACCACCAGGCCCAGCTGG + Intergenic
938338369 2:130518772-130518794 TTGCCATCAAGAGGCCCAGCTGG - Intergenic
938343207 2:130549029-130549051 ATTCCTCCGGGAGGCCCACCGGG - Intronic
938346626 2:130571693-130571715 ATTCCTCCGGGAGGCCCACCGGG + Intronic
938351470 2:130601978-130602000 TTGCCATCAAGAGGCCCAGCTGG + Intergenic
938408622 2:131046244-131046266 TTTCTTCCCCGAGGCCCACTCGG + Exonic
940722243 2:157294652-157294674 TTTCCCCCATGAGCCCCAGTAGG + Intronic
940984176 2:160036442-160036464 TTTCCCCCATGAGGCCTACCAGG - Intronic
946274758 2:218622793-218622815 TTTCCTCCAAGAGGAGCAGAAGG + Exonic
948560594 2:238848815-238848837 TCTCCTCGGCGAGGCCCCGCGGG + Intronic
1172195589 20:33089539-33089561 TACAATCCACGAGGCCCAGCTGG - Exonic
1174219019 20:48937361-48937383 TCTTCTCCACTAGGCCCAGTAGG - Intronic
1179626404 21:42651998-42652020 TTTCCTCCAAGAGCCCCAGAAGG - Intergenic
1182107661 22:27700798-27700820 TTCCCACCCCGAGGCCCACCGGG - Intergenic
1182283510 22:29231402-29231424 CTCCCTCCTCCAGGCCCAGCAGG + Intronic
1182796598 22:32995532-32995554 CTTCCTCCACGTGGCACAGGTGG + Intronic
1182892471 22:33830415-33830437 TTTCCTCCACGAGAGGCAGGAGG + Intronic
1183327597 22:37202911-37202933 TTTCCTGCCCCAGGCCCTGCGGG + Intergenic
1185165823 22:49261613-49261635 TCTCTACCACGATGCCCAGCAGG - Intergenic
1185376341 22:50484211-50484233 TGTACTCCACGAGGCCCTGTGGG + Exonic
949369580 3:3319625-3319647 TGTCCTCCACCACACCCAGCAGG + Intergenic
950004735 3:9684493-9684515 CTCCCTCCACCAGGCCAAGCTGG + Intronic
952729791 3:36626751-36626773 CTTCATCCACCAGGCCCAGCAGG - Intergenic
954424794 3:50437697-50437719 TTTCCACCTGCAGGCCCAGCAGG + Intronic
954839571 3:53498588-53498610 TTCCCTCCACCAGGCCCAGAAGG + Intronic
959580438 3:107977681-107977703 TTTCCTCCAGGAGGTCAGGCAGG + Intergenic
963970961 3:151429181-151429203 TTTCCTCCATGAGTCTCTGCTGG - Intronic
967233368 3:187362259-187362281 TTACCTCCAGGAGCCCCACCAGG - Intergenic
971075131 4:23139336-23139358 CTTCCTCAACGAGGCACACCTGG - Intergenic
974607822 4:64174811-64174833 TTCCACCCACTAGGCCCAGCAGG - Intergenic
976178829 4:82380490-82380512 TTCCGCCCACGTGGCCCAGCAGG + Intergenic
982791052 4:159592077-159592099 TTTGCTCCACCAGGCCCTGAAGG + Intergenic
985788321 5:1911504-1911526 GTTCCTCCCAGAGCCCCAGCTGG + Intergenic
990848726 5:60176081-60176103 TTTCCTCCACAAACCCCACCAGG - Intronic
991647414 5:68815089-68815111 TTACCTCCAGGAAGTCCAGCAGG - Intergenic
995433128 5:112104892-112104914 CTTCCTTCAAGAGACCCAGCCGG + Intergenic
995433956 5:112114573-112114595 TTTCCTCTATGAGGCTCAGCTGG - Intergenic
998520827 5:142798909-142798931 CTTCATCCACCAGGCCAAGCTGG + Intronic
998977841 5:147667974-147667996 TTTGCTCCAAGAGACACAGCTGG - Intronic
1002957536 6:1881784-1881806 TTTCCTGCAAGATGCACAGCAGG + Intronic
1007232287 6:40356629-40356651 TTACTTCCCCCAGGCCCAGCAGG - Intergenic
1007702477 6:43772978-43773000 TTTCCTCCTTGGGGCCCAGGAGG + Intronic
1011255283 6:85414403-85414425 TTTCCTCCAGGATCTCCAGCTGG - Intergenic
1014357567 6:120432111-120432133 TTTCGCCCACTTGGCCCAGCAGG - Intergenic
1018937474 6:168283260-168283282 TGTCCTACAGGAGGCCCAGAGGG - Intergenic
1019018669 6:168899750-168899772 TTTCCTCCAGGACACCCAGCTGG - Intergenic
1019736297 7:2651346-2651368 TTTCCTCCAGGAGGCTCTTCAGG - Intronic
1022505706 7:30907729-30907751 TTCCCTCCAGGAGGGCCACCAGG - Intergenic
1023979748 7:45061865-45061887 TTACCTCCATGAGCCCCACCAGG - Intronic
1024162763 7:46695445-46695467 TTACCTCCAGGAGCCCCACCAGG + Intronic
1024396538 7:48875545-48875567 TTTCTTCCTCAGGGCCCAGCAGG + Intergenic
1027250176 7:76393831-76393853 TTTCTTCCCCGCGGCCCAGGCGG + Exonic
1027486350 7:78766385-78766407 TTTCCTCCCCCAGCCCCAGATGG + Intronic
1029026408 7:97421459-97421481 TTTACACCAGGAGTCCCAGCAGG - Intergenic
1029419065 7:100462912-100462934 GTTTCACCACGAGGCCAAGCTGG - Intronic
1029461232 7:100694645-100694667 TTTCCTCCAGGAAGCCCGCCTGG + Intergenic
1029596095 7:101538327-101538349 GTGCCTCCACGAAGCTCAGCCGG + Intronic
1033615732 7:143012505-143012527 TTTCCCCCTCCAGGCCCAGTTGG + Intergenic
1035578890 8:727715-727737 TTCCCTACAGAAGGCCCAGCCGG + Intronic
1037823537 8:22147414-22147436 TTGCCCCCAGGAGGCCAAGCAGG + Exonic
1041139546 8:54801654-54801676 TTTCCTCCAAGAACCCCACCAGG - Intergenic
1042148290 8:65755214-65755236 TTTCCTCAAGTTGGCCCAGCTGG + Intronic
1043151860 8:76727853-76727875 GTTCCTCCCCGAGGCTCAGCAGG + Intronic
1045198818 8:99957797-99957819 TTACCTACAGGAGGCCCATCAGG + Intergenic
1046255822 8:111694773-111694795 TTTCCTCCACCACACCTAGCAGG - Intergenic
1046262430 8:111786533-111786555 TTTCCTGCAGCAGGCCCAGTAGG + Intergenic
1049146839 8:141006607-141006629 TCCCCTCCACAAGGCTCAGCAGG + Intergenic
1049682434 8:143925569-143925591 TCTCCTCCTCGATGCGCAGCCGG + Exonic
1052759946 9:32579893-32579915 TTTCCACCAGGAGGCGCAGTTGG - Intergenic
1055069104 9:72148611-72148633 GTTCCTCCATGAAACCCAGCTGG - Intronic
1057004669 9:91546834-91546856 TTCCCTCCAGGAACCCCAGCAGG + Intergenic
1057515296 9:95715385-95715407 TTTCCTCCTGGAAACCCAGCTGG + Intergenic
1057828215 9:98387297-98387319 TTTCCCCCAGGAGGCCAAGAGGG + Intronic
1058836610 9:108863123-108863145 TGTCCTCCACGATGCCCATCTGG - Exonic
1058936925 9:109778433-109778455 TTTCCAGCACAAGCCCCAGCAGG - Intronic
1059218087 9:112585516-112585538 TGTCCTCCACGGGGCTCAGGGGG + Intronic
1186506002 X:10092785-10092807 TTTACGCCATGAGGCCAAGCAGG + Intronic
1187269702 X:17768672-17768694 CTTCCTCCACAGGGCCCACCAGG - Intergenic
1187465754 X:19526160-19526182 TTTCCTCCAGGAACCCCACCTGG - Intergenic
1190055375 X:47178420-47178442 TTCCCTCCCCGAGCCCCTGCTGG + Intronic
1194776007 X:97965633-97965655 TATCCTCCACGTGGCCAAACAGG + Intergenic
1196230798 X:113218494-113218516 TTTCCTACTCCAGGCTCAGCTGG + Intergenic
1198312647 X:135436733-135436755 CCTCCTCCAGGAAGCCCAGCAGG - Intergenic
1198608203 X:138368031-138368053 TTTTCTCCACGAGGCCTGCCAGG - Intergenic